Neurotoxicogenomic impact of 4-nonylphenol on Heteropneustes fossilis via molecular, histopathological and bioinformatic analysis

Abstract

Exposure to 4-Nonylphenol at concentrations of 64 µg/L (low) and 160 µg/L (high) for 30 to 60 days, spanning the pre-spawning to spawning phases in H. fossilis, induces significant adverse effects in the brain, particularly within the telencephalon and cerebellum regions. Additionally, protein content in brain decreases in treated group of 4-Nonylphenol (4-NP), brain acetylcholinesterase (AChE) activity decreases in a manner contingent upon the amount of dose and exposure period. In the brain tissue of H. fossilis, exposure to 4-Nonylphenol (4-NP) results in a dose-dependent decrement of antioxidant enzymes including Superoxide dismutase(SOD), Catalase, and Glutathione peroxidase(GPx), alongside a dose and duration-dependent increase in Lipid peroxidation (LPO) levels. Cortisol level in the brain increases with higher doses of 4-NP. The exposure to 4-NP induces a dose-dependent increase in cell death after both 30 and 60 days, with a marked increase in necrosis after 30 days. However, at 60 days, apoptosis becomes more prominent, suggesting a shift toward programmed cell death due to prolonged exposure. In the brain cells of H. fossilis, exposure to 4-Nonylphenol (4-NP) over 30 to 60 days caused an escalation in reactive oxygen species (ROS) and DNA fragmentation. Gene expression of brain aromatase (Cyp19a1b) and Gonadotropin-releasing hormone (GnRH) is downregulated in a dose-dependent manner. These findings indicate that both acute and chronic exposure to 4-NP induces neurotoxicity in male H. fossilis by crossing the blood–brain barrier. This was further validated through an in silico analysis using SwissADME, which predicted high intestinal absorption of 4-NP and its potential to cross the blood–brain barrier. Additionally, molecular docking and Molecular Dynamics (MD) simulations substantiated a strong binding affinity of 4-NP to acetylcholinesterase in the brain. Overall, this investigation demonstrates that 4-NP disrupts brain tissue, impairs antioxidant defenses, promotes ROS production, and impacts gene expression and brain enzyme activity.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-36820-8.

Introduction

Due to anthropogenic activity such as industrialization, domestication, and agricultural practices, eventually disposing of their sewage wastewater in aquatic bodies causes our natural aquatic ecosystem to be full of toxicants. These toxicants cause alterations in homeostasis in the body of an aquatic organism and hamper the different physiological processes, including development, metabolism, and growth. 4-Nonylphenol (4-NP) is one of the potent micropollutants which are pervasive, due to its high bioconcentration factor, lipophilicity (octanol–water partition coefficient log Kow of 4-Nonylphenol is 4.48)¹, nondegradable causes prolonged existence in the environment and via biomagnification, it reaches to the human population.4-NP has been reported as a potent endocrine-disrupting chemical, xenoestrogenic, and neurotoxicity. The global threat posed by 4-NP requires significant attention, as its health impacts extend beyond aquatic creatures to humans by accumulating in lipids of living beings along food consumption². Even though the Environmental Protection Agency (EPA) declare that susceptibility to Nonylphenol at levels up to 28 ppm at one time every three years does not affect freshwater existence³, the European Union has imposed curltainment on the use of NPs due to their endocrine-disrupting effects and widespread presence in industry and households⁴. It was reported¹ that the brain exhibited the elevated accumulation of 4-NP, while the muscle had the little assimilation in catfish Heteropneustes fossilis. Because of high polyunsaturated fatty acid concentration, brain tissue is especially vulnerable to free radical damage, making strict homeostasis maintenance required⁵. The brain and neurotransmitters roles in reducing the harmful effect of 4-NP in fish are not well understood. According to research survey⁶ acetylcholinesterase (AChE) is essential for the release of neurotransmitters, the modulation of neuronal electrical pursuit, and synaptic plasticity in the central nervous system (CNS). The catfish H. fossilis serves as a toxicological model, with numerous studies investigating the toxicity of 4-NP in different species⁷. The spinal cord and brain play crucial roles in fish physiology and their rigorous maintenance of homeostasis, neuronal tissue is frequently investigated in fish toxicity research⁷. According to some research, brain biomarkers might be helpful in tracking pollution levels and offering early alerts when pollutants are being exposed⁸. As aforementioned biomarkers, neuronal cell death in a variety of clinical diseases, especially chronic degenerative brain illnesses, is frequently attributed to apoptosis⁹. Cell morphological abnormalities, such as alterations in cell shape, nuclear anomalies, and DNA damage, are linked to apoptosis^10–12. Throughout the process of oxidative phosphorylation that takes place in the mitochondrial respiratory chain, complexes I and III generate reactive oxygen species (ROS), chemically not stable molecules derived from oxygen. Physiological and pathological processes can cause ROS levels to increase, which can increase oxidative stress in cells. The effect of reactive oxygen species (ROS) generated from the metabolism of various xenobiotics can be mitigated by innate defense mechanisms, including specific antioxidant enzymes that help neutralize free radicals⁸.

4-NP induces oxidative stress by altering the level of antioxidant enzymes in the body of organisms which causes the generation of total ROS. Nevertheless, research explicitly investigating the impact of 4-NP neurotoxicity on fish brain tissue is not well understood. In silico molecular docking is a novel probing search procedure that simulates the 3D structure of a ligand and receptor binding domains¹³. Understanding the relationship of 4-NP binding with hormones can help explain the concentration–response and time response of xenoestrogens. However, there is limited research on the harmful impact of 4-NP on aquatic organisms using in silico methods. Additionally, earlier research has mainly examined the generalized toxicity of 4-NP, with little data available on its effects on neural tissue.

Material and methods

Chemicals

4-Nonylphenol (liquid), 99%, a mixture of isomers (CAS: 84852-15-3) was purchased from Acros Organics (Geel, Belgium),Disodium hydrogen phosphate dehydrate a dibasic salt, Sodium dihydrogen phosphate monohydrate, Bovine serum albumin from SRL,Thiobarbituric acid from Otto Chemika-Biochemika Reagent Acetic acid from Fischer Scientific ,Absolute alcohol Analytical Reagent from GBG,Butylated hydroxyl toluene from Molychem, L-methionine, 1% Triton X-100, Hydroxylamine hydrochloride, EDTA, riboflavin, 1% NED, 1% sulphanilamide, and 5% phosphoric acid, Glutaraldehyde TCI, osmium tetraoxide (osmic acid)2% w/v, Ottokemi, Copper sulfate SRL, acetone SRL, H₂O₂, Tris-HCl buffer, sodium azide, TCA, glutathione, DTNB, xylenol orange, NaCl, glycerol, sulphuric acid, o-dianisidine dihydrochloride and ferrous ammonium sulphate, Clark and Lubs solution a p-nitro-N, N-dimethylaniline, sodium hydroxide, potassium ferricyanide, DCFDA all were purchased from SRL,Ammonium chloride, Sodium bicarbonate, ethylene diamine tetra acetic acid, FBS from Hi Media, Potassium Chloride, Sodium Phosphate dibasic, Monopotassium phosphate, all were purchased from SRL, Annexin V binding buffer, Annexin V FITC antibody and Propidium iodide ELABSCIENCE APOPTOSIS KIT, cDNA synthesis kit (verso, Thermofisher, USA) cat.no. AB1453A, SYBR-Green qPCR thermo Fischer. Dimethylsulfoxide (DMSO)—Qualigens (CPW59), Disodium EDTA—HiMedia, Ethidium Bromide—Sigma, Sodium Hydroxide (NaOH)—BDH-Merck, Triton X-100-SRL.Phosphate Buffered Saline (PBS) (Ca++, Mg++free) – HiMedia.

Animal collection and acclimation

Sexually mature male catfish (H. fossilis, body weight 40–50 gm; length 15–35 cm), fish were purchased during the preparation phase (March–April; 11.5L: 12.5D, 22 ± 2 °C;), sourced from a nearby fish market in Varanasi, Uttar Pradesh.pH-7.5 and hardness of water was 130 mg/L. A 20-L flow-through aquarium was used to keep the fish, and 0.1% KMNO4 was used to disinfect them. To recover from the stressful conditions brought on by transit, they were housed for a week in a laboratory setting with normal temperature and photoperiod. They were fed boiled egg albumin ad libitum for the duration of the trial and during the acclimatization period.

