Skip to main content
Springer logoLink to Springer
. 2026 Jan 28;49(1):70. doi: 10.1007/s10753-026-02454-1

Targeting Thioredoxin Reductase 1 Alleviates Severe Acute Pancreatitis by Modulating Oxidative Stress and Ferroptosis-Related Pathways

Ze-peng Shen 1,#, Lin Liu 2,#, Jie Yang 1, Zhi-kun Zhang 1, Zhao-yang Du 1, Fu-long Zhang 1, Heng Zhao 1, Lei Li 1, Hai Jiang 1, Hong-chang Zhao 1,, Zhao-lei Qiu 1,
PMCID: PMC12901235  PMID: 41606267

Abstract

Severe acute pancreatitis (SAP) is a life-threatening inflammatory disease characterized by pancreatic injury, systemic inflammatory responses, and multiorgan dysfunction. Oxidative stress is a central driver of SAP pathogenesis; however, effective targeted therapies remain limited. Thioredoxin reductase 1 (Txnrd1), a key redox-regulating selenoenzyme, has been implicated in inflammatory and oxidative stress–related disorders. Nevertheless, its contribution to SAP-associated redox imbalance and ferroptosis-related molecular alterations remains incompletely understood. SAP was induced in mice by repeated intraperitoneal injections of L-arginine. Txnrd1 expression in pancreatic tissues was assessed using mRNA sequencing, RT-qPCR, and Western blotting. In vitro, SAP-like injury was modeled in C266 pancreatic acinar cells following L-arginine stimulation. Genetic silencing or pharmacological modulation of Txnrd1 was performed to evaluate its functional role. Cell viability, oxidative stress indices, intracellular iron homeostasis, and lipid peroxidation were measured using biochemical assays. Antioxidant signaling pathways and ferroptosis-related molecular markers were analyzed by RT-qPCR, Western blotting, and immunohistochemistry. Mitochondrial ultrastructure was examined by transmission electron microscopy. In vivo oxidative stress, inflammatory responses, apoptosis, and ferroptosis-associated signaling were systematically evaluated. Txnrd1 expression was significantly upregulated in pancreatic tissues from SAP mice and in L-arginine–treated C266 cells. Genetic or pharmacological inhibition of Txnrd1 alleviated pancreatic injury and improved cellular viability. Txnrd1 suppression attenuated oxidative stress, as indicated by reduced ROS, MDA, lipid peroxidation, and intracellular ferrous iron levels, accompanied by restoration of GSH content. Antioxidant defense mechanisms were enhanced, with increased expression of Nrf2, SOD1, and HO-1. Inflammatory cytokine production, including IL-1β, IL-6, and TNF-α, was markedly reduced. Furthermore, Txnrd1 inhibition preserved mitochondrial morphology and was associated with modulation of ferroptosis-related proteins, including increased GPX4 and SLC7A11 expression and decreased levels of COX2, ACSL4, and NOX1. These findings suggest that Txnrd1 contributes to SAP progression by exacerbating oxidative stress, inflammatory responses, and ferroptosis-associated molecular signaling. Targeting Txnrd1 may therefore represent a potential therapeutic strategy for severe acute pancreatitis.

Keywords: SAP, Txnrd1, Inflammation, Oxidative stress, Ferroptosis

Introduction

Acute pancreatitis (AP) is a prevalent gastrointestinal disorder characterized by inflammation of the pancreas [1]. Globally, the incidence of AP has been on the rise, with studies indicating an increase from approximately 1.73 million cases in 1990 to 2.75 million in 2021 [2]. While most AP cases are mild and self-limiting, about 15–20% progress to severe acute pancreatitis (SAP), which is associated with significant morbidity and mortality [3]. The progression to SAP involves a complex interplay of factors, including sustained pancreatic inflammation, acinar cell injury, and systemic inflammatory responses [4, 5]. Key pathological features include increased vascular permeability, pancreatic microcirculatory impairment, and the release of pro-inflammatory cytokine [6, 7]. These events can lead to multi-organ dysfunction syndrome (MODS), a major cause of mortality in SAP patients. Despite advances in supportive care, effective pharmacological treatments for SAP remain limited [8, 9]. Current management strategies primarily focus on symptom control and supportive measures, such as fluid resuscitation and nutritional support [1012]. The lack of targeted therapies underscores the need to identify molecular mechanisms driving SAP progression and to develop novel therapeutic interventions.

Oxidative stress is widely recognized as a central pathogenic factor in SAP, contributing to acinar cell injury, inflammatory amplification, and organ dysfunction [13]. Excessive reactive oxygen species (ROS) generation disrupts cellular redox homeostasis, promotes lipid peroxidation, and sensitizes pancreatic acinar cells to regulated forms of cell death. In recent years, ferroptosis—an iron-dependent form of regulated cell death driven by lipid peroxidation—has emerged as an important mechanism contributing to pancreatic injury in experimental models of acute pancreatitis. Hallmarks of ferroptosis, including glutathione (GSH) depletion, inactivation of glutathione peroxidase 4 (GPX4), accumulation of lipid peroxides, and characteristic mitochondrial abnormalities, have been reported in L-arginine–induced SAP models, highlighting ferroptosis as a key driver of disease severity.

The thioredoxin (Trx) system is a major cellular antioxidant defense pathway that plays a critical role in maintaining redox homeostasis under oxidative stress conditions. Thioredoxin reductase 1 (Txnrd1), a selenoenzyme of the Trx system, catalyzes the NADPH-dependent reduction of oxidized thioredoxin and thereby regulates intracellular redox balance and lipid peroxide detoxification. However, accumulating evidence suggests that increased Txnrd1 expression under pathological conditions does not necessarily confer cytoprotection. Instead, Txnrd1 upregulation often reflects a compensatory yet functionally insufficient response to overwhelming oxidative stress. For example, miR-875-5p–mediated suppression of TXNRD1 alleviates insulin resistance, inflammation, and oxidative stress in gestational diabetes mellitus 10.3892/mmr.2021.11942. TXNRD1 is significantly upregulated in the small airway epithelium of COPD and participates in cigarette smoke–induced oxidative stress and inflammatory responses, at least in part by modulating the Nrf2/HO-1 signaling pathway10.1155/2022/7067623. Importantly, under cysteine-depleted conditions in chronic myeloid leukemia cells, TXNRD1 expression is increased while its enzymatic activity is impaired, leading to uncontrolled lipid peroxidation and ferroptosis. This dissociation between expression and function indicates that TXNRD1 upregulation may signify failure of redox defense rather than effective protection 10.1155/2021/7674565. Recent studies have suggested that Txnrd1 may participate in cell death regulation by modulating cellular redox homeostasis and lipid peroxidation [14]. However, whether Txnrd1-driven redox imbalance contributes to ferroptosis-related injury and disease progression in severe acute pancreatitis remains unclear.

In the present study, we investigated the role of Txnrd1 in SAP using both in vitro and in vivo models. We examined the effects of genetic silencing and pharmacological inhibition of Txnrd1 on oxidative stress, inflammatory responses, and ferroptosis-related pathways. By elucidating the contribution of Txnrd1 to redox imbalance and ferroptotic injury in SAP, this study aims to provide mechanistic insight into SAP pathogenesis and to identify Txnrd1 as a potential therapeutic target.

Materials and Methods

Animal Models of Severe Acute Pancreatitis

Male C57BL/6 mice 8 weeks were obtained from SLAC ANIMAL and housed under specific pathogen-free conditions with ad libitum access to food and water. For SAP model construction, mice were i.p. injected with L-arginine (4 g/kg/h) (HY-N0455, MedChem Express) 2 times. Blank mice received equivalent volumes of PBS. All animal experiments were reviewed and approved by the Ethics Committee of Bengbu Medical University (Approval No. 2025 − 129) and were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals.

