Abstract
Sepsis, a severe infection, often leads to an overwhelming inflammatory response. Transfer RNA (tRNA)-derived small RNAs (tsRNAs), a emerging type of small RNAs, is crucial in various biological activities. Nevertheless, the connection between tsRNAs and sepsis is still unknown. We attempt to uncover the functions that these small RNAs play in sepsis. Our studies in humans, cells, and animal models revealed a significant downregulation of tiRNA-Glu-TTC-003 in the plasma of sepsis patients, in vitro macrophage inflammation models, and in the plasma and tissues of mice subjected to cecal ligation and puncture (CLP). Subsequent experiments revealed that the administration of tiRNA-Glu-TTC-003 agomir augmented the survival rate of CLP mice, mitigated organ damage, and attenuated inflammatory responses. In cellular experiments, we observed that overexpression of tiRNA-Glu-TTC-003 ameliorated the inflammatory state of cells and inhibited the expression of inflammation-related factors in M1 macrophages. Additionally, through target gene prediction and screening, we found that tiRNA-Glu-TTC-003 may interact with triggering receptor expressed on myeloid cells 2 (TREM2) to exert its functions. In THP-1 cells, the application of tiRNA-Glu-TTC-003 mimics resulted in an upregulation of TREM2 at both mRNA and protein levels, alongside a downregulation of Toll-like receptor 4 (TLR4) and its downstream effector, myeloid differentiation factor 88 (MyD88). In conclusion, tiRNA-Glu-TTC-003 demonstrates significant anti-inflammatory and protective effects in CLP mice and macrophage inflammation models. These findings suggest that tiRNA-Glu-TTC-003 may be a major factor in the inflammatory response of sepsis and provide a new idea for future treatment.
Graphical Abstract
Keywords: Sepsis, tiRNA-Glu-TTC-003, inflammation, Macrophage polarization, TLR4/MyD88
Introduction
Sepsis represents a systemic inflammatory response syndrome triggered by infection, often leading to organ failure [1]. It remains a leading cause of mortality among children worldwide [2]. Sepsis can induce immune and microcirculatory dysregulation, as well as widespread tissue damage. Uncontrolled inflammatory responses may rapidly progress to septic shock, often accompanied by multiple organ failure [3]. Although progress has been made in our understanding of the pathophysiology of sepsis, the death rate in pediatric patients suffering from sepsis and septic shock continues to be alarmingly high. Given the incomplete understanding of its complex pathogenesis, clinical management predominantly depends on supportive care. As a result, it is essential to develop more targeted strategies to enhance diagnostic and therapeutic efficacy.
Immune dysregulation and inflammatory processes are central mechanisms underlying the onset and progression of sepsis [4, 5]. Macrophages, as the primary innate immune cells and antigen-presenting cells, play a vital role among immune cells, displaying considerable heterogeneity and plasticity [6]. Upon exposure to distinct stimuli, macrophages polarize toward either the M1 or M2 phenotype, thereby initiating pro- inflammatory or anti-inflammatory programs. When the M1/M2 balance is maintained, the resultant equilibrium effectively mitigates pathological inflammation [7, 8]. During the early stages of sepsis, pro-inflammatory factors like Interferon-gamma (IFN-γ) and lipopolysaccharide (LPS) initiate the polarization of M1 macrophages [9]. The ongoing increase in M1 macrophages leads to the excessive production and secretion of numerous pro-inflammatory cytokines and inducible nitric oxide synthase (iNOS) [10], which further aggravates inflammatory responses and tissue injury.
Recent studies have demonstrated a close association between tRNA-derived small RNAs (tsRNAs), which can be categorized into tRNA-derived fragments (tRFs) and tRNA halves (tiRNAs), and inflammatory conditions. These are short RNA fragments that originate from tRNAs. They are generated in particular situations such as oxidative stress, starvation, and other cellular stresses through cleavage by specific nucleases [11–13]. Studies suggest that tsRNAs are not mere byproducts of tRNA degradation or biogenesis; instead, they represent a class of highly expressed small RNAs with crucial biological roles. The clinical significance of tsRNAs has been thoroughly investigated in various cancers, such as pancreatic and colorectal cancer [14, 15]. Additionally, the role of tsRNAs is gaining increasing attention in inflammation-associated disorders, including inflammatory bowel disease, acute myocarditis, and Alzheimer’s disease [16–18]. For example, a recent study revealed that reducing tsRNA-Gln-i-0095 expression significantly dampens pro-inflammatory cytokine levels, thereby suppressing glial activation and the subsequent inflammatory response, and ultimately attenuating retinal inflammatory injury [19]. TsRNAs are capable of modulating macrophage polarization. Studies have demonstrated that exosomes might prevent the occurrence of M1 macrophage polarization by mediating the delivery of tsRNA-21,109 [20]. Recent findings suggest that tsRNAs may be strongly bound to organ injury and inflammatory responses in sepsis. For instance, in a mouse model of sepsis, a substantial number of tsRNAs were found to have altered expression [21]. With these studies as a foundation, we speculate that tsRNAs might serve as a crucial factor in the inflammatory responses associated with pediatric sepsis development.
Due to the current limited knowledge of the involvement of tsRNAs in sepsis,, we discovered a previously uncharacterized tsRNA, tiRNA-Glu-TTC-003, via tRFs&tiRNAs sequencing. Recent evidence shows that tsRNAs can interact with target genes, thereby influencing disease progression [22, 23]. Leveraging in-silico prediction, we pinpointed TREM2 as a high-confidence target of tiRNA-Glu-TTC-003. A study has shown that TREM2 suppresses TLR4 signaling and, via downstream transcription factors, modulates the transcription of inflammatory cytokines and the polarized phenotype of immune cells [24]. Guided by these findings, we first screened for the most discriminative tsRNA between paediatric sepsis patients and non-sepsis controls. We then dissected, through cell-based assays and animal models, how this tsRNA modulates inflammatory progression via the TREM2/TLR4 axis. The work lays the groundwork for future tsRNA-guided diagnostics and therapeutics in paediatric sepsis.
Materials and Methods
Study Population
In the pilot cohort, we collected plasma samples from 6 pediatric patients with sepsis and 6 with septic shock from the ward. After sample collection, tRFs and tiRNAs sequencing was performed. In the validation cohort, plasma samples were prospectively collected between January and July 2025 at the Children’s Hospital of Chongqing Medical University. Samples were obtained from children who met the 2024 International Consensus Definitions for Pediatric Sepsis and Septic Shock within 24 h of PICU admission. Control samples were drawn from non-septic children without significant inflammatory response who were hospitalized in the same PICU and were collected within 48 h of discharge from the unit. The plasma samples were processed by centrifugation at 1000 g for 10 min at 4 °C, and the supernatant was aliquoted and stored at −80 °C for subsequent analysis. The inclusion criteria for children with sepsis were as follows: (1) meeting the criteria of the 2024 International Consensus Definitions for Pediatric Sepsis and Septic Shock, with a Phoenix score of 2 or higher [25]; (2) age ranging from 29 days to 18 years; (3) having informed consent and complete clinical data. The inclusion criteria for children with septic shock were based on the presence of sepsis, with a cardiovascular score of at least 1 point in the Phoenix Sepsis Score, indicating the presence of severe hypotension, blood lactate > 5 mmol/L, or the use of vasopressor agents. Children who did not meet the above three criteria were excluded. Ethical approval for the clinical component of this study was granted, and informed consent was obtained from all participants or their legal guardians. The ethics approval number is (2024) Ethical Review (Clinical Research) Permit No. 465.