All protocols in this study were approved by the Committee on the Animal Ethics of Banaras Hindu University, Varanasi institutional or licensing committee and the license number is as follows: B.H.U./IAEC/2019–2020/004 dated 03/03/2020. All methods and procedures were carried out in accordance with ARRIVE guidelines 2.0 for experimentation in animals as well as the rules and regulations of the Animal Ethics Committee of Banaras Hindu University, Varanasi. No extra animal discomfort was caused for sample collection for the purpose of this study. Intensive care was given to prevent cruelty of any kind. All experiments were performed in accordance with relevant guidelines and regulations.

Exposure to 4-NP

A total number of 90 male catfish (30–40 g, length 15 ± 3.5 cm) were sourced from the local fish market to investigate the impact of 4-Nonylphenol on male H. fossilis during the pre-spawning phase (March–April, 11.5L: 12.5D, 22 ± 2 °C). Nonylphenol was dissolved in ethanol (10.7 μl of 4-NP was dissolved in 1 ml of ethanol (99.9%) and then diluted with triple distilled water upto 10 ml to obtain a stock solution 1 μg µL⁻¹. These concentrations were determined by the lethal concentration. dosage (LC₅₀) value¹ and these concentrations are in range between environmental dose i.e.,75.2–179.6 µg/L¹⁴. Fish that had been acclimatized from the preliminary phase were kept in three separate 10-L tanks. Control, low dose (64 μg. L⁻¹′1/25th of LC₅₀) and high dose (160 μg L⁻¹ 1/10th of LC₅₀) were represented by groups 1, 2, and 3 and 15 fishes in each group respectively. Semi-static conditions (renewable of doses were done after 12 h in regular intervals) were maintained for 30 days to 60 days of treatment¹.

Dissection

Fish were weighed when the experiment was completed, cold anesthesia¹⁵ was given, and sacrificed by decapitation¹⁶. The brain removed of the catfish H. fossilis, were fixed in Neutral buffer formalin (NBF) for 24 h, and they were kept in 70% alcohol for histopathological analysis and brain tissues were for biochemical and molecular analysis.

Histopathological assessment of brain of H. fossilis

After 24 h in 10% neutral buffered formalin (NBF), the telencephalon and cerebellum region of the brain part of catfish were placed in 30% alcohol for two one-hour changes. This was followed by two one-hour changes each in 50%, 70%, 90% and absolute alcohol. The tissues further processing for histology, including routine staining of paraffin Sects. (5 μm), were stained with hematoxylin and eosin (H&E), and photomicrographs were taken using a Olympus Magnus microscope with camera Magcam DC 5(5.1MP,1/2.5″ CMOS SENSOR) Histological features were identified following the H&E staining method.

AChE activity in the brain of H.fossilis

A homogenizer was used to homogenize 10% v/v brain tissues (whole brain) in 0.1 M phosphate buffer (pH 7.4) that contained Triton-X 100. After centrifuging the homogenates for 30 min at 4 °C at 10,000 rpm, the precipitate was disposed of, supernatants served as the source of enzyme for calculating AChE¹⁷. A modified¹⁸ approach was used to measure AChE activity, 50 µl of 0.5 mM DTNB in 1% sodium citrate, 200 µl of 0.5 M phosphate buffer (KH2PO4/K2HPO4; pH 8.0), 650 µl of H₂O, 50 µl of crude extract, and 50 µl of 10 mM Acetylthiocholine iodide made up the 1.0 ml total volume used for the enzymatic reaction. Acetylthiocholine iodide was absent from the control cuvette¹⁹. Using a UV1800 spectrophotometer (Molecular Devices, Shimadzu, Tokyo, Japan), variations in absorbance during 5 min at a wavelength of 412 nm were used to measure enzyme activity. To determine protein concentration²⁰ method was used.

Anti-oxidative parameters in the brain of H. fossilis

Brain tissues (whole brain) from each catfish across all groups were meticulously removed, the samples were rinsed in ice-cold physiological saline solution, blotted dry with filter paper, and weighed. A 10% tissue homogenate was then prepared in ice-cold phosphate buffer (0.05 M, pH 7.4) and centrifuged at 10,000 × g for 20 min at 4 °C. The supernatant was collected for the estimation of the protein by Bradford method, superoxide dismutase (SOD),²¹ protocol, estimation of catalase activity²², glutathione peroxidase (GPx) level²³, malondialdehyde (MDA) content^24,25. Using a multimode Agilent BioTek Gen5 version 3.12 reader, OD was taken in 96 non-coated ELISA well plates for the aforementioned tests.

Total antioxidant status and total oxidant status in the brain of H. fossilis

The established protocol was used to estimate TAS²⁶

In short, 75 mM KCl and 10 mM lubricant were dissolved to create reagent 1, also known as Clark and Lubs solution (75 mM, pH 1.8). o-dianisidine dihydrochloride, 75 mM reagent-grade hydrochloric acid, and 45 μM Fe(NH4)2(SO4)2·6H2O in 1000 ml of pure water. 7.5 mM hydrogen peroxide was combined with 1000 mL of distilled water to create Reagent 2. 200 μl of reagent 1 and 20 μl of brain homogenate were added to the microtiter plate to create the reaction mixture. After measuring the absorbance at 444 nm, 10 μl of reagent 2 was applied. Three to four minutes after adding reagent two, the final absorbance was measured in a microplate reader (Biotek, USA). Results of each sample were expressed in terms of millimolar Trolox equivalent/L TOS²⁷ was determined in brain homogenate by the standard protocol. In brief, reagent 1 (pH 1.75) of TOS was prepared by adding 150 μM xylenol orange, 140 mM NaCl and 1.35 M glycerol in 25mMsulphuric acid Reagent 2 was prepared by adding 5 mM ferrous ammonium sulphate and 10 mM o-dianisidine dihydrochloride. Reaction was set up in a microtiter plate by adding 225 μl reagent 1 and 35 μl brain homogenate First absorbance was observed at 560 nm and further 11 μl reagent 2 was added and end point absorbance was observed after 3–4 min. The assay has been calibrated with hydrogen peroxide equivalent per litre (μM H2O2 Equiv./L).

Cortisol level in the brain of H. fossilis

Steroid extraction

Using an ultrasonic homogenizer (XL-2000 Microson, Misonix, USA) at 0 °C for 5–10 s, fifteen brains from males in each phase (prespawning and spawning) were thawed and homogenized independently in 4 vol cold PBS (0.02 M, phosphate-buffered saline solution, pH 7.4). Three volumes of diethylether were used to extract the homogenate after it had been centrifuged at 5000 g for 20 min at 4C. After being gathered, combined, evaporated, and dried using nitrogen gas, the ether phase was kept at − 20 °C until for assay.

The cortisol level was measured using the vested protocol²⁸ and finally the absorbance of the solution was checked at 650 nm using UV–Vis Spectrophotometer.

Apoptosis, necrosis, and viable cells assessment in the brain tissue of H.fossilis

Annexin V (AV) and propidium iodide (PI) staining was used to estimate apoptosis and necrosis. Cold FACS buffer was used to wash the dissected brain tissues and minced into 2–4 mm pieces using scissors and scalpel blade,0.25% trypsin was diluted in PBS and incubated the tissue in digestion solution at 28°–30° for 30 min with gentle agitation and filtered it through cell strainer(40 µm) to eliminate clumps and debris, cells were centrifuged at 300–400 × g for 5 min at 4 °C, supernatant were discarded and resuspended the pellet in PBS and again repeated the centrifugation process and finally the cells were resuspended in Annexin V binding buffer, stained with AV-FITC and PI, and incubated in the dark at room temperature for 15 min and then analyzed using a flow cytometer in a BECKMAN COULTER CytoFLEX (Trypan blue was used to assess cell health and > 70% cells were viable suitable for flow cytometry analysis). Gating strategies showed interpretation of the four quadrants i.,e Q1Upper left-necrotic cells, Q2 Upper right-late apoptotic cells, Q3Lower right-Early apoptotic cells, Q4 Lower left-viable cells.