Ethics Statement

Human clinical studies were approved by the Ethics Committee of Bengbu Medical University (Approval No. 2024-045), and written informed consent was obtained from all participants, or their legal guardians, prior to inclusion in the study. All procedures were conducted in accordance with the Declaration of Helsinki and relevant national regulations. The privacy and confidentiality of patient data were rigorously safeguarded throughout the study.

Cell Culture and Treatment

The murine pancreatic acinar cell line C266 was obtained from Cell Bank of the Chinese Academy of Sciences (Shang hai, China), and cultured in Dulbecco’s Modified Eagle Medium (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin at 37 °C in a humidified incubator with 5% CO₂. To establish an in vitro model of acute pancreatitis, C266 cells were treated with 5 mg/mL L-arginine (L-Arg; Sigma, USA) for 24 h. Cells without L-Arg treatment were used as controls.

siRNA Transfection

For gene knockdown experiments, small interfering RNA (siRNA) targeting mouse Txnrd1 (si-Txnrd1) and a non-targeting scrambled control siRNA (si-NC) were synthesized by [GENERAL BIOL, China]. C266 cells were seeded into 6-well plates at approximately 50% confluency one day prior to transfection. Transfection was performed using Lipofectamine™ 3000 reagent (Invitrogen, USA) according to the manufacturer’s protocol. Briefly, siRNA and Lipofectamine 3000 were diluted in Opti-MEM™ medium (Gibco, USA) and incubated for 15 min to form siRNA-lipid complexes. The complexes were then added dropwise to the cells. After 6 h, the transfection medium was replaced with fresh complete DMEM, and the cells were cultured for another 48 h before harvesting for downstream analysis. The sequences of siRNAs were as follows:

si-Txnrd1: 5′-CGACAAAUAACAAAGGUAA − 3′.

si-NC: 5′-UUACCUUUGUUAUUUGUCG − 3′.

Cell Viability Assay

Cell viability was measured using the Cell Counting Kit-8 (Beyotime, Shanghai, China). After treatment, 10 µL of CCK-8 reagent was added to each well of a 96-well plate containing 100 µL of culture medium. Cells were incubated for 2 h at 37 °C. The absorbance at 450 nm was measured using a microplate reader (BioTek, USA).

RNA Sequencing

Total RNA was extracted from frozen pancreatic tissues using TRIzol reagent. After quality assessment, mRNA was enriched, fragmented, and reverse-transcribed to construct cDNA libraries. Sequencing was performed on the Illumina NovaSeq 6000 platform. Clean reads were mapped to the mouse reference genome, and differentially expressed genes were identified using DESeq2. GO, KEGG, and PPI analyses were used to explore related biological pathways.

Bioinformatics Analysis

To elucidate the potential signaling pathways associated with Txnrd1, protein–protein interaction (PPI) analysis, Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed.

Txnrd1-interacting proteins were obtained from the STRING database (https://string-db.org/) with the species set to Mus musculus and confidence score > 0.7. The interaction network was visualized using Cytoscape (v3.9.1).

GO and KEGG analyses were carried out using the DAVID database and the ClusterProfiler package in R (v4.2.0). GO terms were classified into biological process (BP), molecular function (MF), and cellular component (CC). Pathways with p < 0.05 were considered significantly enriched.

AAV-Mediated Gene Knockdown

To knock down Txnrd1 in vivo, mice received intraperitoneal injection of adeno-associated virus (AAV) carrying Txnrd1-targeting shRNA or negative control (sh-NC) three weeks prior to the induction of pancreatitis. The recombinant AAV9 vectors (1 × 10¹² vg/mL) were obtained from OBIO and administered at a dose of 100 µL per mouse. Successful gene knockdown was verified by qPCR and western blotting of pancreatic tissues.

ML162 Administration

The selective Txnrd1 inhibitor ML162 (MCE, State of New Jersey, USA) was dissolved in 10% DMSO + 90% Corn Oil. Mice in the treatment group received intraperitoneal injection of ML162 (25 mg/kg) once daily for three consecutive days, starting on the first day of L-arginine injection. Control groups received the same volume of vehicle.

Blood Glucose Measurement

Blood glucose levels were measured in live mice using the tail snip method. Briefly, mice were gently restrained, and approximately 2 mm of the tail tip was snipped using sterile scissors. The first drop of blood was discarded, and subsequent blood was applied to a test strip compatible with a Yuwell blood glucose meter. Measurements were performed at designated time points, and glucose concentrations were recorded in mmol/L. After measurement, hemostasis was achieved by applying gentle pressure and sterile gauze to the tail tip.

Serum Amylase and Lipase Measurement

At the endpoint of the experiment, mice were anesthetized, and blood was collected via cardiac puncture. The samples were left undisturbed at room temperature for 30 min and then centrifuged at 3,000 rpm for 10 min at 4 °C to obtain serum. Serum amylase and lipase activities were determined using commercially available assay kits (mlbio, Shanghai, China) according to the manufacturer’s protocols. Absorbance was measured at appropriate wavelengths using a microplate reader, and enzyme activity levels were calculated based on standard curves.

Hematoxylin and Eosin (H&E) Staining

Pancreatic tissues were harvested and fixed in 4% paraformaldehyde at 4 °C for 24–48 h, then dehydrated through graded alcohols and embedded in paraffin. Sections were cut at 5 μm thickness, deparaffinized in xylene, and rehydrated through descending concentrations of ethanol. The sections were stained with hematoxylin for 5 min, rinsed in running tap water, differentiated in 1% acid alcohol, and counterstained with eosin for 2 min. After dehydration and clearing, slides were mounted with neutral resin.

Immunohistochemistry (IHC)

Paraffin-embedded pancreatic Sect. (5 μm) were deparaffinized, rehydrated, and subjected to antigen retrieval by heating in 0.01 mol/L citrate buffer (pH 6.0) at 95 °C for 20 min. After cooling to room temperature, endogenous peroxidase activity was blocked using 3% hydrogen peroxide for 10 min. Sections were then incubated in 5% bovine serum albumin (BSA) at room temperature for 30 min to block non-specific binding. Primary antibodies against 4-hydroxynonenal (4-HNE) and myeloperoxidase (MPO) (diluted according to the manufacturer’s instructions) were added and incubated overnight at 4 °C in a humidified chamber. After washing with PBS, sections were incubated with appropriate HRP-conjugated secondary antibodies for 30 min at room temperature. Signal detection was performed using a DAB chromogenic substrate, and sections were counterstained with hematoxylin. After dehydration and mounting, stained tissues were visualized under a light microscope. Positive staining was quantified using ImageJ software in randomly selected fields.

TUNEL Staining

TUNEL staining was conducted to detect apoptotic cells in pancreatic tissues using a commercial apoptosis detection kit (beyotime, Shanghai, China) according to the manufacturer’s protocol. Briefly, 5 μm paraffin sections were deparaffinized, rehydrated, and incubated with proteinase K (20 µg/mL) for 15 min at 37 °C to permeabilize the tissue. After rinsing with PBS, sections were incubated with TUNEL reaction mixture in a humidified chamber at 37 °C for 1 h in the dark. Following washing, nuclei were counterstained with DAPI for 5 min. Sections were mounted with anti-fade mounting medium and observed under a fluorescence microscope. The number of TUNEL-positive (apoptotic) cells was quantified in five randomly selected fields per section.

Flow Cytometry for Apoptosis

Apoptotic cells were identified using an Annexin V-FITC/PI Apoptosis Detection Kit (BD Biosciences, USA). After treatments, cells were harvested, washed with cold PBS, and resuspended in binding buffer. Cells were incubated with 5 µL of Annexin V-FITC and 5 µL of propidium iodide (PI) for 15 min at room temperature in the dark. Samples were analyzed by flow cytometry (2060R, NovoCyte) within 1 h.

ROS Measurement

ROS levels in mouse pancreatic tissues were determined using a commercial mouse ROS ELISA kit (Cat. CB10366, KEBIO Biotechnology, China) according to the manufacturer’s instructions. Pancreatic tissues were homogenized in cold PBS, and the supernatants were collected for analysis. Absorbance was measured at 450 nm, and ROS concentrations were calculated from a standard curve and normalized.