Establishment and Drug Administration in Animal Models
Male C57BL/6 mice were raised and fed in an animal center. The method used to create the sepsis mouse model was cecal ligation and puncture (CLP) [26]. Following a period for acclimatization, the mice underwent the modeling process. Initially, the mice were anesthetized based on their body weight. Once they were completely anesthetized, their abdominal fur was shaved, and the surgical site was sanitized. A midline incision in the abdomen was then made using scissors to reveal the cecum, which was ligated to 70%−80% of its length. Subsequently, a needle punctured the cecum, allowing a little fecal material to be gently expressed. The cecum was then put back to its original position and abdominal cavity was closed. In the control group, designated as the Sham group, mice underwent a sham operation in which ligation and puncture were not performed, while all other procedures remained consistent. Finally, the mice were injected subcutaneously with normal saline and placed back in their cages after recovering. After 24 h, the samples were collected and stored for subsequent analysis. For our animal experiments, the mice were divided into two groups: the CLP group and the CLP + agomir group. In the CLP + agomir group, in addition to undergoing cecal ligation and puncture, the mice were intraperitoneally injected with the tsRNA agomir at a dose of 5 OD per mouse to mimic the overexpression of this tsRNA in vivo. All animal procedures received approval from the Animal Ethics Committee. The ethical approval number for the animal study is CHCMU-IACUC20250217006.
Hematoxylin and Eosin Staining (H&E Staining)
Liver, lung, and kidney tissues were collected from mice in the CLP group and the CLP + agomir group and fixed in 4% paraformaldehyde for 24 h. Subsequently, the tissues underwent dehydration and paraffin embedding. After embedding, the tissues were sectioned at 4–5 μm thickness using a microtome and mounted onto glass slides for drying. The sections were then stained with hematoxylin and eosin (H&E) using an H&E staining kit (Servicebio, G1005, China). Following staining, the sections were scanned under a microscope, and five random fields of view were selected for blinded assessment of tissue injury in each section. The tissue injury scores were subsequently summarized. The scoring criteria for each organ were based on established standards from previously published literature [27–29].
Cell Culture and Transfection
For the cellular experiments, we selected two cell lines, THP-1 cells and RAW264.7 cells, for subsequent validation. THP-1 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S) in an incubator at 37 °C with 5% CO₂. THP-1 cells were divided into four groups: negative control(NC) group, NC + LPS + IFN-γ group, tsRNA-siRNA + LPS + IFN-γ group, and tsRNA-siRNA group. The cells were first treated with Phorbol 12-myristate 13-acetate (PMA) (100 ng/ml; Sigma, P1585, USA) for 24 h to induce differentiation into macrophages. After 24 h, the medium was replaced, and siRNA was mixed with the transfection reagent (Zeta Life, AD600150, USA) at a 1:1 ratio and incubated at room temperature for 10–15 min before being added to the cells for transfection. After a 24-hour transfection period, the medium was replaced again, and the cells were treated with LPS (100 ng/ml; MCE, HY-D1056, USA) and IFN-γ (20 ng/ml; PeproTech, 300-02-20UG, USA) for an additional 48 h. After 48 h, the cells or their supernatants were collected for subsequent experiments. RAW264.7 cells were cultured in high-glucose DMEM medium supplemented with 10% FBS and 1% P/S in an incubator at 37 °C with 5% CO₂. These cells were also divided into four groups: (1) negative control group, (2) negative control + LPS group, (3) tsRNA-siRNA + LPS group, and (4) tsRNA-siRNA group. RAW264.7 cells were seeded into plates and allowed to adhere until the cell density reached 40%−50%. The cells were then transfected with the same transfection reagent (Zeta Life, AD600150, USA). After a 24-hour transfection period, the cells were treated with LPS (100 ng/ml) for 6 h to induce an inflammatory model. After 6 h, the cells or their supernatants were collected for subsequent experiments. The tRNA-Glu-TTC-003 mimics, tRNA-Glu-TTC-003 inhibitors, and their corresponding negative controls were all purchased from GenePharma Co., Ltd., Shanghai, China.
Enzyme-Linked Immunosorbent Assay (ELISA)
The secretion levels of IL-1β, IL-6 and TNF-α in mouse serum, peritoneal lavage fluid (PLF) and cell supernatant were determined by using ELISA kits. All ELISA kits were purchased from Beyotime Biotechnology.
Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
Small RNA samples from human plasma, mouse plasma, tissue homogenates, and THP-1 cells were isolated using the miRcute miRNA Isolation Kit (TIANGEN, DP501, China). The cDNA was subsequently synthesized with the ABScript miRNA First-Strand Synthesis Kit(ABclonal, RK30170, China). The reverse transcription protocol is as follows: 37 °C for 50 min, followed by 85 °C for 5 min. Total RNA of THP-1 and RAW264.7 cell lines was isolated using an RNA extraction kit(Beyotime, R0027, China) followed by cDNA synthesis employing the ABScript III RT Master Mix(ABclonal, RK20433, China), the reverse transcription protocol was as follows: 37 °C for 2 min, 55 °C for 15 min, and 85 °C for 5 min. The synthesized cDNA was then utilized for qRT-PCR to assess mRNA levels, with specific primer sequences detailed in the table 2, table 3 and table 4. The PCR protocol consisted of an initial denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s.
Table 2.
Sequences of the primers-mouse
| Gene | Forward (5′−3′) | Reverse (5′−3′) |
|---|---|---|
| β-actin | GATGGTGGGAATGGGTCAGAAGG | TTGTAGAAGGTGTGGTGCCAGATC |
| Trem2 | GTACTGGTGGAGGTGCTGGAG | TGCCTGGAGGTGCTGTGTTC |
| IL-1β | CACTACAGGCTCCGAGATGAACAAC | TGTCGTTGCTTGGTTCTCCTTGTAC |
| IL-6 | CTCCCAACAGACCTGTCTATAC | CCATTGCACAACTCTTTTCTCA |
| TNF-α | ATGTCTCAGCCTCTTCTCATTC | GCTTGTCACTCGAATTTTGAGA |
| CD86 | AGCACTATTTGGGCACAGAGAAAC | GTGAAGTCGTAGAGTCCAGTTGTTC |
| iNOS | ATCTTGGAGCGAGTTGTGGATTGTC | TAGGTGAGGGCTTGGCTGAGTG |
| Tlr4 | AGGACTATGTGATGTGACCATTGATG | GATACACCTGCCAGAGACATTGC |
| myd88 | CGGCAACTAGAACAGACAGACTATC | TCTCAATTAGCTCGCTGGCAATG |
Table 3.
