Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2026 Jan 22;16:5974. doi: 10.1038/s41598-026-36820-8

Neurotoxicogenomic impact of 4-nonylphenol on Heteropneustes fossilis via molecular, histopathological and bioinformatic analysis

Suman 1, Shivangi Agrawal 2, Rajeev Mishra 2, Gautam Geeta Jiwatram 1,
PMCID: PMC12901239  PMID: 41571910

Abstract

Exposure to 4-Nonylphenol at concentrations of 64 µg/L (low) and 160 µg/L (high) for 30 to 60 days, spanning the pre-spawning to spawning phases in H. fossilis, induces significant adverse effects in the brain, particularly within the telencephalon and cerebellum regions. Additionally, protein content in brain decreases in treated group of 4-Nonylphenol (4-NP), brain acetylcholinesterase (AChE) activity decreases in a manner contingent upon the amount of dose and exposure period. In the brain tissue of H. fossilis, exposure to 4-Nonylphenol (4-NP) results in a dose-dependent decrement of antioxidant enzymes including Superoxide dismutase(SOD), Catalase, and Glutathione peroxidase(GPx), alongside a dose and duration-dependent increase in Lipid peroxidation (LPO) levels. Cortisol level in the brain increases with higher doses of 4-NP. The exposure to 4-NP induces a dose-dependent increase in cell death after both 30 and 60 days, with a marked increase in necrosis after 30 days. However, at 60 days, apoptosis becomes more prominent, suggesting a shift toward programmed cell death due to prolonged exposure. In the brain cells of H. fossilis, exposure to 4-Nonylphenol (4-NP) over 30 to 60 days caused an escalation in reactive oxygen species (ROS) and DNA fragmentation. Gene expression of brain aromatase (Cyp19a1b) and Gonadotropin-releasing hormone (GnRH) is downregulated in a dose-dependent manner. These findings indicate that both acute and chronic exposure to 4-NP induces neurotoxicity in male H. fossilis by crossing the blood–brain barrier. This was further validated through an in silico analysis using SwissADME, which predicted high intestinal absorption of 4-NP and its potential to cross the blood–brain barrier. Additionally, molecular docking and Molecular Dynamics (MD) simulations substantiated a strong binding affinity of 4-NP to acetylcholinesterase in the brain. Overall, this investigation demonstrates that 4-NP disrupts brain tissue, impairs antioxidant defenses, promotes ROS production, and impacts gene expression and brain enzyme activity.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-026-36820-8.

Keywords: Acetylcholine esterase, MD simulation, Blood–brain barrier, 4-NP, GPx, SOD

Subject terms: Neuroscience, Zoology

Introduction

Due to anthropogenic activity such as industrialization, domestication, and agricultural practices, eventually disposing of their sewage wastewater in aquatic bodies causes our natural aquatic ecosystem to be full of toxicants. These toxicants cause alterations in homeostasis in the body of an aquatic organism and hamper the different physiological processes, including development, metabolism, and growth. 4-Nonylphenol (4-NP) is one of the potent micropollutants which are pervasive, due to its high bioconcentration factor, lipophilicity (octanol–water partition coefficient log Kow of 4-Nonylphenol is 4.48)1, nondegradable causes prolonged existence in the environment and via biomagnification, it reaches to the human population.4-NP has been reported as a potent endocrine-disrupting chemical, xenoestrogenic, and neurotoxicity. The global threat posed by 4-NP requires significant attention, as its health impacts extend beyond aquatic creatures to humans by accumulating in lipids of living beings along food consumption2. Even though the Environmental Protection Agency (EPA) declare that susceptibility to Nonylphenol at levels up to 28 ppm at one time every three years does not affect freshwater existence3, the European Union has imposed curltainment on the use of NPs due to their endocrine-disrupting effects and widespread presence in industry and households4. It was reported1 that the brain exhibited the elevated accumulation of 4-NP, while the muscle had the little assimilation in catfish Heteropneustes fossilis. Because of high polyunsaturated fatty acid concentration, brain tissue is especially vulnerable to free radical damage, making strict homeostasis maintenance required5. The brain and neurotransmitters roles in reducing the harmful effect of 4-NP in fish are not well understood. According to research survey6 acetylcholinesterase (AChE) is essential for the release of neurotransmitters, the modulation of neuronal electrical pursuit, and synaptic plasticity in the central nervous system (CNS). The catfish H. fossilis serves as a toxicological model, with numerous studies investigating the toxicity of 4-NP in different species7. The spinal cord and brain play crucial roles in fish physiology and their rigorous maintenance of homeostasis, neuronal tissue is frequently investigated in fish toxicity research7. According to some research, brain biomarkers might be helpful in tracking pollution levels and offering early alerts when pollutants are being exposed8. As aforementioned biomarkers, neuronal cell death in a variety of clinical diseases, especially chronic degenerative brain illnesses, is frequently attributed to apoptosis9. Cell morphological abnormalities, such as alterations in cell shape, nuclear anomalies, and DNA damage, are linked to apoptosis1012. Throughout the process of oxidative phosphorylation that takes place in the mitochondrial respiratory chain, complexes I and III generate reactive oxygen species (ROS), chemically not stable molecules derived from oxygen. Physiological and pathological processes can cause ROS levels to increase, which can increase oxidative stress in cells. The effect of reactive oxygen species (ROS) generated from the metabolism of various xenobiotics can be mitigated by innate defense mechanisms, including specific antioxidant enzymes that help neutralize free radicals8.

4-NP induces oxidative stress by altering the level of antioxidant enzymes in the body of organisms which causes the generation of total ROS. Nevertheless, research explicitly investigating the impact of 4-NP neurotoxicity on fish brain tissue is not well understood. In silico molecular docking is a novel probing search procedure that simulates the 3D structure of a ligand and receptor binding domains13. Understanding the relationship of 4-NP binding with hormones can help explain the concentration–response and time response of xenoestrogens. However, there is limited research on the harmful impact of 4-NP on aquatic organisms using in silico methods. Additionally, earlier research has mainly examined the generalized toxicity of 4-NP, with little data available on its effects on neural tissue.

Material and methods

Chemicals

4-Nonylphenol (liquid), 99%, a mixture of isomers (CAS: 84852-15-3) was purchased from Acros Organics (Geel, Belgium),Disodium hydrogen phosphate dehydrate a dibasic salt, Sodium dihydrogen phosphate monohydrate, Bovine serum albumin from SRL,Thiobarbituric acid from Otto Chemika-Biochemika Reagent Acetic acid from Fischer Scientific ,Absolute alcohol Analytical Reagent from GBG,Butylated hydroxyl toluene from Molychem, L-methionine, 1% Triton X-100, Hydroxylamine hydrochloride, EDTA, riboflavin, 1% NED, 1% sulphanilamide, and 5% phosphoric acid, Glutaraldehyde TCI, osmium tetraoxide (osmic acid)2% w/v, Ottokemi, Copper sulfate SRL, acetone SRL, H2O2, Tris-HCl buffer, sodium azide, TCA, glutathione, DTNB, xylenol orange, NaCl, glycerol, sulphuric acid, o-dianisidine dihydrochloride and ferrous ammonium sulphate, Clark and Lubs solution a p-nitro-N, N-dimethylaniline, sodium hydroxide, potassium ferricyanide, DCFDA all were purchased from SRL,Ammonium chloride, Sodium bicarbonate, ethylene diamine tetra acetic acid, FBS from Hi Media, Potassium Chloride, Sodium Phosphate dibasic, Monopotassium phosphate, all were purchased from SRL, Annexin V binding buffer, Annexin V FITC antibody and Propidium iodide ELABSCIENCE APOPTOSIS KIT, cDNA synthesis kit (verso, Thermofisher, USA) cat.no. AB1453A, SYBR-Green qPCR thermo Fischer. Dimethylsulfoxide (DMSO)—Qualigens (CPW59), Disodium EDTA—HiMedia, Ethidium Bromide—Sigma, Sodium Hydroxide (NaOH)—BDH-Merck, Triton X-100-SRL.Phosphate Buffered Saline (PBS) (Ca++, Mg++free) – HiMedia.

Animal collection and acclimation

Sexually mature male catfish (H. fossilis, body weight 40–50 gm; length 15–35 cm), fish were purchased during the preparation phase (March–April; 11.5L: 12.5D, 22 ± 2 °C;), sourced from a nearby fish market in Varanasi, Uttar Pradesh.pH-7.5 and hardness of water was 130 mg/L. A 20-L flow-through aquarium was used to keep the fish, and 0.1% KMNO4 was used to disinfect them. To recover from the stressful conditions brought on by transit, they were housed for a week in a laboratory setting with normal temperature and photoperiod. They were fed boiled egg albumin ad libitum for the duration of the trial and during the acclimatization period.