MDA Measurement

MDA levels in mouse pancreatic tissues were determined using a commercial mouse MDA ELISA kit (Cat. CB10205, KEBIO Biotechnology, China) according to the manufacturer’s instructions. Pancreatic tissues were homogenized in cold PBS, and the supernatants were collected for analysis. Absorbance was measured at 450 nm, and MDA concentrations were calculated from a standard curve.

GSH Measurement

GSH levels in mouse pancreatic tissues were determined using a commercial mouse GSH ELISA kit (Cat. CB10323, KEBIO Biotechnology, China) according to the manufacturer’s instructions. Pancreatic tissues were homogenized in cold PBS, and the supernatants were collected for analysis. Absorbance was measured at 450 nm, and GSH concentrations were calculated from a standard curve.

Clinical Whole Blood qPCR Analysis

Whole blood samples were collected from patients during the acute phase of pancreatitis upon hospital admission into EDTA-containing tubes. Total RNA was extracted using a commercial blood RNA isolation kit according to the manufacturer’s instructions, including DNase treatment to remove genomic DNA contamination. RNA was then reverse-transcribed into cDNA using a standard reverse transcription kit. Quantitative PCR (qPCR) was performed with gene-specific primers for Txnrd1, and GAPDH was used as the internal control. Relative mRNA expression levels were calculated using the 2−ΔΔCt method. PCR reverse primers are listed in Table 1.

Table 1.

Primer sequences used for qPCR analysis in human whole blood samples

Genes Primers (5′–3′)
Txnrd1-human
Forward ATATGGCAAGAAGGTGATGGTCC
Reverse GGGCTTGTCCTAACAAAGCTG
GAPDH -human
Forward GGAGCGAGATCCCTCCAAAAT
Reverse GGCTGTTGTCATACTTCTCATGG

Quantitative Real-Time PCR (qPCR)

Total RNA was extracted from mouse pancreatic tissues or cultured cells using TRIzol reagent (Invitrogen, USA) according to the manufacturer’s protocol. RNA concentration and purity were determined using a NanoDrop spectrophotometer (Implen, Munich, Germany). cDNA synthesis was performed using a reverse transcription kit (Applied Biosystem, Foster City, USA). qPCR was carried out using SYBR Green Master Mix (Accurate Biotechnology, Hunan, China) on a StepOnePlus Real-Time PCR System. GAPDH was used as an internal control. The relative expression of target genes was calculated using the 2−ΔΔCt method. All samples were tested in triplicate. PCR reverse primers are listed in Table 2.

Table 2.

Primer sequences used for qPCR analysis

Genes Primers (5′–3′)
Txnrd1-mouse
Forward GGGTCCTATGACTTCGACCTG
Reverse AGTCGGTGTGACAAAATCCAAG
Nrf2-mouse
Forward CTTTAGTCAGCGACAGAAGGAC
Reverse AGGCATCTTGTTTGGGAATGTG
Sod1-mouse
Forward AACCAGTTGTGTTGTCAGGAC
Reverse CCACCATGTTTCTTAGAGTGAGG
Ho-1-mouse
Forward GATAGAGCGCAACAAGCAGAA
Reverse CAGTGAGGCCCATACCAGAAG
IL-1β-mouse
Forward GAAATGCCACCTTTTGACAGTG
Reverse TGGATGCTCTCATCAGGACAG
IL-6-mouse
Forward CTGCAAGAGACTTCCATCCAG
Reverse AGTGGTATAGACAGGTCTGTTGG
TNF-a -mouse
Forward CAGGCGGTGCCTATGTCTC
Reverse CGATCACCCCGAAGTTCAGTAG
GAPDH-mouse
Forward AGGTCGGTGTGAACGGATTTG
Reverse GGGGTCGTTGATGGCAACA
Txnrd1-human
Forward ATATGGCAAGAAGGTGATGGTCC
Reverse GGGCTTGTCCTAACAAAGCTG
GAPDH -human
Forward GGAGCGAGATCCCTCCAAAAT
Reverse GGCTGTTGTCATACTTCTCATGG

Western Blot

To assess protein expression levels in pancreatic tissues and C266 cells, total proteins were extracted using RIPA lysis buffer (Beyotime, China) containing protease and phosphatase inhibitors. Pancreatic tissues were homogenized on ice, and C266 cells were lysed directly in culture plates. Lysates were incubated on ice for 30 min and centrifuged at 12,000 × g for 15 min at 4 °C. The supernatant was collected, and protein concentrations were determined using a BCA assay kit (Beyotime, Shanghai, China). Equal amounts of protein (30 µg) were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, USA). After blocking with 5% non-fat milk or BSA for 1 h at room temperature, membranes were incubated overnight at 4 °C with primary antibodies against Txnrd1 (11117-1-AP, Proteintech, China), GPX4 (ab125066, abcam, UK), SLC7A11 (ab307601, abcam, UK), COX2 (#12282, CST, UK), ACSL4 (ab155282, abcam, UK), NOX1 (ab131088, abcam, UK), Nrf2 (#12721, CST, USA), SOD1 (#37385, CST, USA), HO-1 (BF8020, Affinity, China), and GAPDH (60004-1-Ig, Proteintech, China). The next day, membranes were washed and incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Signals were developed using ECL reagents and imaged with a Bio-Rad ChemiDoc™ MP system. Band intensities were quantified using ImageJ, and normalized to GAPDH.

Statistical Analysis

All data are presented as mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism 9.0 software. For comparisons between two groups, unpaired two-tailed Student’s t-test was used. For multiple group comparisons, one-way ANOVA followed by Tukey’s post hoc test was applied. A p-value < 0.05 was considered statistically significant. All experiments were independently repeated at least three times.

Results

Txnrd1 Expression Is Elevated in Pancreatic Tissues of SAP Mice

To confirm successful induction of acute pancreatitis, we first examined pancreatic tissues from L-arginine-treated mice using H&E staining. Compared to Blank controls, SAP mice exhibited severe pancreatic tissue damage, including acinar cell necrosis, interstitial edema, and inflammatory cell infiltration (Fig. 1A). Consistently, serum levels of amylase and lipase were significantly elevated in SAP mice, indicative of pancreatic injury (Fig. 1B–C). SAP is often associated with elevated levels of oxidative stress. Therefore, we assessed the expression of key antioxidant markers by Western blot. The protein levels of Nrf2 and HO-1 were markedly increased in the pancreatic tissues of SAP mice compared to controls (Fig. 1D–F), whereas SOD1 was decreased (Fig. 1D and G). To identify potential therapeutic targets for SAP, we performed transcriptomic profiling of pancreatic tissues from SAP and control mice. The volcano plot revealed several differentially expressed genes, among which Txnrd1 was significantly upregulated (Fig. 1H). RT-PCR analysis further validated the increased Txnrd1 mRNA expression in SAP tissues (Fig. 1I), and Western blot confirmed elevated Txnrd1 protein levels (Fig. 1J–K). Similar elevation of Txnrd1 expression was also observed in whole blood samples from patients with SAP, further highlighting its clinical relevance (Fig. 1L). Together, these results indicate that Txnrd1 is significantly upregulated in the pancreatic tissues of SAP mice and human SAP samples, coinciding with exacerbated pancreatic injury and impaired antioxidant responses. These findings suggest a possible pathogenic role for Txnrd1 in SAP progression.

Fig. 1.