Estimation of total ROS in the brain tissue of H. fossilis by flow cytometer

The DCFH-DA assay is a common method for the estimation of intracellular reactive oxygen species (ROS) levels in cells. Tissue was homogenized in 1 ml of FACS and centrifuged at 1000 RPM for 5 min, followed by removing the supernatant and adding 1 ml of FACS buffer, centrifuged at 1000 RPM for 5 min, repeated it three times. Single cell suspension was made containing 1 X 10⁵ cells in 100 μl of PBS was plated and incubated with 100 μl of 10 μM of DCFDA (2′,7′-dichlorodihydrofluorescein diacetate) at 37 °C for 10 min in the dark. Then, the cells were analyzed using the Beckman Coulter CytoFLEX S flow cytometer, USA²⁹.

DNA fragmentation in the brain tissue of H. fossilis by COMET assay

DNA fragmentation by COMET assay was followed by³⁰ tissue homogenate of the brain of H. fossilis. It was centrifuged at 4000 rpm at 4 °C for 5 min, 50 µl homogenate (supernatant) mixed with 50 µl low melting point agarose 1.5% (quick step),0.8% low melting point agarose was taken and cast on the slide add cover slip and then remove the coverslip after drying the gel (approx.10 min). 100 µl solution (1:1) sample and low-melting-point agarose were cast on slides. Then slides are placed in the lysing buffer in a coupling jar for 30 min and run in an electrophoretic buffer solution in the gel electrophoresis compartment at 25 V for 30 min. Then slides were washed in neutralizing buffer solution 2–3 times. Slides were stained with ethidium bromide stain for 5 min and scored immediately finally observed under the fluorescence microscope. Analysis of DNA damage was done by CapsLab software³¹.

GnRH and Cyp19a1b gene expression in the brain of H. fossilis

Total RNA was isolated from catfish brain tissue (optic tectum, ventral telencephalon region, hypothalamus and olfactory bulb region) using Trizol reagent and subsequently quantified and purity checked by measuring ultraviolet absorption at 260/280 nm. Complementary DNA (cDNA) was generated from 2 μg of total RNA using a cDNA synthesis kit (Thermofisher, USA). Gene expression analysis was performed via qPCR using the SYBR-Green qPCR Super Mix-UDG kit on a Mastercycler® ep realplex detection system (Agilent, USA). Relative mRNA levels were calculated using the 2 − ΔΔCt method, with β-actin as the internal control. The forward and reverse primer sequences for the target gene were as follows: Table 1

Table 1.

Forward and reverse primer sequences of target genes Gonadotropin releasing hormone (GnRh2), Brain aromatase (CYP19a1b) and β-actin as housekeeping gene.

Primer	Forward primer	Reverse primer	References
GnRh2	GTTCAGCACAGACGAGGCA	CTGATGTGTTCCTCCAGGGCA	119
CYP19a1b	CAAACTGGTCCCCAGTCGT	TGCAGCTTTCCTCAGGACAC	120
β actin	TGGCCGTGACCTGACTGAC	CCTGCTCAAGTCAAGAGCGAC	120

Physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

The pharmacokinetic server pKCMS and Swiss ADME were used to predict and compute 4-Nonylphenol’s physicochemical characteristics, drug-likeness, and ADME/Tox-related descriptors. On July 1, 2024, the compound’s chemical structures were retrieved in SDF (Structure Data Format) from the PubChem database (http://pubchem.ncbi.nlm.nih.gov/). The Swiss ADME web page was accessed, and files were imported using the external file option. Molecular structures were converted into sketches using ChemAxon’s Marvin JS’ to generate canonical SMILES for each compound, followed by ADME calculations using default parameters. As a result, pharmacokinetic profiles, drug similarity, and physicochemical characteristics were predicted. Swiss ADME was used to evaluate drug-likeness, which shows the probability that a molecule is an orally active drug based on its bioavailability. Swiss ADME filters chemical libraries to exclude incompatible molecules.

Assessment of binding affinity of protein Acetylcholine esterase biomarker with 4-NP by Molecular docking and MD simulation

Molecular docking of 4-NP with acetylcholine esterase AChE

We used AutoDock Vina 1.2.0 (Eberhardt et al., 2021) to investigate the binding interactions of 4-NP (PubChem ID: 1752) with AChE, of Danio rerio and its UniProt id Q9DDE3, establishing an exhaustiveness level of 200 for accuracy. AutoDock tools were used to obtain and build the three-dimensional protein structure of AChE (Alpha fold model: Q9DDE3) for docking³². From both terminals, the areas of poor confidence were removed. Grid box center values of x =  − 5.53, y = 4.20, z =  − 3.75, and grid box size values of x = 27.95, y = 21.11, z = 22.35 with 1 Å spacing were used to define the docking grid parameters. Following docking, we used ‘Maestro-12.4 4 (Schrödinger Release 2020–2: Maestro, Schrödinger, LLC, New York, NY, USA) for comprehensive 2D interaction profiles and UCSF Chimera for 3D interaction analysis³³.

Validation of 4-NP binding affinity

Using reiterated 200 ns Molecular Dynamics (MD) simulations, the stability of the 4-NP molecule in association with AChE was verified. The CHARMM 36 m force field served as the guide for the simulations, which were carried out using GROMACS software version 2021.1^34,35. SwissParam contributed the ligand’s topology and atomic charges, as necessary parameters³⁶. TIP3P water, enhanced with sodium and chloride ions to attain charge neutrality, served as our simulation environment in a triclinic water box. The V-rescale thermostat and Parrinello-Rahman barostat were used to maintain a constant 300 K temperature and 1 bar of pressure during the MD simulations following the initial energy minimization and system equilibration^37,38.

We used the LINCS algorithm³⁹ and the Particle Mesh Ewald approach⁴⁰ to maintain bond lengths and determine electrostatic forces, respectively. The radius of gyration (Rg), the root mean square deviation (RMSD) of the protein backbone and ligand, the minimum distance between the ligand and protein, and the Root Mean Square Fluctuations (RMSF) of residues near the ligand (within 5 Angstroms) were used to analyze these MD trajectories. The XMGRACE software (https://plasma-gate.weizmann.ac.il/Grace/) was used to generate the plots.

Free energy calculations

To compute the free energy using the Molecular Mechanics Generalized Born Surface Area (MMGBSA) method, we chose 400 snapshots from the 200 ns Molecular Dynamics (MD) simulation dataset, spaced by every 5th snapshot and spanning frames 18,000 to 20,000. MMPBSA.py was used to perform these computations^41–43. To determine each amino acid residue contribution to the system total energy, we also conducted a residue energy decomposition study. The energy contribution of each amino acid residue to the overall energy was also assessed using residue energy decomposition analysis. For free energy calculation, the following equation was used:

The binding free energy (ΔTotal) was estimated using van der Waals energy (ΔE_VDW); polar solvation energy (ΔE_GB); electrostatic energy (ΔE_EEL); non-polar solvation energy (ΔE_Surf); total gas-phase free energy (ΔG_gas); total solvation free energy (ΔG_Sol).

Statistical analysis

Evaluation of the data using the Bonferroni test (P < 0.05) as a post hoc test after a two-way analysis of variance (ANOVA). The data was presented as mean ± standard error mean (SEM) for n = 15. All statistical data were evaluated using Graph Pad Prism version 5.01.

Results and discussion

Effect of 4-NP on histology of brain H.fossilis

Histopathological assessment shows that exposure of 4-NP for 30 days to 60 days of low dose (64 µgL⁻¹) and high dose (160 µgL⁻¹) during pre-spawning to spawning period of catfish H. fossilis, sections of the telencephalon (Fig. 1) from the normal control group of H. fossilis, stained with H&E, displayed typical histological architecture. Neurons exhibiting a significant amount of uniform cytoplasm were visible along with their dendrites. The vesicular, rounded, centrally placed nuclei were observed. There was also a few neuroglia visible, their nuclei strongly stained. In the treated group adverse effects of 4-NP exposure on the telencephalon region of the brain of catfish like diffused and degenerated neurons, vacuolization, increased hemorrhage, and inflammatory cell generation. The Cerebellum region (Fig. 2) was also affected by exposure to 4-NP causing the formation of a separation gap between the molecular region and granular region, deformed necrotic neurons, vacuolization in the neuropil, Purkinje cells in treated groups when compared to control groups (Figs. 1 and 2).