Sequences of the primers-human
| Gene | Forward (5′−3′) | Reverse (5′−3′) |
|---|---|---|
| β-actin | CCTGGCACCCAGCACAAT | GGGCCGGACTCGTCATAC |
| Trem2 | TGGCTGCTGTCCTTCCTGAG | GGAGGCTCTGGCACTGGTAG |
| IL-1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG |
| TNF-α | CCTCTCTCTAATCAGCCCTCTG | GAGGACCTGGGAGTAGATGAG |
| CD86 | CCAGATATTAGGTCACAGCAGAAGC | TGAAGTTAGCAGAGAGCAGGAAGG |
| iNOS | CTGGCAAGCCCAAGGTCTAT | TCCCCGCAAACATAGAGGTG |
| Tlr4 | TCTTGGTGGAAGTTGAACGAATGG | AGCACACTGAGGACCGACAC |
| myd88 | CGCCGCCTGTCTCTGTTCTTG | GGTCCGCTTGTGTCTCCAGTTG |
Table 4.
Sequences of the primers-tsRNA
| Gene | Forward (5′−3′) | Reverse (5′−3′) |
|---|---|---|
| U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCACGAATTTGCGTGTCAT |
| tiRNA-GLU-TTC-003 | TCTCCCTGGTGGTCTAGTGGC | GACGTGTGCTCTTCCGATCTAA |
Target Gene of tsRNA Prediction
It is acknowledged that specific tsRNAs are capable of performing functions akin to miRNAs [30]. Consequently, we utilized two websites to predict and screen tsRNA target genes: TargetScan (www.targetscan.org) and miRanda (www.microrna.org).
Immunohistochemistry (IHC)
IHC was employed to investigate the expression and localization of Triggering Receptor Expressed on Myeloid Cells 2(TREM2), with the aim of preliminarily assessing its association with macrophages. Paraffin-embedded sections of liver, lung, and kidney tissues were deparaffinized and rehydrated. Antigen retrieval was performed using Tris-EDTA antigen retrieval solution (pH 8.0) (Servicebio, G1206, China) for 30 min. The sections were then washed three times with PBS and blocked with serum for 30 min. Subsequently, the sections were incubated overnight at 4 °C with primary antibodies against TREM2 (1: 100, Zenbio, 510482, China). On the following day, the primary antibodies were removed, and the sections were washed three times with PBS before incubation with HRP-conjugated goat anti-rabbit IgG secondary antibodies (Servicebio, GB23303, China) for 60 min at room temperature. After incubation with the secondary antibodies, the sections underwent a color development reaction. Finally, the sections were scanned using a digital slide scanner for observation. The images obtained from IHC were processed using ImageJ software.
Western Blot (WB)
Total protein was first extracted from the cell samples using RIPA lysis buffer (MCE, HY-K1001, USA). After preparing a 10% polyacrylamide gel (EpiZyme Biotechnology, PG112, China), the protein samples were loaded onto the gel for electrophoretic separation of the target proteins. Following electrophoresis, the gel corresponding to the molecular weight of the target proteins was excised and placed on a PVDF membrane activated with methanol (Millipore, IPVH00010, USA) for electrotransfer. After electrotransfer, the membrane was blocked with a rapid blocking solution (NCMBio, P30500, China) for 10–15 min, followed by incubation with primary antibodies overnight on a rocker at 4 °C. On the following day, the primary antibodies were recovered, and the membrane was incubated with secondary antibodies. Finally, the membrane was developed using a highly sensitive ECL substrate (Meilunbio, MA0186, China).The primary antibodies used in this study included TREM2 (1:1000, Zenbio, 510482, China), TLR4 (1:1000, Zenbio, 617066, China), MYD88 (1:1000, Zenbio, 340629, China), and β-Actin (1:10000, ZSGB-BIO, TA-09, China), with β-Actin serving as the internal control. All bands were analyzed using ImageJ software.
Statistical Analysis
We conducted all the statistical analyses using GraphPad Prism 9.0 software. The expression levels of tiRNA-Glu-TTC-003 in the plasma of pediatric sepsis patients, septic mouse plasma and tissues, as well as macrophages, were compared to control groups using the t-test. We assessed survival rates using the log-rank (Mantel‒Cox) method. Tissue injury scores were compared using the t-test. Variations of inflammatory factors, polarization-related elements, TREM2, and TLR4/MYD88 were analyzed using one-way analysis of variance (ANOVA). Clinical data were analyzed using the corrected Wilcoxon test for continuous variables and the chi-square test or Fisher’s exact test for categorical variables. All cellular experiments included three biological replicates. A P-value of < 0.05 indicates a statistically significant difference, typically marked by one asterisk (*).
Result
TiRNA-Glu-TTC-003 is Downregulated in Plasma of Pediatric Sepsis Patients
In the pilot cohort (Fig. 1a), we performed tRFs and tiRNAs sequencing on plasma samples from six pediatric patients with sepsis and six with septic shock. Additionally, we collected plasma samples from clinical controls, sepsis, and septic shock pediatric patients (Fig. 1A) for validation. Subsequently, we identified differentially expressed tsRNAs from the sequencing results that simultaneously met the criteria of a P value less than 0.05 and a log2 fold change (log2FC) less than − 2. A total of 17 downregulated tsRNAs were identified. Among these, we selected the tsRNA with the smallest P value, tiRNA-Glu-TTC-003, as the target for further investigation (Fig. 1b). Within the pilot cohort (Fig. 1c), the plasma level of tiRNA-Glu-TTC-003 was significantly lower in patients with septic shock than in those with sepsis. In the validation cohort (Fig. 1d), compared with the clinical control group, the plasma level of tiRNA-Glu-TTC-003 was significantly decreased in pediatric patients with sepsis, with an even more pronounced reduction observed in patients with septic shock. The clinical characteristics of the children in the control, sepsis, and septic shock groups are detailed in Table 1.
Fig. 1.
TiRNA-Glu-TTC-003 is downregulated in the plasma of children with sepsis. (a) Schematic diagram of clinical sample collection. (b) Identification of differentially expressed tsRNAs. (c) Expression levels of tiRNA-Glu-TTC-003 in the clinical pilot cohort. (d) Expression levels of tiRNA-Glu-TTC-003 in the clinical validation cohort
Table 1.