Fig. 1

Txnrd1 expression is elevated in pancreatic tissues of AP mice. A Representative H&E staining of pancreatic tissues from Blank and AP mice (n = 3). B Serum amylase levels in Blank and AP mice(n = 6). C Serum lipase levels in Blank and AP mice(n = 6). DG Western blot analysis of Nrf2, SOD1, and HO-1 protein expression in pancreatic tissues from Blank and AP mice(n = 3). H Volcano plot of differentially expressed genes based on mRNA sequencing of pancreatic tissues from Blank and AP mice(n = 4). I RT-PCR analysis of Txnrd1 mRNA expression in pancreatic tissues (n = 3). JK Western blot analysis and quantification of Txnrd1 protein expression in pancreatic tissues(n = 3). L Quantitative analysis of Txnrd1 mRNA expression in peripheral whole blood samples from healthy individuals and patients with severe acute pancreatitis (SAP) (n = 30 per group). Data are presented as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: H&E, hematoxylin and eosin; AP, acute pancreatitis; HO-1, heme oxygenase-1; SOD1, superoxide dismutase 1

Knockdown of Txnrd1 Alleviates Oxidative Stress and Apoptosis in C266 Cells Under SAP Conditions

To investigate the functional role of Txnrd1 in pancreatic acinar cell injury during SAP, we established an in vitro SAP model by treating C266 mouse pancreatic acinar cells with 5 mg/mL L-arginine (L-Arg) for 24 h. Compared with the Blank group, SAP-treated C266 cells exhibited significantly reduced cell viability and elevated levels of apoptosis and oxidative stress markers, confirming successful induction of cellular injury. Txnrd1 expression was silenced using siRNAs targeting three distinct sites of the Txnrd1 gene. RT-PCR and Western blot analysis demonstrated that siTxnrd1-1 achieved the highest knockdown efficiency; thus, this siRNA was used in subsequent experiments (Fig. 2A–C).

Fig. 2.

Fig. 2

Knockdown of Txnrd1 alleviates oxidative stress and apoptosis in C266 cells under SAP conditions. A RT-PCR analysis of Txnrd1 mRNA expression in C266 cells transfected with three different siRNAs targeting distinct sites of the Txnrd1 gene. B Western blot analysis of Txnrd1 protein expression after siRNA transfection. C Quantification of Txnrd1 protein levels normalized to GAPDH. D CCK-8 assay showing cell viability over five days in Blank, SAP, siCtrl + SAP, and siTxnrd1 + SAP groups. E Flow cytometry plots showing apoptosis in each group. F Quantification of apoptotic rates based on flow cytometry. G Intracellular ROS levels in each group. H GSH levels in each group. I MDA levels in each group. Data are presented as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: ROS, reactive oxygen species; GSH, glutathione; MDA, malondialdehyde

Functionally, Txnrd1 knockdown markedly improved cell viability in SAP-modeled C266 cells, as assessed by the CCK-8 assay (Fig. 2D). Flow cytometric analysis revealed that apoptosis rates were significantly reduced following Txnrd1 silencing compared to the SAP and siCtrl + SAP groups (Fig. 2E–F). Furthermore, intracellular reactive oxygen species (ROS) levels and malondialdehyde (MDA) content were significantly decreased (Fig. 2G and I), whereas glutathione (GSH) levels were increased (Fig. 2H), indicating a substantial attenuation of oxidative stress. Collectively, these findings indicate that Txnrd1 knockdown exerts a protective effect on pancreatic acinar cells under SAP conditions by reducing oxidative stress and inhibiting apoptosis.

Txnrd1 Knockdown Alleviates Oxidative Stress and Preserves Mitochondrial Integrity in C266 Cells Under SAP Conditions

To further elucidate the antioxidant mechanisms underlying Txnrd1 silencing, we examined the expression of key antioxidant proteins in C266 cells under SAP conditions. Western blot analysis revealed that, compared with the SAP and siCtrl + SAP groups, Txnrd1 knockdown significantly increased the protein levels of Nrf2, HO-1, and SOD1 (Fig. 3A–E). Consistently, RT-qPCR analysis showed parallel upregulation of their corresponding mRNA levels (Fig. 3F–H), indicating activation of Nrf2-mediated antioxidant defense pathways following Txnrd1 silencing.

Fig. 3.

Fig. 3

Txnrd1 knockdown alleviates oxidative stress and mitochondrial ferroptotic ultrastructural damage in C266 cells under SAP conditions. A Representative Western blot images showing the protein expression of Nrf2, HO-1, SOD1, and Txnrd1 in C266 cells from Blank, SAP, siCtrl + SAP, and siTxnrd1 + SAP groups. BE Quantification of Nrf2, HO-1, SOD1, and Txnrd1 protein levels in C266 cells. FH RT-PCR analysis of Nrf2, HO-1, and SOD1 mRNA levels in C266 cells. I Transmission electron microscopy images of mitochondrial morphology in C266 cells from each group. Data are presented as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; siCtrl, negative control siRNA; siTxnrd1, Txnrd1-targeted siRNA; Nrf2, nuclear factor erythroid 2–related factor 2; HO-1, heme oxygenase 1; SOD1, superoxide dismutase 1; Txnrd1, thioredoxin reductase 1

Given that mitochondria are a major source of intracellular reactive oxygen species (ROS) and are highly susceptible to oxidative damage, we next assessed mitochondrial ultrastructure using transmission electron microscopy (TEM). In the SAP and siCtrl + SAP groups, C266 cells displayed pronounced mitochondrial abnormalities, including cristae disruption, increased membrane density, and mitochondrial shrinkage—features commonly reported under conditions of severe oxidative stress and lipid peroxidation. In contrast, these ultrastructural alterations were markedly attenuated in the siTxnrd1 + SAP group, with mitochondria exhibiting more preserved morphology and intact cristae (Fig. 3I).

Taken together, these findings indicate that Txnrd1 knockdown enhances cellular antioxidant capacity through activation of the Nrf2/HO-1 pathway and protects mitochondrial structural integrity in pancreatic acinar cells under SAP conditions. The observed mitochondrial preservation is consistent with a reduced susceptibility to lipid peroxidation–associated cell injury, including ferroptosis-related damage.

Txnrd1 Knockdown Attenuates ferroptosis-associated Oxidative Injury in L-arginine–treated Pancreatic Acinar Cells

To further investigate the cellular mechanisms through which Txnrd1 contributes to SAP-related injury, we established an in vitro L-arginine–induced damage model in C266 pancreatic acinar cells and compared the effects of Txnrd1 silencing with those of the ferroptosis inhibitor ferrostatin-1 (Fer-1). CCK-8 assays demonstrated that L-arginine treatment significantly reduced cell viability, whereas both Fer-1 administration and Txnrd1 knockdown markedly improved cell survival (Fig. 4A). The comparable protective effects observed in the siTxnrd1 and Fer-1 groups suggest that Txnrd1 influences cell death pathways closely associated with lipid peroxidation–dependent injury.

Fig. 4.

Fig. 4

Txnrd1 knockdown suppresses ferroptosis in L-arginine–treated pancreatic acinar cells. A CCK-8 assay showing cell viability each groups. BD Intracellular Fe²⁺ levels (B), GSH levels (C), and MDA levels (D) in each group. EG RT-PCR analysis of Nrf2, HO-1, and SOD1 mRNA expression. HJ Western blot analysis of Nrf2, HO-1, and SOD1 protein expression, with quantification normalized to GAPDH (K). L Lipid-ROS staining showing lipid peroxidation in each group (scale bar = 20 μm). M Transmission electron microscopy images of mitochondrial morphology showing ferroptotic changes in each groups (scale bar = 20 μm). Data are presented as mean ± SD (n = 3 per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: CCK-8, Cell Counting Kit-8; Fe²⁺, ferrous ion; GSH, glutathione; MDA, malondialdehyde; RT-PCR, reverse transcription polymerase chain reaction; Nrf2, nuclear factor erythroid 2–related factor 2; HO-1, heme oxygenase-1; SOD1, superoxide dismutase 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; ROS, reactive oxygen species; TEM, transmission electron microscopy

Biochemical analyses further supported this notion. L-arginine exposure resulted in pronounced intracellular ferrous iron (Fe²⁺) accumulation, glutathione (GSH) depletion, and increased malondialdehyde (MDA) levels—changes indicative of iron-dependent oxidative stress and enhanced lipid peroxidation (Fig. 4B–D). Notably, both Fer-1 treatment and Txnrd1 knockdown significantly reversed these alterations, indicating that suppression of Txnrd1 mitigates iron-driven oxidative injury in a manner comparable to pharmacological inhibition of lipid peroxidation.