Fig. 1.

Showing photomicrograph of the transverse section of the telencephalon region of the brain of treated catfish H. fossilis exposed to 4-NP. Fig (A, D): control, (B, E): experimental of 30 to 60 days low dose (64 µg/l) and (C, F): high dose (160 µg/l) of treatment during pre-spawning to spawning (May–July). H & E stain, Magnification: 40x, Scale bar: 20 µm a-neurons, b-neuropil, c-neuroglial cells, d-diffuse deformed and degenerated neurons, e-vacuolization, f-hemorrhage and inflammatory cells.

Fig. 2.

Showing photomicrograph of transverse section cerebellum region of the brain of treated catfish H. fossilis exposed to 4-NP. Fig (A, D): control, (B, E): experimental of 30 to 60 days low dose (64 µg/l) and (C, F): high dose (160 µg/l) of treatment during pre-spawning to spawning (May–July). H&E stain, Magnifiication: 40x, Scale bar: 20 µm, ML-molecular layer, GL-granular layer, a-neuroglial cells, b-neuropil, c-deformed necrotic neurons, d-vacuolization of neuropils, e-vacuolization in purkinje cells, f-separation gap between granular layers from molecular layer.

Effect of 4-NP on protein content in brain tissue of male H.fossilis

Protein content in the brain tissue of male H.fossilis was affected by 4-NP exposure, as compared to comtrol group treated group showed dose dependent decrease in the level of protein content of low dose (64 µgL⁻¹) high dose (160 µgL⁻¹) for 30 days and 60 days during pre-spawning to spawning period (Fig. 3).

Fig. 3.

Graphical representation of protein content in the brain tissue of H. fossilis due to effect of 4-NP with a concentration of low dose (LD) (64 µg/L) and high dose (HD)(160 µg/L) for 30 days to 60 days of experiment from pre-spwaning to spawning period. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way analysis of variance (ANOVA) followed by Bonferroni test. Different alphabets denote statistically significant changes from the control (C0N) (P < 0.001).

Effect of 4-NP on acetylcholine esterase activity (AChE) in the brain of H. fossilis

The activity of brain enzyme acetylcholine esterase (AChE) was affected by exposure of 4-NP induces a decrease that is dependent on both dose and duration in level in the treated group of low dose (64 µgL⁻¹) high dose (160 µgL⁻¹) for 30 days and 60 days during pre-spawning to spawning period (Fig. 4). Statistical analysis shows the significant difference between dose and duration as F value is greator than F-critical value but interaction between dose and duration shows no significant difference as F-value value is less than F-critical value (Table 2).

Fig. 4.

Graphical representation of AChE activity in the brain cells in H. fossilis due to effect of 4-NP with a concentration of low dose (LD) (64 µg/L) and high dose(HD) (160 µg/L) for 30 days to 60 days of experiment from pre-spwaning to spawning period. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way analysis of variance (ANOVA) followed by Bonferroni test. Different alphabets denote statistically significant changes from the control (CON) (P < 0.001).

Table 2.

F values of two ANOVA test of AChE activity in the brain cells in H. fossilis due to effect of 4-NP.

AChE activity	F-value duration	F-value dose	F-value of interaction of both
	11.06	8.747	0.356

Effects of 4-nonylphenol on anti-oxidative parameters, total antioxidant status, and total oxidant status in the brain of H. fossilis

A significant alteration was seen in antioxidant level in the brain tissue of H. fossilis due to exposure of 4-NP of low dose 64 µg/L and 160 µg/L of 30 and 60 days from the pre-spawning period to the spawning period. Dose-dependent significant decrease of SOD, GPx, Total Antioxidant status, and a decrease in catalase activity dependent on both dose and duration, along with a dose- and duration-dependent increase in LPO, a dose-dependent increase in Total oxidant status was found in brain tissue comparison to the control group of experiments (Figs. 5 and 6). Statistical analysis was also done and it was found that no significant difference in duration, interaction of dose and duration group. F-value was less than F-critical value but there was significant difference in dose groups in SOD level group (Table 3). In the treated group, catalase level its statistical significant difference was found in duration, dose group as well in interaction between dose and duration group as F-value was greater than F-critical value (Table 3). In treated group, GPx level statistical significant difference was not found in duration and interaction between dose and duration groups but had significant difference in dose groups. In LPO level all groups dose, duration and interaction between dose, duration were significantly difference as F-value was greater than F-critical value (Table 3). Total antioxidant status was found to be dose and duration dependent manner decreased. Total antioxidant status was found to be dose dependent manner decreased and Total oxidant status was found to be dose dependent increasing manner in brain tissue. Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of TAS (Table 4). In TOS there was significant difference in dose, duration and interaction between doses durations group where F-value is greater than F-critical value in brain tissue (Table 4). (Fig. 6 Supplementary data S1-Standard curve of Trolox for TAS measurement, Fig. 6 Supplementary data S2-Standard curve of H₂O₂ for TOS measurement).

Fig. 5.

Effects of 4-NP on antioxidant defense system (SOD, CAT, GPx, LPO) in the brain of male catfish H. fossilis during pre-spawning and spawning phase of the reproductive cycle of low dose (LD)(64 µg/L) and high dose(HD) (160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups (n = 15, P < 0.05).

Fig. 6.

Effects of 4-NP on TAS (total antioxidant status, expressed as micromole Trolox equivalent/L) and TOS (total oxidant status, expressed as micro mole H2O2 equivalent/L) in the brain of male catfish H. fossilis during pre-spawning and spawning phase of the reproductive cycle of low dose(LD)(64 µg/L) and high dose (HD)(160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant difference between experimental groups (n = 15, P < 0.05).

Table 3.

F values of two ANOVA test of effects of 4-NP on antioxidant defense system (SOD, CAT, GPx, LPO) in the brain of male catfish H. fossilis.

	F-value duration	F-value dose	F-value of interaction of both dose and duration
SOD	2.0065	243.87	2.754
F-critical	4.413873	3.12653	4.00234
CATALASE	4.87	229.48	3.75
F-critical	4.31234	4.56792	3.56789
GPx	2.83	108.86	0.052
F-critical	4.45643	3.526784	3.54321
LPO	7.667	451.1	4.313
F-critical	4.53245	3.56231	3.40982

Table 4.

F values of two ANOVA test of Effects of 4-NP on TAS (total antioxidant status) and TOS (total oxidant status) in the brain of male catfish H. fossilis.

	F-value duration	F-value dose	F-value of interaction of both dose and duration
TAS	163.09	937.7	12.73
F-critical	4.52341	4.34526	3.56743
TOS	63.45	127.7	6.5
F-critical	5.09654	4.03457	3.54321

Effects of 4-nonylphenol on cortisol in the brain of H. fossilis

The results indicated an increase in cortisol levels dependent on the dose in the brain tissue of H. fossilis when exposed to 4-NP at low (64 µg/L) and high (160 µg/L) doses for 30 and 60 days, from the pre-spawning to spawning period, compared to the control group. It was also observed that cortisol is higher in 30 days of treatment than in 60 days of treatment in the brain tissue of H. fossilis (Fig. 7). Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of cortisol level in in brain tissue (Table 5).

Fig. 7.

Effects of 4-NP on stress hormone cortisol level in brain of catfish H. fossilis during pre-spawning and spawning phase of reproductive cycle of low dose(LD)(64 µg/L) and high dose (HD)(160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two -way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant difference between experimental groups. (n = 15, P < 0.05).

Table 5.

F values of two ANOVA test of Effects of 4-NP on stress hormone cortisol level in brain of catfish H. fossilis.