Clinical data
| data | Clinical controls(n = 30) | Sepsis(n = 15) | Septic shock(n = 18) | P value |
|---|---|---|---|---|
| Sex(male/female) | 17/13 | 10/5 | 8/10 | 0.4350 |
| Age(years) | 4.1(2.0–10.2.0.2) | 6.1(2.7–9.0.7.0) | 7.2(1.2–9.7) | 0.9991 |
| Z-score | −0.4(−1.8-0.3) | −0.3(−0.8-0.6) | −0.8(−1.8-1.1) | 0.2421 |
| WBC(109/L) | 10.0(8.2–13.8) | 14.8(7.6–26.5) | 2.9(1.1–8.6) | 0.0058 |
| CRP(mg/L) | 2.1(0.8–7.9) | 112.3(37.3–134.1.3.1) | 59.1(36.5–167.1.5.1) | < 0.0001 |
| PCT(ng/ml) | 0.1(0.1–0.4) | 4.4(2.1–37.6) | 3.3(1.3–18.9) | 0.0001 |
| Bilirubin(umol/L) | 6.4(4.7–8.6) | 15.7(8.1-0.46.1.46.8) | 9.5(4.2–45.3) | 0.0137 |
| ALT(U/L) | 23.5(16.8–43.3) | 33.0(17.0–114.0.0.0) | 36.5(16.8–125.0) | 0.2386 |
| AST(U/L) | 37.5(28.0–96.0) | 87.0(30.0–168.0.0.0) | 45.5(25.0–231.3.0.3) | 0.2730 |
| Creatinine(umol/L) | 28.0(20.8–38.3) | 35.0(23.0–86.0) | 46.5(28.3–46.5) | 0.1186 |
| LDH(U/L) | 304.5(241.5–546.3.5.3) | 741.0(281.0–886.0.0.0) | 388.0(270.8–777.8.8.8) | 0.3468 |
| Lactic acid(mmol/L) | 0.7(0.6–1.1) | 0.7(0.6–1.1) | 2.3(0.8–4.4) | 0.0007 |
| Infection site(Number of patients) | ||||
| Respiratory | NA | 7 | 9 | 0.8487 |
| Gastrointestinal | NA | 3 | 6 | 0.3918 |
| Vascular | NA | 2 | 1 | 0.4390 |
| Skin | NA | 1 | 3 | 0.3808 |
| Nervous | NA | 2 | 0 | 0.1100 |
| Phoeniex score | NA | 2(2–4) | 5(3–7.3.3) | 0.0126 |
| Died/survived | 0/30 | 0/15 | 3/18 | 0.0195 |
Table 1 Clinical data, with the exception of gender and mortality/survival status, are presented as quartiles. Abbreviations used include: WBC for white blood cell count, CRP for C-reactive protein, PCT for procalcitonin, Z-score for weight-for-age Z-score, ALT for alanine aminotransferase, AST for aspartate aminotransferase, LDH for lactate dehydrogenase, and NA for not applicable. All variables were compared among the three groups, except those with NA values, which were compared between two groups only.
Downregulation of tiRNA-Glu-TTC-003 in Sepsis Mice and Macrophages
We collected plasma, liver, kidney, and lung tissues from mice subjected to CLP(Fig. 2a), as well as macrophages stimulated with inflammatory agents(Fig. 2b), to measure the expression levels of tiRNA-Glu-TTC-003. We found that the expression of tiRNA-Glu-TTC-003 was decreased in macrophages treated with LPS and IFN-γ(Fig. 2c). Additionally, our results showed that, compared with the Sham group, the expression of tiRNA-Glu-TTC-003 was also reduced in the plasma, liver, kidney, and lung tissues of sepsis mice(Fig. 2d).
Fig. 2.
TiRNA-Glu-TTC-003 is downregulated in both animal and cellular experiments. (a) Schematic diagram of animal experiments. (b) Schematic diagram of cell experiments. (c) The level of tiRNA-Glu-TTC-003 in macrophages. (d) The level of tiRNA-Glu-TTC-003 in plasma, liver, lung and kidney of sepsis model mice(n = 6)
Protective Role of tiRNA-Glu-TTC-003 in Septic Mice
The results demonstrated that the administration of tiRNA-Glu-TTC-003 enhanced the survival rate of CLP mice(Fig. 3a). Furthermore, tiRNA-Glu-TTC-003 mitigated damage to the lungs and kidneys but did not present a significant protective effect on liver function (Fig. 3b-c). Moreover, we found that the levels of inflammatory factors in CLP mice that were injected with tiRNA-Glu-TTC-003 agomir were significantly reduced (Fig. 3d-e).
Fig. 3.
Protective effect of tiRNA-Glu-TTC-003 on mice with sepsis. (a) Survival rates of CLP mice administered with tiRNA-Glu-TTC-003 agomir(n = 10). (b) H&E-stained images of tissues(n = 5). (c) Pathological injury scoring of tissues(n = 5). (d) Serum inflammatory factor expressions(n = 6). (e) PLF inflammatory factor expressions (n = 6)
Overexpression of tiRNA-Glu-TTC-003 Inhibits Inflammatory Responses and M1 Polarization in THP-1 and RAW264.7 Cells
We also examined the effects of tiRNA-Glu-TTC-003 on inflammatory responses in THP-1 and RAW264.7 cells. As depicted in Fig. 4, the overexpression of tiRNA-Glu-TTC-003 led to a notable decrease in the mRNA levels and secretion of inflammatory cytokines in both THP-1 and RAW264.7 cell lines (Fig. 4a-d).
Fig. 4.
Overexpression of tiRNA-Glu-TTC-003 reduced the inflammatory response. (a) mRNA levels of inflammatory factors in THP-1 cells. (b) mRNA levels of inflammatory factors in RAW264.7 cells. (c) Protein levels of inflammatory factors in THP-1 cells. (d) Protein levels of inflammatory factors in RAW264.7 cells
Knockdown of tiRNA-Glu-TTC-003 Promotes Inflammatory Responses in THP-1 and RAW264.7 Cells
Following tiRNA-Glu-TTC-003 knockdown, we observed a pronounced elevation of IL-6, TNF-α, and IL-1β in both THP-1 and RAW264.7 cells (Fig. 5a–d), indicating that loss of this tsRNA amplifies the macrophage-mediated inflammatory response.
Fig. 5.
The knockdown of tiRNA-Glu-TTC-003 promoted the inflammatory response. (a) mRNA levels of inflammatory factors in THP-1 cells. (b) mRNA levels of inflammatory factors in RAW264.7 cells. (c) Protein levels of inflammatory factors in THP-1 cells. (d) Protein levels of inflammatory factors in RAW264.7 cells
tiRNA-Glu-TTC-003 Regulates Macrophage Polarization
We next examined whether tiRNA-Glu-TTC-003 modulates polarization in human THP-1 and murine RAW264.7 macrophages. Overexpression of tiRNA-Glu-TTC-003 in both cell lines markedly attenuated mRNA levels of the M1 markers CD86 and iNOS, whereas its knockdown reciprocally promoted M1 polarization (Fig. 6a-d). Consistently, in THP-1 cells, enforced expression of tiRNA-Glu-TTC-003 reduced iNOS protein abundance, thereby dampening the inflammatory phenotype (Fig. 6e).
Fig. 6.