To explore potential antioxidant mechanisms, we assessed the expression of key redox-regulating factors. L-arginine stimulation markedly reduced the mRNA and protein levels of Nrf2, HO-1, and SOD1, whereas both Fer-1 treatment and Txnrd1 silencing restored their expression (Fig. 4E–K). The parallel activation of the Nrf2–HO-1 antioxidant axis in both intervention groups suggests that Txnrd1 depletion alleviates oxidative stress through pathways linked to ferroptosis-associated redox imbalance.

Consistent with these molecular findings, lipid ROS staining revealed substantial lipid peroxidation in L-arginine–treated cells, which was significantly attenuated by Fer-1 or Txnrd1 knockdown (Fig. 4L). Moreover, transmission electron microscopy demonstrated that L-arginine exposure induced marked mitochondrial abnormalities, including mitochondrial shrinkage, cristae disruption, and increased membrane density—features commonly associated with severe oxidative and lipid peroxidation–mediated injury. These ultrastructural alterations were largely alleviated by both interventions, with preservation of mitochondrial integrity (Fig. 4M).

Taken together, these results indicate that Txnrd1 knockdown reduces susceptibility to L-arginine–induced iron-dependent oxidative damage and lipid peroxidation in pancreatic acinar cells, producing protective effects comparable to those of ferroptosis inhibition. These findings support a functional role for Txnrd1 in modulating ferroptosis-associated injury during SAP progression.

ML162 Treatment Alleviates Pancreatic Inflammation and Apoptosis in SAP Mice

To validate the therapeutic potential of Txnrd1 inhibition in vivo, we administered ML162, a selective Txnrd1 inhibitor, to SAP mice and assessed its impact on pancreatic injury, inflammation, and apoptosis. Histopathological analysis using H&E staining revealed that SAP mice exhibited marked pancreatic edema, inflammatory infiltration, and acinar cell necrosis compared to the Blank group. Notably, ML162 treatment substantially ameliorated these pathological alterations (Fig. 5A). Consistently, SAP mice showed significantly elevated serum levels of amylase and lipase, which were markedly reduced following ML162 administration (Fig. 5B–C), indicating an improvement in pancreatic exocrine function.

Fig. 5.

Fig. 5

ML162 treatment alleviates pancreatic inflammation and apoptosis in SAP mice. A Representative H&E staining of pancreatic tissues from mice in the Blank, SAP, and SAP + ML162 groups (scale bar = 50 µm). BC Serum levels of amylase and lipase in each group of mice. D Blood glucose concentrations. EG ELISA analysis of serum IL-1β, IL-6, and TNF-α levels in mice. HJ qPCR analysis of IL-1β, IL-6, and TNF-α mRNA expression in mouse pancreatic tissues. K TUNEL staining of pancreatic sections showing apoptotic cells (green) and nuclei (blue, DAPI) in each group of mice (scale bar = 50 µm). Data are presented as mean ± SD (n = 3 mice per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; ML162, selective Txnrd1 inhibitor; IL-1β, interleukin-1 beta; IL-6, interleukin-6; TNF-α, tumor necrosis factor-alpha; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; DAPI, 4’,6-diamidino-2-phenylindole

Furthermore, ML162 treatment partially restored blood glucose levels that were diminished under SAP conditions (Fig. 5D), suggesting improved metabolic stability. To evaluate systemic inflammation, we measured serum levels of proinflammatory cytokines including IL-1β, IL-6, and TNF-α. ELISA results showed that all three cytokines were significantly increased in SAP mice, whereas ML162 treatment significantly reduced their circulating levels (Fig. 5E–G). Similarly, qPCR analysis of pancreatic tissues confirmed a decrease in IL-1β, IL-6, and TNF-α mRNA expression following ML162 treatment (Fig. 5H–J). To further assess cellular apoptosis, TUNEL staining was performed. A pronounced increase in TUNEL-positive apoptotic cells was observed in the SAP group, while ML162 treatment substantially reduced apoptosis in the pancreatic tissue (Fig. 5K). Collectively, these data demonstrate that pharmacological inhibition of Txnrd1 with ML162 effectively alleviates pancreatic injury, suppresses inflammatory responses, and mitigates apoptosis in SAP mice.

ML162 Treatment Alleviates Oxidative Stress by Enhancing Nrf2/HO-1 Antioxidant Responses in SAP Mice

To determine whether the protective effect of ML162 in SAP is mediated through antioxidant mechanisms, we examined oxidative stress markers and antioxidant protein expression in pancreatic tissues. Compared to the Blank group, SAP mice showed markedly elevated levels of ROS and MDA, along with significantly decreased GSH content, indicating enhanced oxidative stress. ML162 treatment effectively reversed these changes by reducing ROS and MDA levels and restoring GSH levels (Fig. 6A–C), suggesting its antioxidative potential. Western blot analysis further revealed that SAP led to a significant downregulation of key antioxidant proteins, including Nrf2, HO-1, and SOD1, accompanied by a marked increase in Txnrd1 expression. Notably, ML162 treatment reversed these alterations, upregulating Nrf2, HO-1, and SOD1 expression while reducing Txnrd1 levels (Fig. 6D–H), indicating that inhibition of Txnrd1 enhances endogenous antioxidant responses via the Nrf2/HO-1 axis. To further verify the reduction of oxidative damage, we performed immunohistochemical staining for 4-HNE, a lipid peroxidation marker, and MPO, a marker of neutrophil infiltration and oxidative inflammation. SAP mice exhibited strong 4-HNE and MPO staining in pancreatic tissues, whereas ML162-treated mice showed substantially reduced immunoreactivity (Fig. 6I–J), supporting the conclusion that Txnrd1 inhibition alleviates oxidative tissue damage. Together, these findings demonstrate that ML162 exerts protective effects in SAP mice by enhancing antioxidant defenses and attenuating oxidative stress through activation of the Nrf2/HO-1 pathway.

Fig. 6.

Fig. 6

ML162 treatment alleviates oxidative stress by enhancing Nrf2/HO-1 antioxidant responses in SAP mice. AC Quantification of ROS, MDA, and GSH levels in pancreatic tissues from mice in the Blank, SAP, and SAP + ML162 groups. D Representative western blot images showing the expression of Nrf2, HO-1, SOD1, and Txnrd1 in pancreatic tissues. EH Densitometric analysis of Nrf2, HO-1, SOD1, and Txnrd1 protein levels. IJ IHC staining of 4-HNE and MPO in mouse pancreatic tissues (scale bar = 50 μm). Data are presented as mean ± SD (n = 3 mice per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; ML162, selective Txnrd1 inhibitor; ROS, reactive oxygen species; MDA, malondialdehyde; GSH, glutathione; Nrf2, nuclear factor erythroid 2–related factor 2; HO-1, heme oxygenase-1; SOD1, superoxide dismutase 1; Txnrd1, thioredoxin reductase 1; 4-HNE, 4-hydroxynonenal; MPO, myeloperoxidase; IHC, immunohistochemistry

Txnrd1 Knockdown Alleviates Pancreatic Inflammation and Oxidative Stress in SAP Mice

To further validate the in vivo role of Txnrd1 in SAP progression, we constructed a Txnrd1 knockdown mouse model using adeno-associated virus (AAV)–mediated delivery of shRNA, followed by SAP induction with L-arginine. Histological analysis revealed extensive pancreatic damage in SAP and shCtrl + SAP mice, characterized by acinar cell necrosis, inflammatory infiltration, and tissue edema, while KD-Txnrd1 + SAP mice exhibited markedly alleviated histopathological changes (Fig. 7A). Correspondingly, serum levels of amylase and lipase were significantly elevated in SAP mice and partially reversed upon Txnrd1 knockdown (Fig. 7B and C). In addition, SAP-induced hypoglycemia was mitigated in the KD-Txnrd1 + SAP group, suggesting improved pancreatic function (Fig. 7D). Oxidative stress indicators, including ROS and MDA, were markedly increased in SAP mice, accompanied by a reduction in GSH levels (Fig. 7E); These alterations were significantly attenuated following Txnrd1 knockdown. Moreover, ELISA and qPCR analyses showed that the systemic levels of proinflammatory cytokines TNF-α, IL-6, and IL-1β in the serum and tissues were significantly reduced in KD-Txnrd1 + SAP mice compared to both SAP and shCtrl + SAP controls (Fig. 7H). Taken together, these findings demonstrate that AAV-mediated Txnrd1 knockdown effectively mitigates pancreatic inflammation and oxidative stress in SAP mice.