	F-value duration	F-value dose	F-value of interaction of dose and duration
CORTISOL	395.997	855.91	23.798
F-critical	4.56321	5.87621	3.65482

Effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis

In brain it was depicted the number of percentage of necrotic cells increases in dose-dependent manner in 30 days of treatment of 4-NP but there was dose dependent increase in apoptotic cell percentage in 60 days of treatment in brain tissue of H.fossilis (Fig. 8).Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of necrosis percentage and apoptosis percentage in brain tissue (Table 6).

Fig. 8.

A-Flow cytometry dot plots of the simultaneous binding of annexin V-fluorescein isothiocyanate (FITC) (FL-1) and propidium iodide uptake (FL-2) in the brain cells of H. fossilis control, Low dose(LD) 64 μg/l and high dose(HD) 160 μg/l for 30 to 60 days exposed groups to 4-NP. The numbers represent the percentage (%) of cells. The cells from the control H. fossilis were mostly negative for both annexin V binding and uptake of propodium iodide (PI). In contrast, the cells from nonylphenol (NP) treated groups exhibited strong positive staining for annexin V or both annexin V and PI in dose and time-dependent manner, B and C are graphical representations of apoptosis and necrosis percentage of flow cytometry dot plots. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups (n = 15, P < 0.05).

Table 6.

F values of two ANOVA test of the effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis.

	F-value duration	F-value dose	F-value of interaction of dose and duration
Necrosis	19.09	12.64	10.73
F-critical	4.747225	3.885294	3.65487
Apoptosis	34.23	40.16	12.99
F-critical	4.59988	3.78654	3.89543

Effect of 4-NP on intracellular ROS in the brain of H. fossilis

Results depicted that 4-NP exposure to male catfish of low dose 64 µg/L and high dose160µg/L for 30 and 60 days during pre-spawning to spawning period caused an increased level of intracellular generation of Total ROS (reactive oxygen species) in dose-dependent manner in brain cells of H. fossilis (Fig. 9).Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of Total ROS percentage in brain cells (Table 7).

Fig. 9.

(A) Cytofluorometric (ROS-FACS) analysis of the frequency histograms for total ROS (reactive oxygen species) generation percentage by flow cytometer and (B) Showing graphical representation of Total ROS generation intensity in brain cells showing the effect of different concentrations of 4-NP doses low dose (LD) 64 µg and high dose(HD) of 160 µg on testicular cells of H. fossilis duration of 30 to 60 days pre-spawning to spawning period. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups. (n = 15, P < 0.05).

Table 7.

F values of two ANOVA test of Effect of 4-NP on intracellular ROS in the brain of H. fossilis.

	F-value duration	F-value dose	F-value of interaction of dose and duration
ROS	12.5	25.99	4.867
F-critical	4.87643	3.856743	3.67544

Effects of 4-nonylphenol on DNA fragmentation in brain tissue of H.fossilis

Our results depicted that 4-NP exposure to male catfish of low dose 64 µg/L and high dose 160 µg/L for 30 and 60 days during the pre-spawning to spawning period causes increased DNA fragmentation means it makes DNA migrate from comet causing tail movement. The increase in DNA fragmentation(tail length), tail moment and olive tail moment was dose and duration-dependent manner in brain tissues (Figs. 10 and 11i, ii, iii). Statistical assessment shows significant difference in dose, duration groups and in interaction between dose and duration groups of DNA migration in brain cells where F-value is greater than F-critical value in brain tissue (Table 8).

Fig. 10.

Effect of 4-NP on DNA migration in brain at low dose (64 μg/L) and high dose (160 μg/L) for 30 and 60 days of treatment. Measuring DNA damage in cells using CASP lab software showing different degrees of DNA migration indicated by comet parameters as comet head and tail. (a) Control: No DNA migration in undamaged cell; (b) Treated: Mild increase in DNA migration or tail, (c) Treated: Moderate increase in DNA migration; (d) Treated: Severe DNA damage with increased DNA migration or tail length.

Fig. 11.

(i) DNA migration (tail length, μm) (ii) tail moment (TM) and (iii) Olive tail moment (OTM) in control, low dose (LD) 64 μg/l, and high dose (HD) 160 μg/l for 30 to 60 days exposed groups to 4-NP in the brain of H. fossilis Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups. (n = 15, P < 0.05).

Table 8.

F values of two ANOVA test of Effects of 4-Nonylphenol on DNA fragmentation in brain tissue of H.fossilis.

	F-value duration	F-value dose	F-value of interaction of dose and duration
DNA migration	135.02	170.57	112.94
F-critical	4.55632	3.48324	3.5

Effects of 4-nonylphenol on gene expression of GnRh and CYP19a1b in brain of H.fossilis

Gene expression of gonadotropin-releasing hormone (GnRh), brain aromatase (Cyp19 a1b) downregulates in dose-dependent manner in brain tissues of H.fossilis (Fig. 12). In brain there was significant difference in dose and duration groups and in interaction between dose and duration groups of gene expression of brain aromatase and GnRh where F-value is greator than F-critical value (Table 9). (Fig. 12 Supplementary data S3-Melting curve of GnRh, Fig. 12 Supplementary data S4-Melting curve of Cyp19a1b).

Fig. 12.

Effects of 4-NP on gene expression of Gonadotropin-releasing hormone and brain aromatase in the brain of catfish H. fossilis of 30 to 60 days treatment of low dose (LD)(64 µg/L) and high dose (HD)(160 µg/L) during pre-spawning and spawning phase of the reproductive cycle. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way ANOVA followed by post hoc test Bonferroni test (P < 0.05). Different alphabets denote significant changes from the control.

Table 9.

F values of two ANOVA test of Effects of 4-Nonylphenol on gene expression of GnRH and CYP19A1B in brain of H.fossilis.

	F-value duration	F-value dose	F-value of interaction of dose and duration
GnRH	15.11838	856.9661	26.50224
F-critical value	4.747225	3.885294	3.885294
Brain aromatase	512.388	58,275.32	3397.676
F-critical value	5.43876	4.36785	3.98769

Physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

In silico study screening of pharmacokinetics properties of 4-Nonylphenol was done through Swiss ADME bioinformatics tools shows that 4-NP crosses the blood–brain barrier and has the highest organism’s intestinal absorption and drug-likeness properties. Metabolism prediction by Swiss ADME is that 4-NP inhibits CYP1A2, CYP2C19, and CYP2D6, these are cytochrome P₄₅₀ enzymes. 4-NP blocks the function of CYP1A2, which are involved in various processes, including drug metabolism and lipid production—such as cholesterol and steroids—the CYP2C19 gene encodes an enzyme primarily located in the endoplasmic reticulum of liver cells, where it plays a key role in protein processing and transport. The human CYP2D6 gene encodes the enzyme cytochrome P₄₅₀ 2D6 (CYP2D6). It is mainly expressed in the liver and is also highly present in certain regions of the central nervous system, such as the substantia nigra. Physicochemical properties of small molecules, such as molecular weight (MW) less than 500, lipophilicity (cLogP) less than 5, and a maximum of 10 hydrogen bond acceptors (HBA) and 5 hydrogen bond donors (HBD), are evaluated by the Lipinski filter. So, according to Lipinski’s rule, 4-NP does not violate the rule of five (Table 10).

Table 10.

Lipinski’s molecular descriptors for 4-Nonylphenol from SwissADME.

Compound name	4-Nonylphenol
Canonical SMILES	CCCCCCCCCc1ccc(cc1)O
MW(g/mol) molecular weight (≤ 500)	220.35 g/mol
HBA = Hydrogen bond acceptor (≤ _10)	1
HBD Hydrogen bond donor (≤ 5)	1
cLogP lipophilicity (< 5)	3.7
MR molar refractivity (40–130)	71.89
n-ROTB number of rotatable bonds	8
TPSA (Å2) Topological polar surface area	20.23 Å2
Parameters	Compound 4-Nonylphenol
GI absorption	High,90.88%
BBB permeability	Yes
P-glycoprotein substrate	No
CYP1A2 inhibitor	Yes
CYP2C19 inhibitor	Yes
CYP2D6 inhibitor	Yes
Druglikeness according to Lipinski’s rule	Yes
Total clearance	1.422 log ml/min/kg
Renal OCT2 substrate	No

Assessment of binding affinity of protein acetylcholine esterase biomarker with 4-NP by molecular docking and molecular dynamic simulation

Molecular docking of 4-NP with AChE

We found that 4-NP exhibits potential binding with AChE with a binding score of -7.0 kcal/mol. Molecular docking study revealed that 4-NP was stabilized in the pocket of AChE mainly via interactions with hydrophobic residues i.e., Trp108, Tyr146, Leu152, Tyr155, ALa226, Phe315, Tyr355, Phe356, and Ile499. Other interactions stabilizing the 4-NP include negatively charged Glu224, and several polar and glycine residues as shown in Fig. 13.