All protocols in this study were approved by the Committee on the Animal Ethics of Banaras Hindu University, Varanasi institutional or licensing committee and the license number is as follows: B.H.U./IAEC/2019–2020/004 dated 03/03/2020. All methods and procedures were carried out in accordance with ARRIVE guidelines 2.0 for experimentation in animals as well as the rules and regulations of the Animal Ethics Committee of Banaras Hindu University, Varanasi. No extra animal discomfort was caused for sample collection for the purpose of this study. Intensive care was given to prevent cruelty of any kind. All experiments were performed in accordance with relevant guidelines and regulations.

Exposure to 4-NP

A total number of 90 male catfish (30–40 g, length 15 ± 3.5 cm) were sourced from the local fish market to investigate the impact of 4-Nonylphenol on male H. fossilis during the pre-spawning phase (March–April, 11.5L: 12.5D, 22 ± 2 °C). Nonylphenol was dissolved in ethanol (10.7 μl of 4-NP was dissolved in 1 ml of ethanol (99.9%) and then diluted with triple distilled water upto 10 ml to obtain a stock solution 1 μg µL−1. These concentrations were determined by the lethal concentration. dosage (LC50) value1 and these concentrations are in range between environmental dose i.e.,75.2–179.6 µg/L14. Fish that had been acclimatized from the preliminary phase were kept in three separate 10-L tanks. Control, low dose (64 μg. L−1′1/25th of LC50) and high dose (160 μg L−1 1/10th of LC50) were represented by groups 1, 2, and 3 and 15 fishes in each group respectively. Semi-static conditions (renewable of doses were done after 12 h in regular intervals) were maintained for 30 days to 60 days of treatment1.

Dissection

Fish were weighed when the experiment was completed, cold anesthesia15 was given, and sacrificed by decapitation16. The brain removed of the catfish H. fossilis, were fixed in Neutral buffer formalin (NBF) for 24 h, and they were kept in 70% alcohol for histopathological analysis and brain tissues were for biochemical and molecular analysis.

Histopathological assessment of brain of H. fossilis

After 24 h in 10% neutral buffered formalin (NBF), the telencephalon and cerebellum region of the brain part of catfish were placed in 30% alcohol for two one-hour changes. This was followed by two one-hour changes each in 50%, 70%, 90% and absolute alcohol. The tissues further processing for histology, including routine staining of paraffin Sects. (5 μm), were stained with hematoxylin and eosin (H&E), and photomicrographs were taken using a Olympus Magnus microscope with camera Magcam DC 5(5.1MP,1/2.5″ CMOS SENSOR) Histological features were identified following the H&E staining method.

AChE activity in the brain of H.fossilis

A homogenizer was used to homogenize 10% v/v brain tissues (whole brain) in 0.1 M phosphate buffer (pH 7.4) that contained Triton-X 100. After centrifuging the homogenates for 30 min at 4 °C at 10,000 rpm, the precipitate was disposed of, supernatants served as the source of enzyme for calculating AChE17. A modified18 approach was used to measure AChE activity, 50 µl of 0.5 mM DTNB in 1% sodium citrate, 200 µl of 0.5 M phosphate buffer (KH2PO4/K2HPO4; pH 8.0), 650 µl of H2O, 50 µl of crude extract, and 50 µl of 10 mM Acetylthiocholine iodide made up the 1.0 ml total volume used for the enzymatic reaction. Acetylthiocholine iodide was absent from the control cuvette19. Using a UV1800 spectrophotometer (Molecular Devices, Shimadzu, Tokyo, Japan), variations in absorbance during 5 min at a wavelength of 412 nm were used to measure enzyme activity. To determine protein concentration20 method was used.

Anti-oxidative parameters in the brain of H. fossilis

Brain tissues (whole brain) from each catfish across all groups were meticulously removed, the samples were rinsed in ice-cold physiological saline solution, blotted dry with filter paper, and weighed. A 10% tissue homogenate was then prepared in ice-cold phosphate buffer (0.05 M, pH 7.4) and centrifuged at 10,000 × g for 20 min at 4 °C. The supernatant was collected for the estimation of the protein by Bradford method, superoxide dismutase (SOD),21 protocol, estimation of catalase activity22, glutathione peroxidase (GPx) level23, malondialdehyde (MDA) content24,25. Using a multimode Agilent BioTek Gen5 version 3.12 reader, OD was taken in 96 non-coated ELISA well plates for the aforementioned tests.

Total antioxidant status and total oxidant status in the brain of H. fossilis

The established protocol was used to estimate TAS26

In short, 75 mM KCl and 10 mM lubricant were dissolved to create reagent 1, also known as Clark and Lubs solution (75 mM, pH 1.8). o-dianisidine dihydrochloride, 75 mM reagent-grade hydrochloric acid, and 45 μM Fe(NH4)2(SO4)2·6H2O in 1000 ml of pure water. 7.5 mM hydrogen peroxide was combined with 1000 mL of distilled water to create Reagent 2. 200 μl of reagent 1 and 20 μl of brain homogenate were added to the microtiter plate to create the reaction mixture. After measuring the absorbance at 444 nm, 10 μl of reagent 2 was applied. Three to four minutes after adding reagent two, the final absorbance was measured in a microplate reader (Biotek, USA). Results of each sample were expressed in terms of millimolar Trolox equivalent/L TOS27 was determined in brain homogenate by the standard protocol. In brief, reagent 1 (pH 1.75) of TOS was prepared by adding 150 μM xylenol orange, 140 mM NaCl and 1.35 M glycerol in 25mMsulphuric acid Reagent 2 was prepared by adding 5 mM ferrous ammonium sulphate and 10 mM o-dianisidine dihydrochloride. Reaction was set up in a microtiter plate by adding 225 μl reagent 1 and 35 μl brain homogenate First absorbance was observed at 560 nm and further 11 μl reagent 2 was added and end point absorbance was observed after 3–4 min. The assay has been calibrated with hydrogen peroxide equivalent per litre (μM H2O2 Equiv./L).

Cortisol level in the brain of H. fossilis

Steroid extraction

Using an ultrasonic homogenizer (XL-2000 Microson, Misonix, USA) at 0 °C for 5–10 s, fifteen brains from males in each phase (prespawning and spawning) were thawed and homogenized independently in 4 vol cold PBS (0.02 M, phosphate-buffered saline solution, pH 7.4). Three volumes of diethylether were used to extract the homogenate after it had been centrifuged at 5000 g for 20 min at 4C. After being gathered, combined, evaporated, and dried using nitrogen gas, the ether phase was kept at − 20 °C until for assay.

The cortisol level was measured using the vested protocol28 and finally the absorbance of the solution was checked at 650 nm using UV–Vis Spectrophotometer.

Apoptosis, necrosis, and viable cells assessment in the brain tissue of H.fossilis

Annexin V (AV) and propidium iodide (PI) staining was used to estimate apoptosis and necrosis. Cold FACS buffer was used to wash the dissected brain tissues and minced into 2–4 mm pieces using scissors and scalpel blade,0.25% trypsin was diluted in PBS and incubated the tissue in digestion solution at 28°–30° for 30 min with gentle agitation and filtered it through cell strainer(40 µm) to eliminate clumps and debris, cells were centrifuged at 300–400 × g for 5 min at 4 °C, supernatant were discarded and resuspended the pellet in PBS and again repeated the centrifugation process and finally the cells were resuspended in Annexin V binding buffer, stained with AV-FITC and PI, and incubated in the dark at room temperature for 15 min and then analyzed using a flow cytometer in a BECKMAN COULTER CytoFLEX (Trypan blue was used to assess cell health and > 70% cells were viable suitable for flow cytometry analysis). Gating strategies showed interpretation of the four quadrants i.,e Q1Upper left-necrotic cells, Q2 Upper right-late apoptotic cells, Q3Lower right-Early apoptotic cells, Q4 Lower left-viable cells.