Fig. 7.

Fig. 7

Txnrd1 knockdown alleviates pancreatic inflammation and oxidative stress in SAP mice. A Representative H&E staining of pancreatic tissues from mice in the Blank, SAP, shCtrl + SAP, and KD-Txnrd1 + SAP groups (scale bar = 50 μm). BC Serum amylase and lipase levels in each group of mice. D Blood glucose levels. EG Pancreatic levels of ROS, MDA, and GSH in each group. EJ Serum levels of TNF-α, IL-6, and IL-1β as assessed by ELISA. Data are presented as mean ± SD (n = 3 mice per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; shCtrl, negative control shRNA; KD-Txnrd1, Txnrd1 knockdown; H&E, hematoxylin and eosin; ROS, reactive oxygen species; MDA, malondialdehyde; GSH, glutathione; TNF-α, tumor necrosis factor-alpha; IL-6, interleukin-6; IL-1β, interleukin-1 beta

Txnrd1 Knockdown Alleviates inflammation, Apoptosis, and Oxidative Stress in SAP Mice

To further elucidate the protective mechanisms of Txnrd1 knockdown in SAP, we evaluated markers of oxidative damage, inflammation, and apoptosis in pancreatic tissues. Immunohistochemical staining revealed intense 4-HNE accumulation and MPO infiltration in the SAP and shCtrl + SAP groups, indicative of elevated lipid peroxidation and neutrophil-mediated inflammation (Fig. 8A and B). In contrast, KD-Txnrd1 + SAP mice showed markedly reduced 4-HNE and MPO signals, suggesting that Txnrd1 knockdown alleviates oxidative injury and inflammatory cell infiltration (Fig. 8A and B). In line with this, TUNEL staining demonstrated widespread apoptotic cell death in SAP and shCtrl + SAP pancreatic tissues, which was significantly decreased in KD-Txnrd1 + SAP mice (Fig. 8C). Furthermore, Western blot analysis showed that the expression levels of antioxidant proteins Nrf2, HO-1, and SOD1 were suppressed in SAP conditions but were robustly restored in the KD-Txnrd1 + SAP group, while Txnrd1 levels were effectively silenced (Fig. 8D-H). These results indicate that Txnrd1 knockdown not only reduces oxidative stress and inflammation but also enhances antioxidant defenses and suppresses apoptosis in SAP-induced pancreatic injury.

Fig. 8.

Fig. 8

Txnrd1 knockdown alleviates inflammation, apoptosis, and oxidative stress in SAP mice. A Representative immunohistochemical staining of 4-HNE in pancreatic tissues from mice in the Blank, SAP, shCtrl + SAP, and KD-Txnrd1 + SAP groups (scale bar = 50 μm). B Representative immunohistochemical staining of MPO in pancreatic tissues (scale bar = 50 μm). C TUNEL staining of pancreatic tissues showing apoptotic cells (green) and nuclei (blue, DAPI) in each group (scale bar = 50 μm). D Representative Western blot images of Nrf2, HO-1, SOD1, and Txnrd1 expression in pancreatic tissues. EH Densitometric quantification of the protein levels of Nrf2, HO-1, SOD1, and Txnrd1. Data are presented as mean ± SD (n = 3 mice per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; Txnrd1, thioredoxin reductase 1; KD, knockdown; shCtrl, short hairpin control; 4-HNE, 4-hydroxynonenal; MPO, myeloperoxidase; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling; DAPI, 4′,6-diamidino-2-phenylindole; Nrf2, nuclear factor erythroid 2–related factor 2; HO-1, heme oxygenase-1; SOD1, superoxide dismutase 1

Txnrd1 Knockdown Attenuates Ferroptosis-associated Signaling and Oxidative Injury in the Pancreatic Tissues of SAP Mice

To further explore the molecular mechanisms underlying the protective effects of Txnrd1 knockdown in SAP, we performed a series of analyses to investigate potential signaling pathways and regulatory networks involved. A protein–protein interaction (PPI) network generated using the STRING database revealed that Txnrd1 is closely connected to multiple proteins associated with oxidative stress responses and cellular injury pathways (Fig. 9A). Gene Ontology (GO) enrichment analysis indicated that Txnrd1-related networks are involved in biological processes such as response to oxidative stress, lipid metabolic processes, and regulation of cell death (Fig. 9B), all of which are commonly linked to lipid peroxidation–associated cell injury.

Fig. 9.

Fig. 9

Txnrd1 knockdown alleviates ferroptosis in the pancreatic tissues of SAP mice. A PPI network analysis of Txnrd1-associated targets. B GO enrichment analysis of Txnrd1-related genes. C KEGG pathway analysis indicating enrichment in ferroptosis-associated pathways. D Representative Western blot images showing the expression of COX2, NOX1, ACSL4, GPX4, and SLC7A11 in pancreatic tissues from SAP mice in the shCtrl + SAP and KD-Txnrd1 + SAP groups. EI Densitometric analysis of COX2, NOX1, ACSL4, GPX4, and SLC7A11 protein levels. Data are presented as mean ± SD (n = 3 mice per group). *p < 0.05, **p < 0.01, ***p < 0.001. Abbreviations: SAP, severe acute pancreatitis; Txnrd1, thioredoxin reductase 1; KD, knockdown; shCtrl, short hairpin control; PPI, protein–protein interaction; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; COX2, cyclooxygenase-2; NOX1, NADPH oxidase 1; ACSL4, acyl-CoA synthetase long-chain family member 4; GPX4, glutathione peroxidase 4; SLC7A11, solute carrier family 7 member 11

Consistently, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis demonstrated enrichment of Txnrd1-associated proteins in pathways related to glutathione metabolism and ferroptosis-associated signaling (Fig. 9C), suggesting a potential role for Txnrd1 in redox-dependent cell injury processes rather than direct execution of a specific cell death program.

To further assess the relevance of these bioinformatics findings in vivo, we examined the expression of representative regulators associated with lipid peroxidation and ferroptosis-related pathways in pancreatic tissues from SAP mice. Western blot analysis showed that Txnrd1 knockdown significantly reduced the expression of proteins involved in lipid peroxidation and oxidative stress amplification, including COX2, NOX1, and ACSL4, while increasing the levels of GPX4 and SLC7A11, key regulators of cellular antioxidant capacity and cystine–glutamate transport (Fig. 9D–I).

These molecular changes were consistent with the observed attenuation of oxidative stress and preservation of mitochondrial integrity described in earlier experiments. Collectively, these findings suggest that Txnrd1 knockdown mitigates SAP-associated pancreatic injury by modulating redox homeostasis and ferroptosis-associated signaling pathways, thereby reducing susceptibility to lipid peroxidation–driven cellular damage.

Discussion

AP is increasingly prevalent, with a subset of cases progressing to SAP, which carries high mortality [15, 16]. Current treatments are mainly supportive, underscoring the need for novel molecular targets to guide effective therapy [5, 17, 18].