Fig. 13.

Binding Interactions of 4-NP with Acetylcholine esterase (AChE), 2D interaction shows the 5 Ǻ interacting residues of 4-NP in the pocket of AChE.

MD simulation and MMGBSA analysis of Fortunellin–Papain-like protease complex

MD trajectory investigation demonstrated that the AChE-4-NP complex remained stable throughout the 200 ns MD simulations in both runs. A stable backbone conformation was observed, with average RMSD values of 0.349 nm and 0.426 nm in runs 1 and 2, respectively (Fig. 14A), indicating interaction stability. The ligand’s RMSD suggested two conformational adjustments to stabilize within the AChE protein pocket, with a value of 0.8 nm in both simulations (Fig. 14 B). The system sustained an average Rg value of 2.35 ± 0.02 nm in run 1 and 2.38 ± 0.02 nm in run 2, signifying a compact and stable structure (Fig. 14 B). Additionally, a minimum distance of 0.2 ± 0.05 nm between 4-NP and the AChE protein in both simulations indicated a stable interaction (Fig. 14 C). This proximity ensured that the ligand remained within the target site (Fig. 14 D). Furthermore, RMSF analysis revealed that residues within a 5 Å region of the ligand were consistently shielded by 4-NP (Fig. 14 E).

Fig. 14.

MD analysis of AChE-4-NP complex reveals the stability of the ligand in the active pocket of the protein. The figure depicts (A) Root mean square deviation (RMSD) for the backbone, (B) RMSD for the ligand binding, (C) Radius of gyration, (D) Minimum distance between AChE and 4-NP throughout the 200 ns trajectory, (E) Root Mean Square Fluctuations (RMSF) analysis (the critical residues within the active site of the protein are marked with red arrows) of the complex.

AChE-4-NP interaction analysis

The gmx cluster was used to identify the most populated cluster of the AChE-4-NP complex throughout the simulation time. The average snapshot of the most populated cluster in both simulations was generated as shown in Fig. 15. The 2D interaction analysis of this snapshot showed that NP interacts ‘with the active site’residues of AChE, primarily stabilized by hydrophobic interactions. The interactions with Phe94, Gly104, Ile105, Trp108, Tyr146, Ser147 Tyr355, Phe356, Tyr359, and His 495 residues were found to be common in both the simulations (Fig. 15).

Fig. 15.

Most populated structure identification throughout the 200 ns trajectory. The figure depicts (A) 4-NP (shown with stick model in red color) occupying the active site of the AChE protein, (B) The binding conformation, and 2D view of the interacting residues. The color of the residues is same as shown in Fig. 13.

MMGBSA and residue decomposition analysis

Furthermore, MMGBSA analysis revealed that the AChE-4-NP complex was greatly stabilized by the van der Waals forces and exhibits a reliable binding free energy of − 25.0959 ± 2.2791 kcal/mol and − 20.0871 ± 2.8735 kcal/mol in run 1 and run 2 respectively (Table 11 and Fig. 16). Further, the residue decomposition analysis revealed that the residue Trp108 exhibits the highest energy contribution in 4-NP binding followed by other crucial residues i.e., Phe95, Val95, Ile105, Tyr55 Phe356, Tyr359, and others as shown in Fig. 15, stabilizing the AChE-NP complex (Fig. 16).

Table 11.

Free energy calculations of AChE-4-NP complex using MM-GBSA technique.

Energy components	Run 1	Run 2
∆EVDW	− 34.2728 ± 1.9742	− 28.7923 ± 2.7464
∆EEEL	− 6.6963 ± 2.6888	− 4.8146 ± 5.8628
∆EGB	20.9755 ± 1.5211	18.0681 ± 3.2582
∆ESURF	− 5.1024 ± 0.2089	− 4.5483 ± 0.3212
∆Ggas	− 40.9690 ± 2.8178	− 33.6069 ± 5.1728
∆Gsolv	15.8731 ± 1.4701	13.5198 ± 3.2032
∆Gtotal	− 25.0959 ± 2.2791	− 20.0871 ± 2.8735

All energies are in kcal/mol along with their standard deviation in parenthesis. ∆E_VDW: van der Waals contribution from MM; ∆E_EEL: electrostatic energy as calculated by the MM force field; ∆E_GB: the electrostatic contribution to the solvation free energy calculated by GB; ∆E_SURF: solvent-accessible surface area; ∆G_gas: gas-phase interaction energy; ∆G_solv: solvation free energy; ∆G_total: total binding free energy.

Fig. 16.

Energy contribution in AChE-4-NP complex stability by interacting residues calculated using the MMGBSA technique.

Discussion

Effect of 4-NP on protein content in brain tissue of male H.fossilis

Experimental evidence shows that fish exposed to 4-NP exhibit a significant reduction in brain protein levels compared to control groups. This reduction is likely associated with enhanced proteolytic activity or impaired protein synthesis mechanisms resulting from endocrine disruption or oxidative damage^44,45. Decreased brain protein levels could impair cognitive function, sensory processing, and overall behavioral responses in Heteropneustes fossilis, impacting survival and ecological fitness.

Histopathological assessment of the brain of H. fossilis due to the effect of 4-NP

The complex structure of the brain can make pathological examination of the nervous system challenging in neurotoxicology,⁴⁶ especially given the limited literature on fish brain histopathology. In laboratory research, histopathological assessments are essential for identifying the direct effects of contaminants on fish target organs^47,48. Numerous effects and changes in brain tissue in this study were in line with earlier findings that showed neurological deterioration and destruction⁴⁹. For example, high levels of lead exposure have been linked to encephalopathy and brain tissue degeneration^50,51. Findings have been reported in goldfish (Carassius auratus)⁵² and spotted murrel (Channa punctatus) after exposure to heavy metals and endosulfan,⁵³ respectively. The brains of post-juvenile African catfish (C. gariepinus) treated with glyphosate herbicide⁵⁴ and toads (Buffo regularis) exposed to endosulfan and diazinon have also been shown to have minor necrosis and vacuolar formation⁵⁵.

Metals such as aluminum (Al (III)), copper, ferrous sulfate,⁴⁷, AlCl₃,⁵⁶ and methylmercury (MeHg)³³ have been implicated in neuronal cell degeneration, leading to neurodegenerative disorders like Parkinson’s dementia (PD) and Alzheimer’s disease (AD)⁵⁷. Vacuolization in Purkinje cells, neuropil loss, and necrotic neuron were seen in the cerebellum and telencephalon region of the brain of striped bass (Morone saxatilis) due to effect of domoic acid was reported⁵⁸. The severity of histopathological changes varies based on the dose and duration of exposure. Present study depicts the neurotoxic effect of the 4-Nonylphenol exposure dose of low and high doses for 30 days to 60 days prespawning to spawning and shows dose and duration-dependent toxicity in brain tissue. It affects the telencephalon and cerebellum region of the brain of catfish which hampers olfaction, reproduction, locomotion, and spatial cognition^59,600.4-Nonylphenol rapidly crosses the blood–brain barrier and builds up in various brain regions at varying concentrations¹, and in silico studies through Swiss ADME have also predicted and supported the aforesaid statement. This accumulation can have mild to severe effects on non-neuronal and neuronal cells depending upon exposure time and concentration.