Estimation of total ROS in the brain tissue of H. fossilis by flow cytometer

The DCFH-DA assay is a common method for the estimation of intracellular reactive oxygen species (ROS) levels in cells. Tissue was homogenized in 1 ml of FACS and centrifuged at 1000 RPM for 5 min, followed by removing the supernatant and adding 1 ml of FACS buffer, centrifuged at 1000 RPM for 5 min, repeated it three times. Single cell suspension was made containing 1 X 105 cells in 100 μl of PBS was plated and incubated with 100 μl of 10 μM of DCFDA (2′,7′-dichlorodihydrofluorescein diacetate) at 37 °C for 10 min in the dark. Then, the cells were analyzed using the Beckman Coulter CytoFLEX S flow cytometer, USA29.

DNA fragmentation in the brain tissue of H. fossilis by COMET assay

DNA fragmentation by COMET assay was followed by30 tissue homogenate of the brain of H. fossilis. It was centrifuged at 4000 rpm at 4 °C for 5 min, 50 µl homogenate (supernatant) mixed with 50 µl low melting point agarose 1.5% (quick step),0.8% low melting point agarose was taken and cast on the slide add cover slip and then remove the coverslip after drying the gel (approx.10 min). 100 µl solution (1:1) sample and low-melting-point agarose were cast on slides. Then slides are placed in the lysing buffer in a coupling jar for 30 min and run in an electrophoretic buffer solution in the gel electrophoresis compartment at 25 V for 30 min. Then slides were washed in neutralizing buffer solution 2–3 times. Slides were stained with ethidium bromide stain for 5 min and scored immediately finally observed under the fluorescence microscope. Analysis of DNA damage was done by CapsLab software31.

GnRH and Cyp19a1b gene expression in the brain of H. fossilis

Total RNA was isolated from catfish brain tissue (optic tectum, ventral telencephalon region, hypothalamus and olfactory bulb region) using Trizol reagent and subsequently quantified and purity checked by measuring ultraviolet absorption at 260/280 nm. Complementary DNA (cDNA) was generated from 2 μg of total RNA using a cDNA synthesis kit (Thermofisher, USA). Gene expression analysis was performed via qPCR using the SYBR-Green qPCR Super Mix-UDG kit on a Mastercycler® ep realplex detection system (Agilent, USA). Relative mRNA levels were calculated using the 2 − ΔΔCt method, with β-actin as the internal control. The forward and reverse primer sequences for the target gene were as follows: Table 1

Table 1.

Forward and reverse primer sequences of target genes Gonadotropin releasing hormone (GnRh2), Brain aromatase (CYP19a1b) and β-actin as housekeeping gene.

Primer Forward primer Reverse primer References
GnRh2 GTTCAGCACAGACGAGGCA CTGATGTGTTCCTCCAGGGCA 119
CYP19a1b CAAACTGGTCCCCAGTCGT TGCAGCTTTCCTCAGGACAC 120
β actin TGGCCGTGACCTGACTGAC CCTGCTCAAGTCAAGAGCGAC 120

Physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

The pharmacokinetic server pKCMS and Swiss ADME were used to predict and compute 4-Nonylphenol’s physicochemical characteristics, drug-likeness, and ADME/Tox-related descriptors. On July 1, 2024, the compound’s chemical structures were retrieved in SDF (Structure Data Format) from the PubChem database (http://pubchem.ncbi.nlm.nih.gov/). The Swiss ADME web page was accessed, and files were imported using the external file option. Molecular structures were converted into sketches using ChemAxon’s Marvin JS’ to generate canonical SMILES for each compound, followed by ADME calculations using default parameters. As a result, pharmacokinetic profiles, drug similarity, and physicochemical characteristics were predicted. Swiss ADME was used to evaluate drug-likeness, which shows the probability that a molecule is an orally active drug based on its bioavailability. Swiss ADME filters chemical libraries to exclude incompatible molecules.

Assessment of binding affinity of protein Acetylcholine esterase biomarker with 4-NP by Molecular docking and MD simulation

Molecular docking of 4-NP with acetylcholine esterase AChE

We used AutoDock Vina 1.2.0 (Eberhardt et al., 2021) to investigate the binding interactions of 4-NP (PubChem ID: 1752) with AChE, of Danio rerio and its UniProt id Q9DDE3, establishing an exhaustiveness level of 200 for accuracy. AutoDock tools were used to obtain and build the three-dimensional protein structure of AChE (Alpha fold model: Q9DDE3) for docking32. From both terminals, the areas of poor confidence were removed. Grid box center values of x =  − 5.53, y = 4.20, z =  − 3.75, and grid box size values of x = 27.95, y = 21.11, z = 22.35 with 1 Å spacing were used to define the docking grid parameters. Following docking, we used ‘Maestro-12.4 4 (Schrödinger Release 2020–2: Maestro, Schrödinger, LLC, New York, NY, USA) for comprehensive 2D interaction profiles and UCSF Chimera for 3D interaction analysis33.

Validation of 4-NP binding affinity

Using reiterated 200 ns Molecular Dynamics (MD) simulations, the stability of the 4-NP molecule in association with AChE was verified. The CHARMM 36 m force field served as the guide for the simulations, which were carried out using GROMACS software version 2021.134,35. SwissParam contributed the ligand’s topology and atomic charges, as necessary parameters36. TIP3P water, enhanced with sodium and chloride ions to attain charge neutrality, served as our simulation environment in a triclinic water box. The V-rescale thermostat and Parrinello-Rahman barostat were used to maintain a constant 300 K temperature and 1 bar of pressure during the MD simulations following the initial energy minimization and system equilibration37,38.

We used the LINCS algorithm39 and the Particle Mesh Ewald approach40 to maintain bond lengths and determine electrostatic forces, respectively. The radius of gyration (Rg), the root mean square deviation (RMSD) of the protein backbone and ligand, the minimum distance between the ligand and protein, and the Root Mean Square Fluctuations (RMSF) of residues near the ligand (within 5 Angstroms) were used to analyze these MD trajectories. The XMGRACE software (https://plasma-gate.weizmann.ac.il/Grace/) was used to generate the plots.

Free energy calculations

To compute the free energy using the Molecular Mechanics Generalized Born Surface Area (MMGBSA) method, we chose 400 snapshots from the 200 ns Molecular Dynamics (MD) simulation dataset, spaced by every 5th snapshot and spanning frames 18,000 to 20,000. MMPBSA.py was used to perform these computations4143. To determine each amino acid residue contribution to the system total energy, we also conducted a residue energy decomposition study. The energy contribution of each amino acid residue to the overall energy was also assessed using residue energy decomposition analysis. For free energy calculation, the following equation was used:

graphic file with name d33e615.gif

The binding free energy (ΔTotal) was estimated using van der Waals energy (ΔEVDW); polar solvation energy (ΔEGB); electrostatic energy (ΔEEEL); non-polar solvation energy (ΔESurf); total gas-phase free energy (ΔGgas); total solvation free energy (ΔGSol).

Statistical analysis

Evaluation of the data using the Bonferroni test (P < 0.05) as a post hoc test after a two-way analysis of variance (ANOVA). The data was presented as mean ± standard error mean (SEM) for n = 15. All statistical data were evaluated using Graph Pad Prism version 5.01.

Results and discussion

Effect of 4-NP on histology of brain H.fossilis

Histopathological assessment shows that exposure of 4-NP for 30 days to 60 days of low dose (64 µgL−1) and high dose (160 µgL−1) during pre-spawning to spawning period of catfish H. fossilis, sections of the telencephalon (Fig. 1) from the normal control group of H. fossilis, stained with H&E, displayed typical histological architecture. Neurons exhibiting a significant amount of uniform cytoplasm were visible along with their dendrites. The vesicular, rounded, centrally placed nuclei were observed. There was also a few neuroglia visible, their nuclei strongly stained. In the treated group adverse effects of 4-NP exposure on the telencephalon region of the brain of catfish like diffused and degenerated neurons, vacuolization, increased hemorrhage, and inflammatory cell generation. The Cerebellum region (Fig. 2) was also affected by exposure to 4-NP causing the formation of a separation gap between the molecular region and granular region, deformed necrotic neurons, vacuolization in the neuropil, Purkinje cells in treated groups when compared to control groups (Figs. 1 and 2).

Fig. 1.

Fig. 1

Showing photomicrograph of the transverse section of the telencephalon region of the brain of treated catfish H. fossilis exposed to 4-NP. Fig (A, D): control, (B, E): experimental of 30 to 60 days low dose (64 µg/l) and (C, F): high dose (160 µg/l) of treatment during pre-spawning to spawning (May–July). H & E stain, Magnification: 40x, Scale bar: 20 µm a-neurons, b-neuropil, c-neuroglial cells, d-diffuse deformed and degenerated neurons, e-vacuolization, f-hemorrhage and inflammatory cells.