In this study, we demonstrate for the first time that thioredoxin reductase 1 (Txnrd1), a key redox-regulating selenoenzyme, plays a critical role in the development and progression of AP. We first established a mouse model of acute pancreatitis using L-arginine. The L-arginine–induced severe acute pancreatitis (SAP) model is a well-established and widely used experimental model that reliably induces reproducible pancreatic injury with typical features of SAP, including extensive acinar cell necrosis, robust inflammatory infiltration, oxidative stress, and systemic inflammatory response [1921]. The mechanisms underlying L-arginine–induced SAP may involve activation of inflammatory pathways, oxidative stress, dysregulation of Ca²⁺ influx and efflux, and perturbation of calcium signaling pathways. Reported mortality in this model is approximately 5–7% [20]. Transcriptomic and protein expression analysis revealed that Txnrd1 is significantly upregulated in pancreatic tissues of L-arginine–induced SAP mice, suggesting its potential involvement in disease pathogenesis. Importantly, Txnrd1 knockdown or pharmacological inhibition using ML162 effectively attenuated pancreatic damage, reduced oxidative stress, and suppressed both systemic and local inflammatory responses.

Mechanistically, Txnrd1 is a key selenoenzyme involved in maintaining redox homeostasis and regulating cellular responses to oxidative stress. Previous studies have shown that Txnrd1 contributes to the generation of inflammatory responses and oxidative damage under various pathological conditions. In diabetic rat models, Txnrd1 expression is markedly upregulated, which correlates with elevated serum lipid levels, increased pro-inflammatory cytokines, and enhanced oxidative stress. Notably, silencing of miR‑875‑5p has been reported to alleviate these pathological features by suppressing Txnrd1 expression [22]. Overactivation of Txnrd1 in AP may disrupt redox balance, promote ROS accumulation, and trigger oxidative injury to acinar cells. Consistent with this, our in vitro experiments using C266 pancreatic acinar cells showed that Txnrd1 silencing markedly reduced ROS and MDA levels while increasing intracellular GSH content, indicating that Txnrd1 contributes to oxidative stress in SAP. Furthermore, Txnrd1 knockdown enhanced cell viability and reduced apoptosis, accompanied by restoration of antioxidant genes such as Nrf2, SOD1, and HO-1. Interestingly, our findings are in line with previous work by Jianhui Liang et al., who reported that Txnrd1 inhibition in osteoarthritis models led to activation of the Nrf2 signaling pathway and increased expression of the downstream antioxidant enzyme heme oxygenase-1 (HO-1) [23]. In addition to the mechanisms described above, overactivation of Txnrd1 may have further implications on cellular redox balance. As a key enzyme in the thioredoxin (Trx) system, Txnrd1 catalyzes the NADPH-dependent reduction of oxidized thioredoxin, thereby maintaining redox homeostasis. Excessive Txnrd1 activity could theoretically lead to increased NADPH consumption, and if NADPH regeneration is insufficient, this may disturb the overall cellular redox balance [24]. Moreover, overactivation of Txnrd1 might perturb the thioredoxin system, potentially affecting the reduction of other downstream targets and altering oxidative stress responses. Although our current study did not directly measure NADPH levels or global thioredoxin system function, these considerations highlight a potentially important mechanism by which Txnrd1 overactivation could exacerbate oxidative injury in SAP.

One of the notable observations in our study is the association between Txnrd1 and ferroptosis-related molecular alterations. This notion was initially suggested by transmission electron microscopy, which showed that Txnrd1 knockdown mitigated mitochondrial abnormalities, including mitochondrial shrinkage, increased membrane density, and cristae disruption. While these ultrastructural features have been reported in ferroptosis, they are not exclusive to this form of cell death and may also reflect severe oxidative stress and mitochondrial dysfunction. To further explore the potential link between Txnrd1 and ferroptosis-related processes, we conducted protein–protein interaction (PPI) network analysis and functional enrichment analyses (GO and KEGG), which revealed that Txnrd1 is closely connected with pathways involved in redox regulation, lipid metabolism, and ferroptosis-associated signaling. Consistent with these bioinformatic predictions, experimental analyses showed that Txnrd1 silencing was accompanied by increased expression of GPX4 and SLC7A11—key regulators of cellular redox homeostasis and ferroptosis resistance—as well as reduced levels of COX2, NOX1, and ACSL4, proteins implicated in lipid peroxidation and oxidative membrane damage [2528]. Together, these findings suggest that Txnrd1 may influence the susceptibility of pancreatic acinar cells to ferroptosis-related stress by modulating redox balance and lipid peroxidation pathways.

In addition, pharmacological inhibition of Txnrd1 with ML162 in vivo alleviated pancreatic histological injury, reduced serum and tissue inflammatory responses, and mitigated oxidative stress–associated damage. Consistent with these protective effects, immunohistochemical analyses revealed reduced lipid peroxidation–related signals, while TUNEL staining demonstrated a decrease in apoptotic cell death in ML162-treated mice. These findings suggest that Txnrd1 inhibition confers cytoprotective effects in SAP primarily through modulation of oxidative stress and apoptosis, while its impact on ferroptosis in vivo appears to be indirect and remains to be further clarified.

Our observations are in line with previous studies in other disease models in which Txnrd1 has been implicated in oxidative stress–related injury and redox imbalance, including contexts where ferroptosis-associated pathways are dysregulated. However, the functional relevance of Txnrd1 in pancreatitis has not been systematically explored. The present study extends existing knowledge by demonstrating that Txnrd1 is upregulated in SAP and contributes to pancreatic injury by influencing redox homeostasis, inflammatory responses, and ferroptosis-related molecular signaling.

Despite these advances, several limitations of this study should be acknowledged. First, the precise molecular interactions between Txnrd1 and key regulators involved in ferroptosis-associated pathways remain incompletely defined. Second, the GO and KEGG enrichment analyses were based on predicted or previously reported Txnrd1-interacting proteins rather than direct experimental validation in pancreatic tissue; therefore, the identified interactions and pathways should be interpreted as putative in the context of SAP. Future studies incorporating targeted proteomic approaches or co-immunoprecipitation assays in pancreatic acinar cells would help substantiate these interactions and strengthen mechanistic conclusions.

In addition, Txnrd1 expression in the present study was primarily assessed at the mRNA and protein levels, without direct measurement of its enzymatic activity. Given that Txnrd1 functions as a redox enzyme, assessing its activity may provide further mechanistic insight into how Txnrd1 modulation affects oxidative stress responses and downstream signaling pathways in SAP. Moreover, the upstream signals responsible for Txnrd1 induction during pancreatitis, as well as its potential crosstalk with other regulated cell death pathways such as necroptosis or pyroptosis, warrant further investigation.

In conclusion, our findings identify Txnrd1 as an important regulator of oxidative stress and inflammatory injury in severe acute pancreatitis, with a modulatory role in ferroptosis-associated molecular pathways. Genetic or pharmacological inhibition of Txnrd1 confers protective effects in both cellular and animal models, highlighting Txnrd1 as a potential therapeutic target for SAP.

Author Contributions

ZPS, ZKZ, and HCZ conceived the study; HZ and ZPS performed methodology; ZYD, FLZ, and LL conducted formal analysis and investigation; ZPS, LL, JY, and ZLQ prepared the original draft; all authors reviewed and edited the manuscript; HCZ and ZLQ acquired funding; HJ and HCZ provided resources; HCZ and ZLQ supervised the study.

Funding

This study was funded by the Anhui Provincial Department of Education, Key Project of Natural Science (Grant No. 2024AH051271).

Data Availability

All data generated and analyzed during the current study are available in this published article.

Declarations

Ethics Approval and Consent

All animal experiments were reviewed and approved by the Ethics Committee of Bengbu Medical University (Approval No. 2025 − 129) and were conducted in strict accordance with the institutional guidelines for the care and use of laboratory animals. Human clinical studies were approved by the Ethics Committee of Bengbu Medical University (Approval No. 2024-045), and written informed consent was obtained from all participants prior to inclusion in the study.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Ze-peng Shen and Lin Liu contributed equally to this work and share first authorship

Contributor Information

Hong-chang Zhao, Email: hozhao@bbmu.edu.cn.