Expression of tiRNA-Glu-TTC-003 influences M1 polarization of macrophages. (a) CD86 and iNOS mRNA levels in RAW264.7 cells following tiRNA-Glu-TTC-003 overexpression. (b) CD86 and iNOS mRNA levels in RAW264.7 cells after tiRNA-Glu-TTC-003 knockdown. (c) CD86 and iNOS mRNA levels in THP-1 cells cells following tiRNA-Glu-TTC-003 overexpression. (d) CD86 and iNOS mRNA levels in THP-1 cells after tiRNA-Glu-TTC-003 knockdown. (e) iNOS protein expression in THP-1 cells following tiRNA-Glu-TTC-003 overexpression
TREM2 is a Potential Target of tiRNA-Glu-TTC-003
To elucidate the mechanism by which tiRNA-Glu-TTC-003 regulates inflammation and macrophage polarization, we utilized the miRanda and TargetScan databases to predict potential targets of tiRNA-Glu-TTC-003. Among the predicted target genes, TREM2 was identified as being associated with sepsis and macrophage polarization. Therefore, we selected TREM2 for further investigation. The complementary binding sites between tiRNA-Glu-TTC-003 and TREM2 are depicted in Fig. 7a. We examined how tiRNA-Glu-TTC-003 affects TREM2 expression. The IHC findings (Fig. 7b) revealed that, relative to the mice in CLP group, TREM2 level was markedly elevated in the lung and kidney tissues of mice treated with the CLP agomir, while no substantial change was detected in liver tissue(Fig. 7c). Moreover, overexpression of tiRNA-Glu-TTC-003 in THP-1 cells increased TREM2 expression levels (Fig. 7d-e), whereas its knockdown led to a substantial decrease in both(Fig. 7f-g).
Fig. 7.
TREM2 is a potential target for tiRNA-Glu-TTC-003. (a) Predicted binding site of tiRNA-Glu-TTC-003 in the 3 ‘-UTR of TREM2. (b) IHC result images of lung, liver, and kidney tissues. (×20) (n = 5). (c) Quantitative analysis of TREM2 IHC results. (d) mRNA level of TREM2 after overexpression of tiRNA-Glu-TTC-003. (e) Protein level of of TREM2 after overexpression of tiRNA-Glu-TTC-003. (f) mRNA level of TREM2 after knockdown of tiRNA-Glu-TTC-003. (g) Protein level of of TREM2 after knockdown of tiRNA-Glu-TTC-003
Overexpression of tiRNA-Glu-TTC-003 Inhibits the TLR4/MYD88 Signaling Pathway in Macrophages
Our research findings indicate that the combined treatment of LPS and IFN-γ promotes the levels of TLR4 and MYD88 in THP-1 cells. However, this phenomenon changes after overexpression of tiRNA-Glu-TTC-003. Overexpression of tiRNA-Glu-TTC-003 in THP-1 cells significantly inhibits the mRNA and protein levels of TLR4 and MYD88 (Figs. 8a-d).
Fig. 8.
The overexpression of tiRNA-Glu-TTC-003 inhibits the TLR4/MYD88 pathway in the macrophage dealed with LPS and IFN-γ. (a) mRNA level of TLR4. (b) Protein level of the TLR4. (c) mRNA level of MYD88. (d) Protein level of the MYD88
Discussion
Initially, we concentrated on the differential expression of tsRNAs in children suffering from sepsis compared to those with septic shock. Subsequently, we screened and validated a specific tsRNA: tiRNA-Glu-TTC-003, and conducted a series of follow-up studies. To this point, no dedicated studies exploring tsRNAs in relation to pediatric sepsis have been found.
In the pilot group, we observed that the level of tiRNA-Glu-TTC-003 in the plasma of individuals suffering from sepsis and those suffering from septic shock was different, and the individuals with septic shock showed a lower level. In the validation group, in contrast to non-sepsis children, the levels of tiRNA-Glu-TTC-003 in sepsis and septic shock patients were significantly decreased, and the decrease was more obvious in the septic shock patients. These findings suggest that tiRNA-Glu-TTC-003 is fundamentally tied to the occurrence and advancement of sepsis and septic shock. Moreover, research conducted by Zhou, M [31] and Zhang, L [32] has shown that tsRNAs are consistently and abundantly found in various body fluids, emphasizing their potential role as biomarkers for the early diagnosis of diseases. Based on our results, tiRNA-Glu-TTC-003 might be a feasible diagnostic biomarker that can be used for the early detection in sepsis and septic shock, offering a novel approach for clinical diagnosis.
To further explore the influence of tiRNA-Glu-TTC-003 in sepsis, we established a sepsis mouse model using the CLP method. We examined the expression levels of tiRNA-Glu-TTC-003 in the plasma and tissues of the control group mice and the CLP group mice. The results revealed that there were variations, and the expression level in the CLP mice was lower, which was consistent with the trend of the clinical sample detection. In order to conduct in-depth research on the function of tiRNA-Glu-TTC-003, we supplemented CLP mice with tiRNA-Glu-TTC-003 agomir. The findings revealed that mice in the CLP + agomir group exhibited alleviated symptoms, including reduced periocular secretions, improved fur condition, decreased diarrhea, and increased activity and food intake. Furthermore, supplementation with tiRNA-Glu-TTC-003 increased the survival rate of CLP mice and mitigated lung and kidney injuries. However, unexpectedly, the pathological sections of liver tissue indicated the presence of numerous lipid droplets, which resulted in an elevated liver injury score. A previous study found that silencing tRF-3001b in liver disease mouse model inhibited hepatocyte autophagy and reduced lipid vacuole formation [33]. This suggests that tiRNA-Glu-TTC-003 may regulate liver injury through alternative mechanisms in the liver. Furthermore, in addition to detecting the organ damage in CLP mice, we also measured the secretion levels of inflammatory factors after supplementing tiRNA-Glu-TTC-003 agomir. We found that the presence of tiRNA-Glu-TTC-003 significantly suppressed the expression of inflammatory cytokines in the serum and PLF of CLP mice. These findings highlight its protective effect on the organs and anti-inflammatory effect in CLP mice that are in an inflammatory state.
In our investigation, the overexpression of tiRNA-Glu-TTC-003 markedly diminished both mRNA levels and protein expression of inflammatory cytokines in two classes of macrophages (THP-1 and RAW264.7). At the same time, the expression of markers associated with M1 macrophages, including CD86 and iNOS, was also reduced. This observation corresponds with the findings of Shen, L [34], who indicated that the level of 5’-tiRNA-Gly will increase after muscle injury, and knocking down the expression of this tsRNA will lead to a decrease in the expression of factors related to M1 polarization (such as IL-1β, IL-6 and TNF-α). On the contrary, in THP-1 and RAW264.7 cells, knockdown of tiRNA-Glu-TTC-003 exacerbated the inflammatory response and promoted the M1-type polarization of macrophages, further confirming its critical role in regulating inflammation. In summary, tiRNA-Glu-TTC-003 can ameliorate the inflammatory state of cells through the inhibition of M1 macrophage polarization and a reduction in the levels of inflammatory factors.