Fig. 2.

Fig. 2

Showing photomicrograph of transverse section cerebellum region of the brain of treated catfish H. fossilis exposed to 4-NP. Fig (A, D): control, (B, E): experimental of 30 to 60 days low dose (64 µg/l) and (C, F): high dose (160 µg/l) of treatment during pre-spawning to spawning (May–July). H&E stain, Magnifiication: 40x, Scale bar: 20 µm, ML-molecular layer, GL-granular layer, a-neuroglial cells, b-neuropil, c-deformed necrotic neurons, d-vacuolization of neuropils, e-vacuolization in purkinje cells, f-separation gap between granular layers from molecular layer.

Effect of 4-NP on protein content in brain tissue of male H.fossilis

Protein content in the brain tissue of male H.fossilis was affected by 4-NP exposure, as compared to comtrol group treated group showed dose dependent decrease in the level of protein content of low dose (64 µgL−1) high dose (160 µgL−1) for 30 days and 60 days during pre-spawning to spawning period (Fig. 3).

Fig. 3.

Fig. 3

Graphical representation of protein content in the brain tissue of H. fossilis due to effect of 4-NP with a concentration of low dose (LD) (64 µg/L) and high dose (HD)(160 µg/L) for 30 days to 60 days of experiment from pre-spwaning to spawning period. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way analysis of variance (ANOVA) followed by Bonferroni test. Different alphabets denote statistically significant changes from the control (C0N) (P < 0.001).

Effect of 4-NP on acetylcholine esterase activity (AChE) in the brain of H. fossilis

The activity of brain enzyme acetylcholine esterase (AChE) was affected by exposure of 4-NP induces a decrease that is dependent on both dose and duration in level in the treated group of low dose (64 µgL−1) high dose (160 µgL−1) for 30 days and 60 days during pre-spawning to spawning period (Fig. 4). Statistical analysis shows the significant difference between dose and duration as F value is greator than F-critical value but interaction between dose and duration shows no significant difference as F-value value is less than F-critical value (Table 2).

Fig. 4.

Fig. 4

Graphical representation of AChE activity in the brain cells in H. fossilis due to effect of 4-NP with a concentration of low dose (LD) (64 µg/L) and high dose(HD) (160 µg/L) for 30 days to 60 days of experiment from pre-spwaning to spawning period. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way analysis of variance (ANOVA) followed by Bonferroni test. Different alphabets denote statistically significant changes from the control (CON) (P < 0.001).

Table 2.

F values of two ANOVA test of AChE activity in the brain cells in H. fossilis due to effect of 4-NP.

AChE activity F-value duration F-value dose F-value of interaction of both
11.06 8.747 0.356

Effects of 4-nonylphenol on anti-oxidative parameters, total antioxidant status, and total oxidant status in the brain of H. fossilis

A significant alteration was seen in antioxidant level in the brain tissue of H. fossilis due to exposure of 4-NP of low dose 64 µg/L and 160 µg/L of 30 and 60 days from the pre-spawning period to the spawning period. Dose-dependent significant decrease of SOD, GPx, Total Antioxidant status, and a decrease in catalase activity dependent on both dose and duration, along with a dose- and duration-dependent increase in LPO, a dose-dependent increase in Total oxidant status was found in brain tissue comparison to the control group of experiments (Figs. 5 and 6). Statistical analysis was also done and it was found that no significant difference in duration, interaction of dose and duration group. F-value was less than F-critical value but there was significant difference in dose groups in SOD level group (Table 3). In the treated group, catalase level its statistical significant difference was found in duration, dose group as well in interaction between dose and duration group as F-value was greater than F-critical value (Table 3). In treated group, GPx level statistical significant difference was not found in duration and interaction between dose and duration groups but had significant difference in dose groups. In LPO level all groups dose, duration and interaction between dose, duration were significantly difference as F-value was greater than F-critical value (Table 3). Total antioxidant status was found to be dose and duration dependent manner decreased. Total antioxidant status was found to be dose dependent manner decreased and Total oxidant status was found to be dose dependent increasing manner in brain tissue. Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of TAS (Table 4). In TOS there was significant difference in dose, duration and interaction between doses durations group where F-value is greater than F-critical value in brain tissue (Table 4). (Fig. 6 Supplementary data S1-Standard curve of Trolox for TAS measurement, Fig. 6 Supplementary data S2-Standard curve of H2O2 for TOS measurement).

Fig. 5.

Fig. 5

Effects of 4-NP on antioxidant defense system (SOD, CAT, GPx, LPO) in the brain of male catfish H. fossilis during pre-spawning and spawning phase of the reproductive cycle of low dose (LD)(64 µg/L) and high dose(HD) (160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups (n = 15, P < 0.05).

Fig. 6.

Fig. 6

Effects of 4-NP on TAS (total antioxidant status, expressed as micromole Trolox equivalent/L) and TOS (total oxidant status, expressed as micro mole H2O2 equivalent/L) in the brain of male catfish H. fossilis during pre-spawning and spawning phase of the reproductive cycle of low dose(LD)(64 µg/L) and high dose (HD)(160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant difference between experimental groups (n = 15, P < 0.05).

Table 3.

F values of two ANOVA test of effects of 4-NP on antioxidant defense system (SOD, CAT, GPx, LPO) in the brain of male catfish H. fossilis.

F-value duration F-value dose F-value of interaction of both dose and duration
SOD 2.0065 243.87 2.754
F-critical 4.413873 3.12653 4.00234
CATALASE 4.87 229.48 3.75
F-critical 4.31234 4.56792 3.56789
GPx 2.83 108.86 0.052
F-critical 4.45643 3.526784 3.54321
LPO 7.667 451.1 4.313
F-critical 4.53245 3.56231 3.40982

Table 4.

F values of two ANOVA test of Effects of 4-NP on TAS (total antioxidant status) and TOS (total oxidant status) in the brain of male catfish H. fossilis.

F-value duration F-value dose F-value of interaction of both dose and duration
TAS 163.09 937.7 12.73
F-critical 4.52341 4.34526 3.56743
TOS 63.45 127.7 6.5
F-critical 5.09654 4.03457 3.54321

Effects of 4-nonylphenol on cortisol in the brain of H. fossilis

The results indicated an increase in cortisol levels dependent on the dose in the brain tissue of H. fossilis when exposed to 4-NP at low (64 µg/L) and high (160 µg/L) doses for 30 and 60 days, from the pre-spawning to spawning period, compared to the control group. It was also observed that cortisol is higher in 30 days of treatment than in 60 days of treatment in the brain tissue of H. fossilis (Fig. 7). Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of cortisol level in in brain tissue (Table 5).

Fig. 7.

Fig. 7

Effects of 4-NP on stress hormone cortisol level in brain of catfish H. fossilis during pre-spawning and spawning phase of reproductive cycle of low dose(LD)(64 µg/L) and high dose (HD)(160 µg/L) of exposure for 30 days to 60 days. Statistical significance is determined using two -way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant difference between experimental groups. (n = 15, P < 0.05).

Table 5.

F values of two ANOVA test of Effects of 4-NP on stress hormone cortisol level in brain of catfish H. fossilis.

F-value duration F-value dose F-value of interaction of dose and duration
CORTISOL 395.997 855.91 23.798
F-critical 4.56321 5.87621 3.65482

Effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis

In brain it was depicted the number of percentage of necrotic cells increases in dose-dependent manner in 30 days of treatment of 4-NP but there was dose dependent increase in apoptotic cell percentage in 60 days of treatment in brain tissue of H.fossilis (Fig. 8).Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of necrosis percentage and apoptosis percentage in brain tissue (Table 6).

Fig. 8.

Fig. 8

A-Flow cytometry dot plots of the simultaneous binding of annexin V-fluorescein isothiocyanate (FITC) (FL-1) and propidium iodide uptake (FL-2) in the brain cells of H. fossilis control, Low dose(LD) 64 μg/l and high dose(HD) 160 μg/l for 30 to 60 days exposed groups to 4-NP. The numbers represent the percentage (%) of cells. The cells from the control H. fossilis were mostly negative for both annexin V binding and uptake of propodium iodide (PI). In contrast, the cells from nonylphenol (NP) treated groups exhibited strong positive staining for annexin V or both annexin V and PI in dose and time-dependent manner, B and C are graphical representations of apoptosis and necrosis percentage of flow cytometry dot plots. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups (n = 15, P < 0.05).

Table 6.