Zhao-lei Qiu, Email: 012006011@bbmu.edu.cn.

References

  • 1.Wu, J., L. Zhang, and J. Shi et al. 2020. Macrophage phenotypic switch orchestrates the inflammation and repair/regeneration following acute pancreatitis injury [J]. EBioMedicine 58:102920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Li, T., C. Qin, and B. Zhao et al. 2024. Global and regional burden of pancreatitis: Epidemiological trends, risk factors, and projections to 2050 from the global burden of disease study 2021. BMC Gastroenterology 24(1):398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Banks P A, Bollen T L, Dervenis, C. et al. 2013. Classification of acute pancreatitis–2012: Revision of the Atlanta classification and definitions by international consensus. Gut 62(1):102–111. [DOI] [PubMed] [Google Scholar]
  • 4.Wu C, Y, Wang K Q, and Qin Y Y et al. 2024. Micheliolide ameliorates severe acute pancreatitis in mice through potentiating Nrf2-mediated anti-inflammation and anti-oxidation effects. International Immunopharmacology 143(Pt 2):113490. [DOI] [PubMed] [Google Scholar]
  • 5.Tan, J. H., and L. Cao R C, Zhou et al. 2020. ATF6 aggravates acinar cell apoptosis and injury by regulating p53/AIFM2 transcription in severe acute pancreatitis. Theranostics 10(18):8298–8314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yu W Q, Zhang S Y, and Fu S Q et al. 2019. Dexamethasone protects the glycocalyx on the kidney microvascular endothelium during severe acute pancreatitis. Journal of Zhejiang University Science B 20(4):355–362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang, J., and R. L. Rouse. 2014. Histopathology and pathogenesis of caerulein-, duct ligation-, and arginine-induced acute pancreatitis in Sprague-Dawley rats and C57BL6 mice. Histology and Histopathology 29(9):1135–1152. [DOI] [PubMed] [Google Scholar]
  • 8.Liu, H., X. Xu, and J. Li et al. 2024. Overexpression of Plakophilin2 mitigates capillary leak syndrome in severe acute pancreatitis by activating the p38/MAPK signaling pathway. Journal of Inflammation Research 17:4129–4149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Sawa, H., T. Ueda, and Y. Takeyama et al. 2007. Role of toll-like receptor 4 in the pathophysiology of severe acute pancreatitis in mice. Surgery Today 37(10):867–873. [DOI] [PubMed] [Google Scholar]
  • 10.Ge, P., S. Luo, and Y. Okoye C et al. 2020. Intestinal barrier damage, systemic inflammatory response syndrome, and acute lung injury: A troublesome trio for acute pancreatitis. vol. 132 110770. Biomedicine & Pharmacotherapy = Biomedecine & Pharmacotherapie. [DOI] [PubMed] [Google Scholar]
  • 11.Shen, Q., Z. Li, and S. Huang et al. 2017. Intestinal mucosal barrier dysfunction in SAP patients with MODS ameliorated by continuous blood purification. The International Journal of Artificial Organs, 0. [DOI] [PubMed]
  • 12.Huang, H., and M. H. Zhou Q, Chen. 2021. High-volume hemofiltration reduces short-term mortality with no influence on the incidence of MODS, hospital stay, and hospitalization cost in patients with severe-acute pancreatitis: A meta-analysis. Artificial Organs 45(12):1456–1465. [DOI] [PubMed] [Google Scholar]
  • 13.LV, J. C., G. Wang, and Pan S H et al. 2015. Lycopene protects pancreatic acinar cells against severe acute pancreatitis by abating the oxidative stress through JNK pathway. Free Radical Research 49(2):151–163. [DOI] [PubMed] [Google Scholar]
  • 14.Hu, J., M. Cheng, and C. Jiang et al. 2024. Deferoxamine mitigates ferroptosis and inflammation in hippocampal neurons after subarachnoid hemorrhage by activating the Nrf2/TXNRD1 axis. Molecular Neurobiology 61(2):1044–1060. [DOI] [PubMed] [Google Scholar]
  • 15.Liu, Y., H. Cui, and C. Mei et al. 2023. Sirtuin4 alleviates severe acute pancreatitis by regulating HIF-1α/HO-1 mediated ferroptosis. Cell Death & Disease 14(10):694. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Tang, G., C. Yu, and K. Xiang et al. 2022. Inhibition of ANXA2 regulated by SRF attenuates the development of severe acute pancreatitis by inhibiting the NF-κB signaling pathway. Inflammation Research: Official Journal of the European Histamine Research Society [et al] 71(9):1067–1078. [DOI] [PubMed] [Google Scholar]
  • 17.Sun, Y., R. Gu, and Z. Shen et al. 2023. MALAT1 knockdown alleviates myocardial injury in mice with severe acute pancreatitis via the miR-374a/Sp1/Wnt/β-catenin pathway. American Journal of Translational Research 15(6):3928–3941. [PMC free article] [PubMed] [Google Scholar]
  • 18.Lin, T., M. Peng, and Q. Zhu et al. 2024. S1PR2 participates in intestinal injury in severe acute pancreatitis by regulating macrophage pyroptosis. Frontiers in Immunology 15:1405622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang, J., X. Tang, and Q. Wu et al. 2022. A severe acute pancreatitis mouse model transited from mild symptoms induced by a Two-Hit strategy with L-Arginine. Life (Basel Switzerland), 12(1). [DOI] [PMC free article] [PubMed]
  • 20.Hegyi, P., J. R. Rakonczay Z, and R. Sári et al. 2004. L-arginine-induced experimental pancreatitis. World Journal of Gastroenterology 10(14):2003–2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cai, Y., F. Yang, and X. Huang. 2024. Oxidative stress and acute pancreatitis (Review). Biomedical Reports 21(2):124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Fu, S., S. Fu, and X. Ma et al. 2021. miR–875–5p regulates IR and inflammation via targeting TXNRD1 in gestational diabetes rats. Molecular Medicine Reports, 23(5). [DOI] [PMC free article] [PubMed]
  • 23.Liang, J., S. Wang, and J. Hu et al. 2022. Targeted Inhibition of TXNRD1 prevents cartilage extracellular matrix degeneration by activating Nrf2 pathway in osteoarthritis. Biochemical and Biophysical Research Communications 635:267–276. [DOI] [PubMed] [Google Scholar]
  • 24.Pillay C S, Hofmeyr J H, Rohwer, J. M. 2011. The logic of kinetic regulation in the thioredoxin system. BMC Systems Biology 5:15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhou, H., B. Li, and Z. Wang et al. 2025. HO-1-mediated ferroptosis regulates retinal neovascularization via the COX2/VEGFA axis. Free Radical Biology & Medicine 226:84–95. [DOI] [PubMed] [Google Scholar]
  • 26.Xu, Y., Y. Liu, and K. Li et al. 2022. COX-2/PGE2 pathway inhibits the ferroptosis induced by cerebral ischemia reperfusion. Molecular Neurobiology 59(3):1619–1631. [DOI] [PubMed] [Google Scholar]
  • 27.Wang, H., W. Mao, and Y. Zhang et al. 2024. NOX1 triggers ferroptosis and ferritinophagy, contributes to Parkinson’s disease. Free Radical Biology & Medicine 222:331–343. [DOI] [PubMed] [Google Scholar]
  • 28.Tao, L., K. Yang, and K. Wang et al. 2024. NOX1-mediated oxidative stress induces chondrocyte ferroptosis by inhibiting the Nrf2/HO-1 pathway. Scientific Reports 14(1):19877. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data generated and analyzed during the current study are available in this published article.


Articles from Inflammation are provided here courtesy of Springer

RESOURCES