Effect of 4-NP on acetylcholine esterase activity (AChE) in the brain of H. fossilis

AChE is comprehensively recognized as a biomarker for assessing the neurotoxic effects of contaminants in aquatic organisms⁶¹. Impediment of AChE activity leads to acetylcholine cumulation, as observed in the present investigation. Our investigation elucidated that Acetylcholinesterase (AChE) activity was markedly inhibited in the brain tissues. According to our research, the fish brain’s sensory and motor regions experienced a disruption in neuronal connection following exposure for 30 to 60 days, resulting in a significant decrease in AChE activity. The fish exhibited altered and uncoordinated movements as a result of the disturbance brought on by 4-NP exposure. This brain area called the cerebellum is responsible for performing many motor actions poor AChE activity is positively correlated with poor locomotory/swimming performance. Acetylcholine (ACh) accumulates up in synapses as a result of decreased AChE activity, which impairs behavior, eating, and swimming. Lower AChE expression may be associated with AChE inhibition which could lead to neurotoxic modifications in the nervous system.

Evaluation of antioxidant parameters (SOD, CAT, GPx, and TAS) and LPO, TOS in testes and brain tissue of H. fossilis due to exposure of 4-NP

Oxidative stress results from an imbalance between reactive oxygen species (ROS) and reactive nitrogen species (RNS) at the cellular and tissue levels and the body’s ability to counteract these with its antioxidant systems, including antioxidant enzymes. The brain contains a high concentration of polyunsaturated fatty acids, making it particularly susceptible to lipid peroxidation, and polyunsaturated fatty acids (PUFAs). Lipid peroxidation in the brain can be investigated by measuring MDA levels, a key marker of lipid peroxidation and oxidative stress. SOD, GSH, and CAT serve as the primary defense mechanisms against free radicals responsible for oxidative stress. As such, they are important markers for determining how harmful the environment is to different aquatic species^62,63. Antioxidant enzyme activities of aquatic animals are affected by 4-nonylphenol (4-NP) exposure. SOD detoxified superoxide into hydrogen peroxide, which is subsequently converted by catalase into water and oxygen⁶⁴ and⁶⁵. Over time, SOD activity may decline and larger concentrations of superoxide anions may result; yet, SOD is still capable of converting these anions, up to a certain concentration, into hydrogen peroxide⁶⁶. Since high hydrogen peroxide concentrations can quickly inactivate CAT, persistent high production of hydrogen peroxide in tissues under oxidative stress can impede CAT activity^67,68. This mechanism affects non-enzymatic thiol antioxidants like GSH, which aid in lowering lipid peroxidation. Under many oxidative stress scenarios, glutathione (GSH) is an essential free radical scavenger⁶⁹. The inactivation of the GSH enzyme is one target mechanism in 4-NP-induced neurotoxicity^69,70. Zebrafish embryos exposed to 100 µg/L of 4-NP for 4–168 h post-fertilization (hpf), African catfish subjected to’ 0.1 mg/kg body weight of 4-NP for three weeks, and Bighead carp exposed to 1000 µg/L of bisphenol A for sixty days and the brain of adult zebra fish exposed to heavy metals for twenty-one days have all demonstrated notable decreases in SOD and CAT activity as well as GSH levels⁷¹.

Additionally, exposure to 17-β estradiol dramatically changed SOD and CAT activity in the brains of common carp fish,⁷². Lipid peroxidation (LPO), which is caused by oxidative damage to circulating lipids and phospholipids in cell membranes, yields malondialdehyde (MDA). Amount of MDA demonstrates the degree of oxidative damage brought on by pollutants⁷³. An elevation in MDA levels indicates oxidative stress caused by various substance, including xenobiotics⁷⁴. The results of this investigation into the effects of 4-NP exposure on lipid peroxidation are consistent with those of previous studies^75–78. The findings of this study suggest that increased MDA levels may be due to excessive ROS, leading to cell membrane damage and lipid peroxidation in the brain tissue. The production of reactive species within the brain membrane, due to exposure to various xenobiotics, leads to a dwindled metabolic enzyme activity and an escalation in LPO products⁷⁶. Extended exposure to 4-NP increased superoxide anion levels in the brain, leading to decreased SOD activity in the exposed group⁷⁹. Concentration-dependent decline in superoxide dismutase and catalase activity, along with decreased glutathione levels, in zebrafish exposed to 4-Nonylphenol, which was accompanied by elevated malondialdehyde levels in the brain⁸⁰. The mixture of nano plastic and 4-Nonylphenol induces oxidative stress in the zebrafish brain and impaired neurotransmitters⁸¹. Oxidative stress is indicated by escalation of lipid peroxidation (LPO) and dwindled CAT, SOD and GPX activities.

Effect of 4-NP on cortisol level in brain of H. fossilis

While there are several studies detailing the impact of different stressors on pro-opiomelanocortin (POMC) expression, it is largely unknown the impacts of 4-NP on POMC mRNA expression in fish. The mechanism of cortisol action begins with the hypothalamus releasing the polypeptide corticotropin-releasing hormone into the bloodstream. The anterior pituitary gland then secretes adrenocorticotrophic hormone (ACTH) in response to stimulation by CRH. The adrenal cortex’s melanocortin 2 receptor (MC2-R) is activated by ACTH, which then causes the interrenal region to produce and release cortisol and other glucocorticoids (GCs)^82,83. The hypothalamic–pituitary–adrenal (HPA) axis is made up of this intricate neuroendocrine system. The only form of cortisol that is physiologically active is in its unbound form, which is detected in plasma and is removed either by tissue absorption or by molecular breakdown that releases cortisone⁸⁴. Depending on the type of stressor (acute or chronic), clearance rates can vary⁸⁵ with cortisol levels returning to baseline at different times post-stress. Considering the hydrophobic and highly lipophilic nature of cortisol molecules, tissue uptake most likely happens by passive diffusion. To modify gene expression in tissues, cortisol binds to mineralocorticoid and glucocorticoid receptors⁸⁶ and additional non-genomic processes that might not be entirely dependent on certain cortisol receptors⁸⁷. Cortisol molecules are broken down or rendered inactive after binding and the metabolites that result like through urine and feces, primarily via the liver-bile-feces system, release cortisone into the environment. Furthermore, unbound cortisol may diffuse through the gills and enter the surrounding water⁸⁸.

Cortisol is thought to play a neuromodulatory role in controlling the primary neuronal populations of the diencephalon and caudal telencephalon/anterior preoptic region, which are involved in gonadotropin secretion and regulation³⁵ as well as spawning behavior⁸⁹.

Fish exposed to the highest dose of 4-NP showed elevated cortisol levels and reduced total antioxidant capacity (TAC). This suggests that following 4-NP exposure, the plasma antioxidant system responds to the heightened production of reactive oxygen species (ROS). As a result, TAC may be a useful marker for determining how pollution affects animals in the ecosystem⁹⁰. Increased cortisol levels can cause a decrease in TAC. This can be because different cortisol pathways activate sequentially, or because ROS directly affect cortisol metabolism⁹¹. Proposed a link between plasma cortisol levels and HSP70 expression in stressed goldfish⁹². They have shown that elevated cortisol levels stimulate HSP₇₀ mRNA in the brain but not in the hepatopancreas.

Similarly, after 4-NP treatment, elevated HSP70 mRNA levels were seen in Gobius niger^93,94 and after juvenile S. solea were exposed to contaminated sediments⁹⁵. Remarkably, it was shown that a single dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) raised the mRNA levels of POMC and the aryl hydrocarbon receptor (AhR), which in turn caused higher cortisol levels⁹⁶.

Effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis

In brain cell necrosis percentage was greater than the apoptosis percentage in 30 days of treatment of 4-NP but when chronic exposure of 60 days, the apoptosis percentage increased showing 4-NP induction towards the programmed cell death.

ROS have the capability to start a chain of events that harm cellular constituents and ultimately result in cell death^44,97. Alteration in antioxidant parameters and increased levels of ROS induces apoptosis cell death and eventually causes cell death of the tissues. Though more investigation is required to validate this,^7,98 suggest that there are several potential pathways underlying the harmful consequences of 4-NP exposure. DNA damage is the reason for the apoptotic effects on brain cells and erythrocytes. This study discovered a direct correlation between neuronal apoptosis and 4-NP residues in the brain.4-NP was able to cross the blood-brain barrier (BBB), which is a dynamic and selective barrier⁹⁹. In addition to maintaining brain homeostasis, the BBB guards against harmful chemicals¹⁰⁰. Apoptosis is a generalized mechanism of neuronal cell death under pathogenic conditions¹⁰¹. Notably, 4-NP inhibits the expression of glutathione peroxidase and disrupts the cell’s protective mechanisms¹⁰², despite the tight junctions in endothelial cells that protect the brain¹⁰³.