F values of two ANOVA test of the effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis.

F-value duration F-value dose F-value of interaction of dose and duration
Necrosis 19.09 12.64 10.73
F-critical 4.747225 3.885294 3.65487
Apoptosis 34.23 40.16 12.99
F-critical 4.59988 3.78654 3.89543

Effect of 4-NP on intracellular ROS in the brain of H. fossilis

Results depicted that 4-NP exposure to male catfish of low dose 64 µg/L and high dose160µg/L for 30 and 60 days during pre-spawning to spawning period caused an increased level of intracellular generation of Total ROS (reactive oxygen species) in dose-dependent manner in brain cells of H. fossilis (Fig. 9).Its statistical analysis shows significant difference in dose and duration groups and in interaction between dose and duration groups of Total ROS percentage in brain cells (Table 7).

Fig. 9.

Fig. 9

(A) Cytofluorometric (ROS-FACS) analysis of the frequency histograms for total ROS (reactive oxygen species) generation percentage by flow cytometer and (B) Showing graphical representation of Total ROS generation intensity in brain cells showing the effect of different concentrations of 4-NP doses low dose (LD) 64 µg and high dose(HD) of 160 µg on testicular cells of H. fossilis duration of 30 to 60 days pre-spawning to spawning period. Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups. (n = 15, P < 0.05).

Table 7.

F values of two ANOVA test of Effect of 4-NP on intracellular ROS in the brain of H. fossilis.

F-value duration F-value dose F-value of interaction of dose and duration
ROS 12.5 25.99 4.867
F-critical 4.87643 3.856743 3.67544

Effects of 4-nonylphenol on DNA fragmentation in brain tissue of H.fossilis

Our results depicted that 4-NP exposure to male catfish of low dose 64 µg/L and high dose 160 µg/L for 30 and 60 days during the pre-spawning to spawning period causes increased DNA fragmentation means it makes DNA migrate from comet causing tail movement. The increase in DNA fragmentation(tail length), tail moment and olive tail moment was dose and duration-dependent manner in brain tissues (Figs. 10 and 11i, ii, iii). Statistical assessment shows significant difference in dose, duration groups and in interaction between dose and duration groups of DNA migration in brain cells where F-value is greater than F-critical value in brain tissue (Table 8).

Fig. 10.

Fig. 10

Effect of 4-NP on DNA migration in brain at low dose (64 μg/L) and high dose (160 μg/L) for 30 and 60 days of treatment. Measuring DNA damage in cells using CASP lab software showing different degrees of DNA migration indicated by comet parameters as comet head and tail. (a) Control: No DNA migration in undamaged cell; (b) Treated: Mild increase in DNA migration or tail, (c) Treated: Moderate increase in DNA migration; (d) Treated: Severe DNA damage with increased DNA migration or tail length.

Fig. 11.

Fig. 11

(i) DNA migration (tail length, μm) (ii) tail moment (TM) and (iii) Olive tail moment (OTM) in control, low dose (LD) 64 μg/l, and high dose (HD) 160 μg/l for 30 to 60 days exposed groups to 4-NP in the brain of H. fossilis Statistical significance is determined using two-way ANOVA and post hoc test Bonferroni test. Different alphabets indicate significant differences between experimental groups. (n = 15, P < 0.05).

Table 8.

F values of two ANOVA test of Effects of 4-Nonylphenol on DNA fragmentation in brain tissue of H.fossilis.

F-value duration F-value dose F-value of interaction of dose and duration
DNA migration 135.02 170.57 112.94
F-critical 4.55632 3.48324 3.5

Effects of 4-nonylphenol on gene expression of GnRh and CYP19a1b in brain of H.fossilis

Gene expression of gonadotropin-releasing hormone (GnRh), brain aromatase (Cyp19 a1b) downregulates in dose-dependent manner in brain tissues of H.fossilis (Fig. 12). In brain there was significant difference in dose and duration groups and in interaction between dose and duration groups of gene expression of brain aromatase and GnRh where F-value is greator than F-critical value (Table 9). (Fig. 12 Supplementary data S3-Melting curve of GnRh, Fig. 12 Supplementary data S4-Melting curve of Cyp19a1b).

Fig. 12.

Fig. 12

Effects of 4-NP on gene expression of Gonadotropin-releasing hormone and brain aromatase in the brain of catfish H. fossilis of 30 to 60 days treatment of low dose (LD)(64 µg/L) and high dose (HD)(160 µg/L) during pre-spawning and spawning phase of the reproductive cycle. Data were expressed as mean ± SEM (n = 15). Assessment of data by two-way ANOVA followed by post hoc test Bonferroni test (P < 0.05). Different alphabets denote significant changes from the control.

Table 9.

F values of two ANOVA test of Effects of 4-Nonylphenol on gene expression of GnRH and CYP19A1B in brain of H.fossilis.

F-value duration F-value dose F-value of interaction of dose and duration
GnRH 15.11838 856.9661 26.50224
F-critical value 4.747225 3.885294 3.885294
Brain aromatase 512.388 58,275.32 3397.676
F-critical value 5.43876 4.36785 3.98769

Physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

In silico study screening of pharmacokinetics properties of 4-Nonylphenol was done through Swiss ADME bioinformatics tools shows that 4-NP crosses the blood–brain barrier and has the highest organism’s intestinal absorption and drug-likeness properties. Metabolism prediction by Swiss ADME is that 4-NP inhibits CYP1A2, CYP2C19, and CYP2D6, these are cytochrome P450 enzymes. 4-NP blocks the function of CYP1A2, which are involved in various processes, including drug metabolism and lipid production—such as cholesterol and steroids—the CYP2C19 gene encodes an enzyme primarily located in the endoplasmic reticulum of liver cells, where it plays a key role in protein processing and transport. The human CYP2D6 gene encodes the enzyme cytochrome P450 2D6 (CYP2D6). It is mainly expressed in the liver and is also highly present in certain regions of the central nervous system, such as the substantia nigra. Physicochemical properties of small molecules, such as molecular weight (MW) less than 500, lipophilicity (cLogP) less than 5, and a maximum of 10 hydrogen bond acceptors (HBA) and 5 hydrogen bond donors (HBD), are evaluated by the Lipinski filter. So, according to Lipinski’s rule, 4-NP does not violate the rule of five (Table 10).

Table 10.

Lipinski’s molecular descriptors for 4-Nonylphenol from SwissADME.

Compound name 4-Nonylphenol
Canonical SMILES CCCCCCCCCc1ccc(cc1)O
MW(g/mol) molecular weight (≤ 500) 220.35 g/mol
HBA = Hydrogen bond acceptor (≤ _10) 1
HBD Hydrogen bond donor (≤ 5) 1
cLogP lipophilicity (< 5) 3.7
MR molar refractivity (40–130) 71.89
n-ROTB number of rotatable bonds 8
TPSA (Å2) Topological polar surface area 20.23 Å2
Parameters Compound 4-Nonylphenol
GI absorption High,90.88%
BBB permeability Yes
P-glycoprotein substrate No
CYP1A2 inhibitor Yes
CYP2C19 inhibitor Yes
CYP2D6 inhibitor Yes
Druglikeness according to Lipinski’s rule Yes
Total clearance 1.422 log ml/min/kg
Renal OCT2 substrate No

Assessment of binding affinity of protein acetylcholine esterase biomarker with 4-NP by molecular docking and molecular dynamic simulation

Molecular docking of 4-NP with AChE

We found that 4-NP exhibits potential binding with AChE with a binding score of -7.0 kcal/mol. Molecular docking study revealed that 4-NP was stabilized in the pocket of AChE mainly via interactions with hydrophobic residues i.e., Trp108, Tyr146, Leu152, Tyr155, ALa226, Phe315, Tyr355, Phe356, and Ile499. Other interactions stabilizing the 4-NP include negatively charged Glu224, and several polar and glycine residues as shown in Fig. 13.

Fig. 13.

Fig. 13

Binding Interactions of 4-NP with Acetylcholine esterase (AChE), 2D interaction shows the 5 Ǻ interacting residues of 4-NP in the pocket of AChE.