Since tsRNAs can modulate functions by binding the 3’ untranslated region (3’UTR) of target genes [35], we utilized the TargetScan and miRanda databases to find probable target genes of tiRNA-Glu-TTC-003. The results indicated that the 3’ UTR of TREM2 might be a target of tiRNA-Glu-TTC-003. TREM2 is a novel immunoregulatory receptor that exerts protective effects by modulating the secretion of inflammatory factors. For instance, a recent study found that TREM2 improved the survival rate of septic mice, suppressed excessive inflammatory responses in cardiac tissue, and enhanced cardiac function [36]. We supplemented CLP mice with the tiRNA-Glu-TTC-003 agomir to explore the relationship between the two. The IHC results suggest that TREM2 was predominantly located in the cell membrane and cytoplasm. Moreover, the pre-injection of tiRNA-Glu-TTC-003 agomir promoted the expression of TREM2 in tissues, such as the lung and kidney tissues of mice, but the increase in liver tissues did not show statistically significant changes. A study on steatohepatitis suggested that, as inflammation progresses, the gradual release of TNF and IL-1β activates ADAM17 (a disintegrin and metalloproteinase domain-containing protein 17), inducing TREM2 protein cleavage [37], which may explain this observation. To further confirm the regulatory role of tiRNA-Glu-TTC-003 on TREM2, we overexpressed tiRNA-Glu-TTC-003 in THP-1 cells and found that both mRNA and protein levels of TREM2 were enhanced. Conversely, knockdown of tiRNA-Glu-TTC-003 suppressed TREM2 expression. These findings suggest that tiRNA-Glu-TTC-003 may regulate inflammatory responses by targeting TREM2.
TLR4 serves as a receptor that identifies pathogen-associated molecular patterns, particularly LPS [38]. Upon LPS stimulation, TLR4 activates downstream signaling pathways by binding to the adaptor protein MyD88, facilitating the synthesis and secretion of crucial pro-inflammatory cytokines [39]. It has been reported that TREM2 can interact with the TLR4 signaling pathway and inhibit TLR4-mediated inflammatory response [40]. Based on this background, we hypothesized that the TLR4/MYD88 signaling pathway might play a role in the inflammatory response and macrophage polarization mediated by tiRNA-Glu-TTC-003. Our experimental results indicate that overexpression of tiRNA-Glu-TTC-003 in THP-1 cells suppresses the expression of TLR4 and MYD88 at mRNA and protein levels, thereby inhibiting the activation of this signaling pathway and attenuating cellular inflammatory responses. This finding suggests that tiRNA-Glu-TTC-003 may play a corresponding role during the cytokine storm of sepsis by regulating the TLR4/MYD88 signaling pathway.
However, our research has some deficiencies. First, the generalizability and reliability of the experimental outcomes could be constrained by the relatively limited number of clinical samples available for analysis. Thus, it is necessary to increase the number of sample for validation. Secondly, compared with exogenous synthetic tsRNA mimics, the tsRNAs existing in our body contain a large amount of abundant modifications. Nevertheless, the current technical methods used to explore the functions and roles of tsRNA modifications are still limited and complex, thus making it rather difficult to conduct such research. Subsequent studies can use the sequences of modified tsRNAs to investigate the relationship between them and diseases. Finally, to more comprehensively elucidate the molecular mechanisms of tiRNA-Glu-TTC-003, target gene knockdown experiments and multi-method validation of the interaction between tiRNA-Glu-TTC-003 and its target genes are necessary. For example, techniques such as dual-luciferase reporter assays and RNA immunoprecipitation could be employed to further confirm the interactions between tiRNA-Glu-TTC-003 and target genes, such as TREM2. This would help to more precisely clarify its regulatory mechanisms.
Author Contributions
Chenfang Zeng and Lihong Wu were responsible for the main experiments, data curation, and analysis. Liying Zou, Junming Huo, and Yueqiang Fu assisted in the collection of clinical samples and clinical data. Chengjun Liu and Jing Li were in charge of supervision. Feng Xu and Hongxing Dang participated in the study design and funding support. Chenfang Zeng wrote the original draft, and Hongxing Dang reviewed and edited the manuscript.All authors reviewed the manuscript.
Funding
Program for Chongqing Natural Science Foundation Project(CSTB2022NSCQ-MSX0983); Youth Innovation in Future Medicine from Chongqing Medical University: Basic and Clinical Study of Critical Illness in Children (2021-W0111).
Data Availability
No datasets were generated or analysed during the current study.
Declarations
Competing Interests
The authors declare no competing interests.
Footnotes
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Chenfang Zeng and Lihong Wu are co-first authors, and they contributed equally to this study and the manuscript.
References
- 1.Weiss, S.L., and J.C. Fitzgerald. 2024. Pediatric sepsis diagnosis, management, and sub-phenotypes. Pediatrics 153: e2023062967. 10.1542/peds.2023-062967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Schlapbach, L.J., R.S. Watson, L.R. Sorce, A.C. Argent, K. Menon, M.W. Hall, S. Akech, D.J. Albers, E.R. Alpern, F. Balamuth, M. Bembea, P. Biban, E.D. Carrol, K. Chiotos, M.J. Chisti, P.E. DeWitt, I. Evans, C. Flauzino. de Oliveira, C.M. Horvat, D. Inwald, P. Ishimine, J.C. Jaramillo-Bustamante, M. Levin, R. Lodha, B. Martin, S. Nadel, S. Nakagawa, M.J. Peters, A.G. Randolph, S. Ranjit, M.N. Rebull, S. Russell, H.F. Scott, D.C. de Souza, P. Tissieres, S.L. Weiss, M.O. Wiens, J.L. Wynn, N. Kissoon, J.J. Zimmerman, L.N. Sanchez-Pinto, and T.D. Bennett. 2024. International consensus criteria for pediatric sepsis and septic shock. JAMA 331: 665–674. 10.1001/jama.2024.0179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Miranda, M., and S. Nadel. 2023. Pediatric sepsis: A summary of current definitions and management recommendations. Current Pediatric Reports 11: 29–39. 10.1007/s40124-023-00286-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kostakoglu, U., A. Topcu, M. Atak, L. Tumkaya, T. Mercantepe, and H.A. Uydu. 2020. The protective effects of angiotensin-converting enzyme inhibitor against cecal ligation and puncture-induced sepsis via oxidative stress and inflammation. Life Sciences 241: 117051. 10.1016/j.lfs.2019.117051. [DOI] [PubMed] [Google Scholar]