Effect of 4-NP on intracellular ROS in the brain of H. fossilis

Oxidative stress-induced cellular activation typically results from ROS-mediated oxidation of DNA¹⁰⁴, polyunsaturated fatty acids in lipids¹⁰⁵, and amino acids in proteins¹⁰⁶. Beyond these direct oxidation effects, cellular oxidative responses also occur. According to recent studies, 4-NP can cause the production of ROS in yeast, bacterial and cultured vertebrate cells at doses ranging from 50 to 200 μM.^107–110. Findings indicate that 4-NP within this concentration range can cause both estrogenic effects and ROS production. Although these 4-NP levels are higher than those typically found in the environment, significant quantities of 4-NP have been detected in certain sewage sources and various aquatic plants and animals¹¹¹.

Effect of 4-NP on the DNA fragmentation exposure to brain of H. fossilis

4-Nonylphenol also acts as a toxicant, it induces genotoxicity, and cytotoxicity causes DNA damage or DNA fragmentation. Our investigation shows that DNA fragmentation by COMET assay means tail DNA movement increases with a dose-dependent manner in the brain tissue of catfish H. fossilis when they are exposed to 4-NP doses. Reactive species such as free radicals are continuously generated in vivo, with DNA being the most significant target of oxidative stress. Oxidative DNA damage serves as a predictive biomarker for monitoring the risk of developing various diseases. In the comet assay, the percentage of tail DNA is used to evaluate DNA damage. This is a highly important and sensitive parameter that has been extensively utilized in various studies^112,121. The excessive production of ROS can damage lipids, proteins, and DNA.

Impact of 4-NP on gene expression in the brain of H. fossilis

Our study depicts the profound effect of 4-Nonylphenol on gene expression of CYP19a1b, GnRH in the brain of H. fossilis. GnRH, CYP19a1b decrease in a dose-dependent manner due to endocrine disrupting and xenoestrogenic effect of 4-NP exposure of 64 µg/L as a low dose and 160 µg/L as a high dose given for the period of 30 days and 60 days of exposure. A similar study shows the altered brain aromatase activities in male Fathead minnows (Pimephales promelas) following estrogenic treatments were given¹¹³. Additionally, it was reported that reduced brain aromatase levels in wild perch populations from a Swedish lake contaminated by waste dump leachate¹¹⁴.

Fish from polluted settings may exhibit behavioral changes and negative effects on the hypothalamic-pituitary-gonad axis due to disruption of brain aromatase activity, this may also influence crucial brain development in sex-changing animals [136]. Because aromatase activity in seasonal spawners varies with seasonal variations, this disruption may also have a deleterious impact on them^115–117. Different steroid treatments have been shown to both stimulate and inhibit brain aromatase, with the effects varying according to age, gender, species, dose concentration, and length of exposure^42,77,83,113. Fish gonadal functions, gametogenesis, and steroidogenesis are all governed by the kisspeptin-gonadotropin-releasing hormone (GnRH)-gonadotropins (follicle-stimulating hormone (FSH) and luteinizing hormone LH) axis, just like in other vertebrates. Furthermore, sex steroids regulate the synthesis of kisspeptin, gonadotropins, and GnRH through both positive and negative feedback mechanisms¹¹⁸. GnRH expression was significantly reduced in juvenile rainbow trout exposed to 4-NP (0.1–10 μM) and female goldfish (Carassius auratus) exposed to BPA (1–500 μg/L)^68,105.

In silico assessment of physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

To increase the toxicological dataset available for evaluating 4-NP toxicity, the current study sought to estimate comprehensive ADME features for 4-Nonylphenol utilizing an in silico methodology that integrates SwissADME, pkCMS, and PASS online tools for computational toxicology. For the first time, our work offers predictions for 4-Nonylphenol’s physicochemical characteristics, pharmacokinetics, drug similarity, and toxicological consequences.

Our study presents, for the first time, predictions of physicochemical properties, pharmacokinetics, drug-likeness, and toxicological effects associated with 4-Nonylphenol.4-NP shows a high probability of being absorbed in gastrointestinal about 90.88% according to SwissADME and pkCSM. From Swiss ADME, pkCMS prediction 4-NP has druglikeness properties, it can cross the blood–brain barrier, and follows all rule of Lipinski. Enzymes known as cytochrome P₄₅₀ (CYP₄₅₀) are essential for the metabolism of both drugs and other xenobiotics. These enzymes can either detoxify drugs/xenobiotics by converting them into less harmful compounds 0.4-NP is a potent inhibitor to these cytochrome P₄₅₀ enzymes CYP1A2, CYP2C19, and CYP2D6 causing toxicity in the body of any organism which is exposed to any kind of xenobiotics or pollutants. By PASS prediction 4-NP shows hematotoxicity¹² in vivo studies, other toxicity such as nephrotoxicity, and acetylcholine inhibitor.

Assessment of binding affinity of protein acetylcholine esterase biomarker with 4-NP by molecular docking and MD simulation

AChE is a key biomarker commonly used to investigate the neurotoxic effects of pollutants on aquatic organisms¹¹. Molecular docking studies provided additional confirmation that 4-NP exposure inhibited the activity of the AChE enzyme. This is the first time that 4-NP has been shown to interact with the male H.fossilis enzyme AChE. AChE activity inhibition has been studied in various species, including Drosophila melanogaster exposed to dispersed blue-124 and black-9 textile dyes⁵⁷, Electrophorus electricus subjected to bisphenol derivatives⁵²,and Periplaneta americana treated with 3-dimethylmaleic anhydride¹⁶.The binding energy (-7.0 kcal/mol), shows efficient binding of 4-NP with protein AChE, molecular docking study revealed that 4-NP was stabilized in the pocket of AChE mainly via interactions with hydrophobic residues i.e., Trp108, Tyr146, Leu152, Tyr155, ALa226, Phe315, Tyr355, Phe356, and Ile499.MD trajectory analysis showed that the AChE-4-NP complex remained stable throughout the 200 ns MD simulations in both runs. The backbone conformation exhibited stability, with an average RMSD of 0.349 nm in run 1 and 0.426 nm in run 2 (Fig. 13A), indicating sustained interaction stability.

Conclusion

4-Nonylphenol, acute and chronic, sub-lethal dose exposure causes neurotoxicity in the brain of male H. fossilis, which hampers the reproductive function by downregulation of gonadotropin-releasing hormone. It affects the population of catfish and aquaculture. Our study depicts that 4-NP crosses the blood–brain barrier causes oxidative stress, cell death, altered antioxidant defense mechanism, and histopathological alteration in brain tissue. Further molecular docking and MD simulation study analysis depicts the efficient binding affinity of 4-NP with acetylcholine esterase enzyme (AChE) showing its neurotoxic effects. Indirectly via biomagnification, it can affect the human population, so there is a need for concern about the health of the aquatic ecosystem and these parameters can be applied to aquatic ecosystems to determine risk.

Supplementary Information

Below is the link to the electronic supplementary material.

Author contributions

Suman, GGJ, were involved in the conception, design, and execution of the experiments. *In silico* analysis part was done by SA and RM. All experimental data was analyzed by Suman, GGJ, contributed to the article’s drafting. Suman assisted with reagent preparation and experimentation. It was critically revised for significant knowledgeable content by Suman and GGJ. The final version to be published was approved by all of the authors.

Funding

The authors received no financial support for the research, and publication of this article.

Data availability

All data supporting the findings of this study will be available upon request and the datasets generated and/or analysed during the current study are available in the name i.e.,AChE of *Danio rerio* and its UniProt id [**Q9DDE3**](https:/www.uniprot.org/uniprotkb/Q9DDE3/entry).

Declarations

Competing interests

The authors declare no competing interests.