MD simulation and MMGBSA analysis of Fortunellin–Papain-like protease complex

MD trajectory investigation demonstrated that the AChE-4-NP complex remained stable throughout the 200 ns MD simulations in both runs. A stable backbone conformation was observed, with average RMSD values of 0.349 nm and 0.426 nm in runs 1 and 2, respectively (Fig. 14A), indicating interaction stability. The ligand’s RMSD suggested two conformational adjustments to stabilize within the AChE protein pocket, with a value of 0.8 nm in both simulations (Fig. 14 B). The system sustained an average Rg value of 2.35 ± 0.02 nm in run 1 and 2.38 ± 0.02 nm in run 2, signifying a compact and stable structure (Fig. 14 B). Additionally, a minimum distance of 0.2 ± 0.05 nm between 4-NP and the AChE protein in both simulations indicated a stable interaction (Fig. 14 C). This proximity ensured that the ligand remained within the target site (Fig. 14 D). Furthermore, RMSF analysis revealed that residues within a 5 Å region of the ligand were consistently shielded by 4-NP (Fig. 14 E).

Fig. 14.

Fig. 14

MD analysis of AChE-4-NP complex reveals the stability of the ligand in the active pocket of the protein. The figure depicts (A) Root mean square deviation (RMSD) for the backbone, (B) RMSD for the ligand binding, (C) Radius of gyration, (D) Minimum distance between AChE and 4-NP throughout the 200 ns trajectory, (E) Root Mean Square Fluctuations (RMSF) analysis (the critical residues within the active site of the protein are marked with red arrows) of the complex.

AChE-4-NP interaction analysis

The gmx cluster was used to identify the most populated cluster of the AChE-4-NP complex throughout the simulation time. The average snapshot of the most populated cluster in both simulations was generated as shown in Fig. 15. The 2D interaction analysis of this snapshot showed that NP interacts ‘with the active site’residues of AChE, primarily stabilized by hydrophobic interactions. The interactions with Phe94, Gly104, Ile105, Trp108, Tyr146, Ser147 Tyr355, Phe356, Tyr359, and His 495 residues were found to be common in both the simulations (Fig. 15).

Fig. 15.

Fig. 15

Most populated structure identification throughout the 200 ns trajectory. The figure depicts (A) 4-NP (shown with stick model in red color) occupying the active site of the AChE protein, (B) The binding conformation, and 2D view of the interacting residues. The color of the residues is same as shown in Fig. 13.

MMGBSA and residue decomposition analysis

Furthermore, MMGBSA analysis revealed that the AChE-4-NP complex was greatly stabilized by the van der Waals forces and exhibits a reliable binding free energy of − 25.0959 ± 2.2791 kcal/mol and − 20.0871 ± 2.8735 kcal/mol in run 1 and run 2 respectively (Table 11 and Fig. 16). Further, the residue decomposition analysis revealed that the residue Trp108 exhibits the highest energy contribution in 4-NP binding followed by other crucial residues i.e., Phe95, Val95, Ile105, Tyr55 Phe356, Tyr359, and others as shown in Fig. 15, stabilizing the AChE-NP complex (Fig. 16).

Table 11.

Free energy calculations of AChE-4-NP complex using MM-GBSA technique.

Energy components Run 1 Run 2
∆EVDW  − 34.2728 ± 1.9742  − 28.7923 ± 2.7464
∆EEEL  − 6.6963 ± 2.6888  − 4.8146 ± 5.8628
∆EGB 20.9755 ± 1.5211 18.0681 ± 3.2582
∆ESURF  − 5.1024 ± 0.2089  − 4.5483 ± 0.3212
∆Ggas  − 40.9690 ± 2.8178  − 33.6069 ± 5.1728
∆Gsolv 15.8731 ± 1.4701 13.5198 ± 3.2032
∆Gtotal  − 25.0959 ± 2.2791  − 20.0871 ± 2.8735

All energies are in kcal/mol along with their standard deviation in parenthesis. ∆EVDW: van der Waals contribution from MM; ∆EEEL: electrostatic energy as calculated by the MM force field; ∆EGB: the electrostatic contribution to the solvation free energy calculated by GB; ∆ESURF: solvent-accessible surface area; ∆Ggas: gas-phase interaction energy; ∆Gsolv: solvation free energy; ∆Gtotal: total binding free energy.

Fig. 16.

Fig. 16

Energy contribution in AChE-4-NP complex stability by interacting residues calculated using the MMGBSA technique.

Discussion

Effect of 4-NP on protein content in brain tissue of male H.fossilis

Experimental evidence shows that fish exposed to 4-NP exhibit a significant reduction in brain protein levels compared to control groups. This reduction is likely associated with enhanced proteolytic activity or impaired protein synthesis mechanisms resulting from endocrine disruption or oxidative damage44,45. Decreased brain protein levels could impair cognitive function, sensory processing, and overall behavioral responses in Heteropneustes fossilis, impacting survival and ecological fitness.

Histopathological assessment of the brain of H. fossilis due to the effect of 4-NP

The complex structure of the brain can make pathological examination of the nervous system challenging in neurotoxicology,46 especially given the limited literature on fish brain histopathology. In laboratory research, histopathological assessments are essential for identifying the direct effects of contaminants on fish target organs47,48. Numerous effects and changes in brain tissue in this study were in line with earlier findings that showed neurological deterioration and destruction49. For example, high levels of lead exposure have been linked to encephalopathy and brain tissue degeneration50,51. Findings have been reported in goldfish (Carassius auratus)52 and spotted murrel (Channa punctatus) after exposure to heavy metals and endosulfan,53 respectively. The brains of post-juvenile African catfish (C. gariepinus) treated with glyphosate herbicide54 and toads (Buffo regularis) exposed to endosulfan and diazinon have also been shown to have minor necrosis and vacuolar formation55.

Metals such as aluminum (Al (III)), copper, ferrous sulfate,47, AlCl3,56 and methylmercury (MeHg)33 have been implicated in neuronal cell degeneration, leading to neurodegenerative disorders like Parkinson’s dementia (PD) and Alzheimer’s disease (AD)57. Vacuolization in Purkinje cells, neuropil loss, and necrotic neuron were seen in the cerebellum and telencephalon region of the brain of striped bass (Morone saxatilis) due to effect of domoic acid was reported58. The severity of histopathological changes varies based on the dose and duration of exposure. Present study depicts the neurotoxic effect of the 4-Nonylphenol exposure dose of low and high doses for 30 days to 60 days prespawning to spawning and shows dose and duration-dependent toxicity in brain tissue. It affects the telencephalon and cerebellum region of the brain of catfish which hampers olfaction, reproduction, locomotion, and spatial cognition59,600.4-Nonylphenol rapidly crosses the blood–brain barrier and builds up in various brain regions at varying concentrations1, and in silico studies through Swiss ADME have also predicted and supported the aforesaid statement. This accumulation can have mild to severe effects on non-neuronal and neuronal cells depending upon exposure time and concentration.

Effect of 4-NP on acetylcholine esterase activity (AChE) in the brain of H. fossilis

AChE is comprehensively recognized as a biomarker for assessing the neurotoxic effects of contaminants in aquatic organisms61. Impediment of AChE activity leads to acetylcholine cumulation, as observed in the present investigation. Our investigation elucidated that Acetylcholinesterase (AChE) activity was markedly inhibited in the brain tissues. According to our research, the fish brain’s sensory and motor regions experienced a disruption in neuronal connection following exposure for 30 to 60 days, resulting in a significant decrease in AChE activity. The fish exhibited altered and uncoordinated movements as a result of the disturbance brought on by 4-NP exposure. This brain area called the cerebellum is responsible for performing many motor actions poor AChE activity is positively correlated with poor locomotory/swimming performance. Acetylcholine (ACh) accumulates up in synapses as a result of decreased AChE activity, which impairs behavior, eating, and swimming. Lower AChE expression may be associated with AChE inhibition which could lead to neurotoxic modifications in the nervous system.