- 5.Leisman, D.E., T.D. Fernandes, V. Bijol, M.N. Abraham, J.R. Lehman, M.D. Taylor, C. Capone, O. Yaipan, R. Bellomo, and C.S. Deutschman. 2021. Impaired angiotensin II type 1 receptor signaling contributes to sepsis-induced acute kidney injury. Kidney International 99: 148–160. 10.1016/j.kint.2020.07.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Khan, F., L. Pang, M. Dunterman, M. S. Lesniak, A. B. Heimberger, and P. Chen. 2023. Macrophages and microglia in glioblastoma: heterogeneity, plasticity, and therapy. J Clin Invest 133:e163446. 10.1172/JCI163446 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Yang, S., L. Fan, L. Yin, Y. Zhao, W. Li, R. Zhao, X. Jia, F. Dong, Z. Zheng, D. Zhao, and J. Wang. 2025. Ginseng exosomes modulate M1/M2 polarisation by activating autophagy and target IKK/IкB/NF-кB to alleviate inflammatory bowel disease. Journal of Nanobiotechnology 23: 198. 10.1186/s12951-025-03292-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Xu, X., P. Xu, G. Shen, X. Peng, Z. Liu, C. Chen, W. Yu, Z. Su, J. Lin, G. Zheng, G. Ye, P. Wang, Z. Xie, Y. Wu, H. Shen, and J. Li. 2025. Targeting macrophage polarization by inhibiting Pim2 alleviates inflammatory arthritis via metabolic reprogramming. Cellular & Molecular Immunology 22:418–436. 10.1038/s41423-025-01268-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kim, D., J. Jin, Y.-R. Lee, D.-H. Kim, S.-Y. Park, J.-K. Byun, Y.-K. Choi, and K.-G. Park. 2025. SLC25A33-mediated mitochondrial DNA synthesis plays a critical role in the inflammatory response of M1 macrophages by contributing to mitochondrial ROS and VDAC oligomerization. International Journal of Biological Sciences 21:2935–2953. 10.7150/ijbs.96563 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Shi, J.-H., L.-N. Liu, D.-D. Song, W.-W. Liu, C. Ling, F.-X. Wu, T.-T. Wang, B. Liu, N.-P. Cui, Y. Qin, and Z.-Y. Ni. 2023. TRAF3/STAT6 axis regulates macrophage polarization and tumor progression. Cell Death and Differentiation 30:2005–2016. 10.1038/s41418-023-01194-1 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Maute, R.L., C. Schneider, P. Sumazin, A. Holmes, A. Califano, K. Basso, and R. Dalla-Favera. 2013. tRNA-derived microRNA modulates proliferation and the DNA damage response and is down-regulated in B cell lymphoma. Proceedings of the National Academy of Sciences of the United States of America 110: 1404–1409. 10.1073/pnas.1206761110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Fu, H., J. Feng, Q. Liu, F. Sun, Y. Tie, J. Zhu, R. Xing, Z. Sun, and X. Zheng. 2009. Stress induces tRNA cleavage by angiogenin in mammalian cells. FEBS Letters 583: 437–442. 10.1016/j.febslet.2008.12.043. [DOI] [PubMed] [Google Scholar]
- 13.Yamasaki, S., P. Ivanov, G.-F. Hu, and P. Anderson. 2009. Angiogenin cleaves tRNA and promotes stress-induced translational repression. Journal of Cell Biology 185:35–42. 10.1083/jcb.200811106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jin, F., L. Yang, W. Wang, N. Yuan, S. Zhan, P. Yang, X. Chen, T. Ma, and Y. Wang. 2021. A novel class of TsRNA signatures as biomarkers for diagnosis and prognosis of pancreatic cancer. Molecular Cancer 20:95. 10.1186/s12943-021-01389-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Qi, Q., B. Chen, J. Wu, J. Xu, H. Bao, K. Jin, L. Chen, G. Zhu, and F. Wang. 2025. TsR-0072 inhibits colorectal cancer progression through modulating lipid and vitamin D3 metabolic reprogramming and inactivating the Wnt/β-catenin signalling pathway. Annals of Medicine 57: 2531253. 10.1080/07853890.2025.2531253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.N. Xu, J. Huang, Y. Wang, Y. Liu, Y. Jiang, W. Zhou, J. Sheng, L. Zhang, 5′-tiRNA-Lys maintains intestinal epithelial homeostasis by EWSR1-dependent suppression of miR-125a and autophagy activation, Acta Biochim. Biophys. Sin. (2025). 10.3724/abbs.2025074. [DOI] [PMC free article] [PubMed]
- 17.Wang, J., Y. Yi, B. Han, L. Zhang, and H. Jia. 2025. A novel tRNA‑derived small RNA, 5’tiRNA‑Gln‑TTG‑001, aggravates cardiomyocyte inflammatory injury through upregulation of CLIC4. Molecular Medicine Reports 32: 1–16. 10.3892/mmr.2025.13626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Deng, Z., Y. Li, W. Chi, W. Zhang, F. Li, and L. Ling. 2025. tRFAla-AGC-3-M8 attenuates neuroinflammation and neuronal damage in Alzheimer’s disease via the EphA7-ERK1/2-p70S6K signaling pathway. Alzheimer’s Research & Therapy 17: 104. 10.1186/s13195-025-01734-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Zhang, Y., Y. Ma, Y.-K. Ji, Y.-F. Jiang, D. Li, W. Mu, M.-D. Yao, J. Yao, and B. Yan. 2025. Co-targeting of glial activation and inflammation by tsRNA-Gln-i-0095 for treating retinal ischemic pathologies. Cell Communication and Signaling 23: 18. 10.1186/s12964-024-02013-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Dou, R., X. Zhang, X. Xu, P. Wang, and B. Yan. 2021. Mesenchymal stem cell exosomal tsRNA-21109 alleviate systemic lupus erythematosus by inhibiting macrophage M1 polarization. Molecular Immunology 139: 106–114. 10.1016/j.molimm.2021.08.015. [DOI] [PubMed] [Google Scholar]