Evaluation of antioxidant parameters (SOD, CAT, GPx, and TAS) and LPO, TOS in testes and brain tissue of H. fossilis due to exposure of 4-NP

Oxidative stress results from an imbalance between reactive oxygen species (ROS) and reactive nitrogen species (RNS) at the cellular and tissue levels and the body’s ability to counteract these with its antioxidant systems, including antioxidant enzymes. The brain contains a high concentration of polyunsaturated fatty acids, making it particularly susceptible to lipid peroxidation, and polyunsaturated fatty acids (PUFAs). Lipid peroxidation in the brain can be investigated by measuring MDA levels, a key marker of lipid peroxidation and oxidative stress. SOD, GSH, and CAT serve as the primary defense mechanisms against free radicals responsible for oxidative stress. As such, they are important markers for determining how harmful the environment is to different aquatic species62,63. Antioxidant enzyme activities of aquatic animals are affected by 4-nonylphenol (4-NP) exposure. SOD detoxified superoxide into hydrogen peroxide, which is subsequently converted by catalase into water and oxygen64 and65. Over time, SOD activity may decline and larger concentrations of superoxide anions may result; yet, SOD is still capable of converting these anions, up to a certain concentration, into hydrogen peroxide66. Since high hydrogen peroxide concentrations can quickly inactivate CAT, persistent high production of hydrogen peroxide in tissues under oxidative stress can impede CAT activity67,68. This mechanism affects non-enzymatic thiol antioxidants like GSH, which aid in lowering lipid peroxidation. Under many oxidative stress scenarios, glutathione (GSH) is an essential free radical scavenger69. The inactivation of the GSH enzyme is one target mechanism in 4-NP-induced neurotoxicity69,70. Zebrafish embryos exposed to 100 µg/L of 4-NP for 4–168 h post-fertilization (hpf), African catfish subjected to’ 0.1 mg/kg body weight of 4-NP for three weeks, and Bighead carp exposed to 1000 µg/L of bisphenol A for sixty days and the brain of adult zebra fish exposed to heavy metals for twenty-one days have all demonstrated notable decreases in SOD and CAT activity as well as GSH levels71.

Additionally, exposure to 17-β estradiol dramatically changed SOD and CAT activity in the brains of common carp fish,72. Lipid peroxidation (LPO), which is caused by oxidative damage to circulating lipids and phospholipids in cell membranes, yields malondialdehyde (MDA). Amount of MDA demonstrates the degree of oxidative damage brought on by pollutants73. An elevation in MDA levels indicates oxidative stress caused by various substance, including xenobiotics74. The results of this investigation into the effects of 4-NP exposure on lipid peroxidation are consistent with those of previous studies7578. The findings of this study suggest that increased MDA levels may be due to excessive ROS, leading to cell membrane damage and lipid peroxidation in the brain tissue. The production of reactive species within the brain membrane, due to exposure to various xenobiotics, leads to a dwindled metabolic enzyme activity and an escalation in LPO products76. Extended exposure to 4-NP increased superoxide anion levels in the brain, leading to decreased SOD activity in the exposed group79. Concentration-dependent decline in superoxide dismutase and catalase activity, along with decreased glutathione levels, in zebrafish exposed to 4-Nonylphenol, which was accompanied by elevated malondialdehyde levels in the brain80. The mixture of nano plastic and 4-Nonylphenol induces oxidative stress in the zebrafish brain and impaired neurotransmitters81. Oxidative stress is indicated by escalation of lipid peroxidation (LPO) and dwindled CAT, SOD and GPX activities.

Effect of 4-NP on cortisol level in brain of H. fossilis

While there are several studies detailing the impact of different stressors on pro-opiomelanocortin (POMC) expression, it is largely unknown the impacts of 4-NP on POMC mRNA expression in fish. The mechanism of cortisol action begins with the hypothalamus releasing the polypeptide corticotropin-releasing hormone into the bloodstream. The anterior pituitary gland then secretes adrenocorticotrophic hormone (ACTH) in response to stimulation by CRH. The adrenal cortex’s melanocortin 2 receptor (MC2-R) is activated by ACTH, which then causes the interrenal region to produce and release cortisol and other glucocorticoids (GCs)82,83. The hypothalamic–pituitary–adrenal (HPA) axis is made up of this intricate neuroendocrine system. The only form of cortisol that is physiologically active is in its unbound form, which is detected in plasma and is removed either by tissue absorption or by molecular breakdown that releases cortisone84. Depending on the type of stressor (acute or chronic), clearance rates can vary85 with cortisol levels returning to baseline at different times post-stress. Considering the hydrophobic and highly lipophilic nature of cortisol molecules, tissue uptake most likely happens by passive diffusion. To modify gene expression in tissues, cortisol binds to mineralocorticoid and glucocorticoid receptors86 and additional non-genomic processes that might not be entirely dependent on certain cortisol receptors87. Cortisol molecules are broken down or rendered inactive after binding and the metabolites that result like through urine and feces, primarily via the liver-bile-feces system, release cortisone into the environment. Furthermore, unbound cortisol may diffuse through the gills and enter the surrounding water88.

Cortisol is thought to play a neuromodulatory role in controlling the primary neuronal populations of the diencephalon and caudal telencephalon/anterior preoptic region, which are involved in gonadotropin secretion and regulation35 as well as spawning behavior89.

Fish exposed to the highest dose of 4-NP showed elevated cortisol levels and reduced total antioxidant capacity (TAC). This suggests that following 4-NP exposure, the plasma antioxidant system responds to the heightened production of reactive oxygen species (ROS). As a result, TAC may be a useful marker for determining how pollution affects animals in the ecosystem90. Increased cortisol levels can cause a decrease in TAC. This can be because different cortisol pathways activate sequentially, or because ROS directly affect cortisol metabolism91. Proposed a link between plasma cortisol levels and HSP70 expression in stressed goldfish92. They have shown that elevated cortisol levels stimulate HSP70 mRNA in the brain but not in the hepatopancreas.

Similarly, after 4-NP treatment, elevated HSP70 mRNA levels were seen in Gobius niger93,94 and after juvenile S. solea were exposed to contaminated sediments95. Remarkably, it was shown that a single dose of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) raised the mRNA levels of POMC and the aryl hydrocarbon receptor (AhR), which in turn caused higher cortisol levels96.

Effect of 4-NP on the apoptosis, necrosis, and cell viability in the brain of H. fossilis

In brain cell necrosis percentage was greater than the apoptosis percentage in 30 days of treatment of 4-NP but when chronic exposure of 60 days, the apoptosis percentage increased showing 4-NP induction towards the programmed cell death.

ROS have the capability to start a chain of events that harm cellular constituents and ultimately result in cell death44,97. Alteration in antioxidant parameters and increased levels of ROS induces apoptosis cell death and eventually causes cell death of the tissues. Though more investigation is required to validate this,7,98 suggest that there are several potential pathways underlying the harmful consequences of 4-NP exposure. DNA damage is the reason for the apoptotic effects on brain cells and erythrocytes. This study discovered a direct correlation between neuronal apoptosis and 4-NP residues in the brain.4-NP was able to cross the blood-brain barrier (BBB), which is a dynamic and selective barrier99. In addition to maintaining brain homeostasis, the BBB guards against harmful chemicals100. Apoptosis is a generalized mechanism of neuronal cell death under pathogenic conditions101. Notably, 4-NP inhibits the expression of glutathione peroxidase and disrupts the cell’s protective mechanisms102, despite the tight junctions in endothelial cells that protect the brain103.

Effect of 4-NP on intracellular ROS in the brain of H. fossilis

Oxidative stress-induced cellular activation typically results from ROS-mediated oxidation of DNA104, polyunsaturated fatty acids in lipids105, and amino acids in proteins106. Beyond these direct oxidation effects, cellular oxidative responses also occur. According to recent studies, 4-NP can cause the production of ROS in yeast, bacterial and cultured vertebrate cells at doses ranging from 50 to 200 μM.107110. Findings indicate that 4-NP within this concentration range can cause both estrogenic effects and ROS production. Although these 4-NP levels are higher than those typically found in the environment, significant quantities of 4-NP have been detected in certain sewage sources and various aquatic plants and animals111.

Effect of 4-NP on the DNA fragmentation exposure to brain of H. fossilis

4-Nonylphenol also acts as a toxicant, it induces genotoxicity, and cytotoxicity causes DNA damage or DNA fragmentation. Our investigation shows that DNA fragmentation by COMET assay means tail DNA movement increases with a dose-dependent manner in the brain tissue of catfish H. fossilis when they are exposed to 4-NP doses. Reactive species such as free radicals are continuously generated in vivo, with DNA being the most significant target of oxidative stress. Oxidative DNA damage serves as a predictive biomarker for monitoring the risk of developing various diseases. In the comet assay, the percentage of tail DNA is used to evaluate DNA damage. This is a highly important and sensitive parameter that has been extensively utilized in various studies112,121. The excessive production of ROS can damage lipids, proteins, and DNA.

Impact of 4-NP on gene expression in the brain of H. fossilis

Our study depicts the profound effect of 4-Nonylphenol on gene expression of CYP19a1b, GnRH in the brain of H. fossilis. GnRH, CYP19a1b decrease in a dose-dependent manner due to endocrine disrupting and xenoestrogenic effect of 4-NP exposure of 64 µg/L as a low dose and 160 µg/L as a high dose given for the period of 30 days and 60 days of exposure. A similar study shows the altered brain aromatase activities in male Fathead minnows (Pimephales promelas) following estrogenic treatments were given113. Additionally, it was reported that reduced brain aromatase levels in wild perch populations from a Swedish lake contaminated by waste dump leachate114.