- 21.Yuan, L., Y. Tang, L. Yin, X. Lin, Z. Luo, S. Wang, J. Li, P. Liang, and B. Jiang. 2022. Microarray analysis reveals changes in tRNA-derived small RNAs (tsRNAs) expression in mice with septic cardiomyopathy. Genes 13: 2258. 10.3390/genes13122258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ying, X., W. Hu, Y. Huang, Y. Lv, D. Ji, C. Chen, B. Yang, C. Zhang, Y. Liang, H. Zhang, M. Liu, G. Yuan, W. Wu, and W. Ji. 2024. A novel tsRNA, m<Superscript>7</Superscript> G-3′ tiRNA Lys<Superscript>TTT</Superscript>, promotes bladder cancer malignancy via regulating ANXA2 phosphorylation. Advanced Science 11: 2400115. 10.1002/advs.202400115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Xu, R., A. Du, X. Deng, W. Du, K. Zhang, J. Li, Y. Lu, X. Wei, Q. Yang, and H. Tang. 2024. tsRNA-GlyGCC promotes colorectal cancer progression and 5-FU resistance by regulating SPIB. Journal of Experimental and Clinical Cancer Research 43: 230. 10.1186/s13046-024-03132-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ren, M., M. Zhang, X. Zhang, C. Wang, Y. Zheng, and Y. Hu. 2022. Hydroxysafflor yellow A inhibits Aβ1–42-induced neuroinflammation by modulating the phenotypic transformation of microglia via TREM2/TLR4/NF-κB pathway in BV-2 cells. Neurochemical Research 47: 748–761. 10.1007/s11064-021-03484-x. [DOI] [PubMed] [Google Scholar]
- 25.Schlapbach, L.J., R.S. Watson, L.R. Sorce, A.C. Argent, K. Menon, M.W. Hall, S. Akech, D.J. Albers, E.R. Alpern, F. Balamuth, M. Bembea, P. Biban, E.D. Carrol, K. Chiotos, M.J. Chisti, P.E. DeWitt, I. Evans, C. Flauzino. De Oliveira, C.M. Horvat, D. Inwald, P. Ishimine, J.C. Jaramillo-Bustamante, M. Levin, R. Lodha, B. Martin, S. Nadel, S. Nakagawa, M.J. Peters, A.G. Randolph, S. Ranjit, M.N. Rebull, S. Russell, H.F. Scott, D.C. De Souza, P. Tissieres, S.L. Weiss, M.O. Wiens, J.L. Wynn, N. Kissoon, J.J. Zimmerman, L.N. Sanchez-Pinto, T.D. Bennett, Society of Critical Care Medicine Pediatric Sepsis Definition Task Force, and J. Bubeck Wardenburg. 2024. International consensus criteria for pediatric sepsis and septic shock. JAMA 331: 665. 10.1001/jama.2024.0179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Gu, P., R. Liu, Q. Yang, L. Xie, R. Wei, J. Li, F. Mei, T. Chen, Z. Zeng, Y. He, H. Zhou, H. Peng, K.S. Nandakumar, H. Chu, Y. Jiang, W. Gong, Y. Chen, B. Schnabl, and P. Chen. 2023. A metabolite from commensal Candida albicans enhances the bactericidal activity of macrophages and protects against sepsis. Cellular and Molecular Immunology 20: 1156–1170. 10.1038/s41423-023-01070-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Aziz, M., Y. Ode, M. Zhou, M. Ochani, N.E. Holodick, T.L. Rothstein, and P. Wang. 2018. B-1a cells protect mice from sepsis-induced acute lung injury. Molecular Medicine 24: 26. 10.1186/s10020-018-0029-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jiang, M., K. Liu, J. Luo, and Z. Dong. 2010. Autophagy is a renoprotective mechanism during in vitro hypoxia and in vivo ischemia-reperfusion injury. American Journal of Pathology 176:1181–1192. 10.2353/ajpath.2010.090594 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kleiner, D.E., E.M. Brunt, M. Van Natta, C. Behling, M.J. Contos, O.W. Cummings, L.D. Ferrell, Y.-C. Liu, M.S. Torbenson, A. Unalp-Arida, M. Yeh, A.J. McCullough, A.J. Sanyal, Nonalcoholic Steatohepatitis Clinical Research Network. 2005. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology (Baltimore, MD) 41: 1313–1321. 10.1002/hep.20701. [DOI] [PubMed] [Google Scholar]
- 30.Shen, Y., X. Yu, L. Zhu, T. Li, Z. Yan, and J. Guo. 2018. Transfer RNA-derived fragments and tRNA halves: Biogenesis, biological functions and their roles in diseases. Journal of Molecular Medicine (Berlin, Germany) 96: 1167–1176. 10.1007/s00109-018-1693-y. [DOI] [PubMed] [Google Scholar]
- 31.Zhou, M., X. He, J. Zhang, C. Mei, B. Zhong, and C. Ou. 2024. tRNA-derived small RNAs in human cancers: Roles, mechanisms, and clinical application. Molecular Cancer 23: 76. 10.1186/s12943-024-01992-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Zhang, L., J. Liu, and Y. Hou. 2023. Classification, function, and advances in tsRNA in non-neoplastic diseases. Cell Death & Disease 14: 748. 10.1038/s41419-023-06250-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhu, J., M. Cheng, and X. Zhao. 2020. A tRNA-derived fragment (tRF-3001b) aggravates the development of nonalcoholic fatty liver disease by inhibiting autophagy. Life Sciences 257: 118125. 10.1016/j.lfs.2020.118125. [DOI] [PubMed] [Google Scholar]
- 34.Shen, L., T. Liao, Q. Chen, Y. Lei, L. Wang, H. Gu, Y. Qiu, T. Zheng, Y. Yang, C. Wei, L. Chen, Y. Zhao, L. Niu, S. Zhang, Y. Zhu, M. Li, J. Wang, X. Li, M. Gan, and L. Zhu. 2023. tRNA-derived small RNA, 5’tiRNA-Gly-CCC, promotes skeletal muscle regeneration through the inflammatory response. Journal of Cachexia, Sarcopenia and Muscle 14: 1033–1045. 10.1002/jcsm.13187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kim, H.K., J. Xu, K. Chu, H. Park, H. Jang, P. Li, P.N. Valdmanis, Q.C. Zhang, and M.A. Kay. 2019. A tRNA-derived small RNA regulates ribosomal protein S28 protein levels after translation initiation in humans and mice. Cell Reports 29: 3816-3824.e4. 10.1016/j.celrep.2019.11.062. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang, K., Y. Wang, S. Chen, J. Mao, Y. Jin, H. Ye, Y. Zhang, X. Liu, C. Gong, X. Cheng, X. Huang, A. Hoeft, Q. Chen, X. Li, and X. Fang. 2023. TREM2hi resident macrophages protect the septic heart by maintaining cardiomyocyte homeostasis. Nature Metabolism 5: 129–146. 10.1038/s42255-022-00715-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Ma, K., S. Guo, J. Li, T. Wei, and T. Liang. 2024. Biological and clinical role of TREM2 in liver diseases. Hepatology Communications 8: e0578. 10.1097/HC9.0000000000000578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ciesielska, A., M. Matyjek, and K. Kwiatkowska. 2021. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cellular and Molecular Life Sciences : CMLS 78: 1233–1261. 10.1007/s00018-020-03656-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Płóciennikowska, A., A. Hromada-Judycka, K. Borzęcka, and K. Kwiatkowska. 2015. Co-operation of TLR4 and raft proteins in LPS-induced pro-inflammatory signaling. Cellular and Molecular Life Sciences : CMLS 72: 557–581. 10.1007/s00018-014-1762-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Awuah, W.A., A. Ben-Jaafar, J.S.H. Kong, V. Sanker, M.H. Shah, J. Poornaselvan, M. Frimpong, S. Imran, T. Alocious, T. Abdul-Rahman, and O. Atallah. 2025. Novel insights into the role of TREM2 in cerebrovascular diseases. Brain Research 1846: 149245. 10.1016/j.brainres.2024.149245. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
No datasets were generated or analysed during the current study.