Fish from polluted settings may exhibit behavioral changes and negative effects on the hypothalamic-pituitary-gonad axis due to disruption of brain aromatase activity, this may also influence crucial brain development in sex-changing animals [136]. Because aromatase activity in seasonal spawners varies with seasonal variations, this disruption may also have a deleterious impact on them115117. Different steroid treatments have been shown to both stimulate and inhibit brain aromatase, with the effects varying according to age, gender, species, dose concentration, and length of exposure42,77,83,113. Fish gonadal functions, gametogenesis, and steroidogenesis are all governed by the kisspeptin-gonadotropin-releasing hormone (GnRH)-gonadotropins (follicle-stimulating hormone (FSH) and luteinizing hormone LH) axis, just like in other vertebrates. Furthermore, sex steroids regulate the synthesis of kisspeptin, gonadotropins, and GnRH through both positive and negative feedback mechanisms118. GnRH expression was significantly reduced in juvenile rainbow trout exposed to 4-NP (0.1–10 μM) and female goldfish (Carassius auratus) exposed to BPA (1–500 μg/L)68,105.

In silico assessment of physiochemical properties, pharmacokinetic predictions, and drug likeness of 4-NP

To increase the toxicological dataset available for evaluating 4-NP toxicity, the current study sought to estimate comprehensive ADME features for 4-Nonylphenol utilizing an in silico methodology that integrates SwissADME, pkCMS, and PASS online tools for computational toxicology. For the first time, our work offers predictions for 4-Nonylphenol’s physicochemical characteristics, pharmacokinetics, drug similarity, and toxicological consequences.

Our study presents, for the first time, predictions of physicochemical properties, pharmacokinetics, drug-likeness, and toxicological effects associated with 4-Nonylphenol.4-NP shows a high probability of being absorbed in gastrointestinal about 90.88% according to SwissADME and pkCSM. From Swiss ADME, pkCMS prediction 4-NP has druglikeness properties, it can cross the blood–brain barrier, and follows all rule of Lipinski. Enzymes known as cytochrome P450 (CYP450) are essential for the metabolism of both drugs and other xenobiotics. These enzymes can either detoxify drugs/xenobiotics by converting them into less harmful compounds 0.4-NP is a potent inhibitor to these cytochrome P450 enzymes CYP1A2, CYP2C19, and CYP2D6 causing toxicity in the body of any organism which is exposed to any kind of xenobiotics or pollutants. By PASS prediction 4-NP shows hematotoxicity12 in vivo studies, other toxicity such as nephrotoxicity, and acetylcholine inhibitor.

Assessment of binding affinity of protein acetylcholine esterase biomarker with 4-NP by molecular docking and MD simulation

AChE is a key biomarker commonly used to investigate the neurotoxic effects of pollutants on aquatic organisms11. Molecular docking studies provided additional confirmation that 4-NP exposure inhibited the activity of the AChE enzyme. This is the first time that 4-NP has been shown to interact with the male H.fossilis enzyme AChE. AChE activity inhibition has been studied in various species, including Drosophila melanogaster exposed to dispersed blue-124 and black-9 textile dyes57, Electrophorus electricus subjected to bisphenol derivatives52,and Periplaneta americana treated with 3-dimethylmaleic anhydride16.The binding energy (-7.0 kcal/mol), shows efficient binding of 4-NP with protein AChE, molecular docking study revealed that 4-NP was stabilized in the pocket of AChE mainly via interactions with hydrophobic residues i.e., Trp108, Tyr146, Leu152, Tyr155, ALa226, Phe315, Tyr355, Phe356, and Ile499.MD trajectory analysis showed that the AChE-4-NP complex remained stable throughout the 200 ns MD simulations in both runs. The backbone conformation exhibited stability, with an average RMSD of 0.349 nm in run 1 and 0.426 nm in run 2 (Fig. 13A), indicating sustained interaction stability.

Conclusion

4-Nonylphenol, acute and chronic, sub-lethal dose exposure causes neurotoxicity in the brain of male H. fossilis, which hampers the reproductive function by downregulation of gonadotropin-releasing hormone. It affects the population of catfish and aquaculture. Our study depicts that 4-NP crosses the blood–brain barrier causes oxidative stress, cell death, altered antioxidant defense mechanism, and histopathological alteration in brain tissue. Further molecular docking and MD simulation study analysis depicts the efficient binding affinity of 4-NP with acetylcholine esterase enzyme (AChE) showing its neurotoxic effects. Indirectly via biomagnification, it can affect the human population, so there is a need for concern about the health of the aquatic ecosystem and these parameters can be applied to aquatic ecosystems to determine risk.

Supplementary Information

Below is the link to the electronic supplementary material.

Supplementary Material 1 (306.5KB, pdf)

Acknowledgements

Suman would like to express her gratitude to the IoE SRICC Banaras Hindu University credit passbook for monetary assistance. The author acknowledges the Interdisciplinary School of Life Sciences (ISLS), SATHI, Central Discovery Centre (CDC), CIL (M.M.V), Banaras Hindu University for assisting the instrumental support.

Author contributions

Suman, GGJ, were involved in the conception, design, and execution of the experiments. *In silico* analysis part was done by SA and RM. All experimental data was analyzed by Suman, GGJ, contributed to the article’s drafting. Suman assisted with reagent preparation and experimentation. It was critically revised for significant knowledgeable content by Suman and GGJ. The final version to be published was approved by all of the authors.

Funding

The authors received no financial support for the research, and publication of this article.

Data availability

All data supporting the findings of this study will be available upon request and the datasets generated and/or analysed during the current study are available in the name i.e.,AChE of *Danio rerio* and its UniProt id [**Q9DDE3**](https:/www.uniprot.org/uniprotkb/Q9DDE3/entry).

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Gautam, G. J., Chaube, R. & Joy, K. Toxicity and tissue accumulation of 4-nonylphenol in the catfish Heteropneustes fossilis with a note on prevalence of 4-NP in water samples. Endocrine Disruptors3(1), e981442 (2015). [Google Scholar]
  • 2.De Falco, M. et al. Nonylphenol effects on the HPA axis of the bioindicator vertebrate, Podarcis sicula lizard. Chemosphere104, 190–196. 10.1016/j.chemosphere.2013.11.014 (2014). [DOI] [PubMed] [Google Scholar]
  • 3.Vincent, M. D. & Sneddon, J. Nonylphenol: An overview and its determination in oysters and wastewaters and preliminary degradation results from laboratory experiments. Microchem. J.92(1), 112–118. 10.1016/j.microc.2009.02.005 (2009). [Google Scholar]
  • 4.Ruczyńska, W., Szlinder-Richert, J. & Nermer, T. The occurrence and distribution of nonylphenols and nonylphenol ethoxylates in different species of fish. Environ. Sci. Process. Impacts22(4), 1057–1070 (2020). [DOI] [PubMed] [Google Scholar]
  • 5.Şahin, E. & Gumuslu, S. Alterations in brain antioxidant status, protein oxidation and lipid peroxidation in response to different stress models. Behav. Brain Res.155(2), 241–248 (2004). [DOI] [PubMed] [Google Scholar]
  • 6.Liu, Y. et al. DNA methylation in the 5′ flanking region of cytochrome P450 17 in adult rare minnow Gobiocypris rarus—tissue difference and effects of 17α-ethinylestradiol and 17α-methyltestoterone exposures. Comp. Biochem. Physiol. C: Toxicol. Pharmacol.162, 16–22. 10.1016/j.cbpc.2014.03.001 (2014). [DOI] [PubMed] [Google Scholar]
  • 7.Sayed, A. E. D. H., Soliman, H. A. & Mitani, H. UVA-induced neurotoxicity in Japanese medaka (Oryzias latipes). Photochem. Photobiol. Sci.18, 71–79. 10.1039/c8pp00169c (2019). [DOI] [PubMed] [Google Scholar]
  • 8.Tabassum, H., Afjal, M. A., Khan, J., Raisuddin, S. & Parvez, S. Neurotoxicological assessment of pendimethalin in freshwater fish Channa punctata Bloch. Ecol. Ind.58, 411–417 (2015). [Google Scholar]
  • 9.Chi, H., Chang, H. Y. & Sang, T. K. Neuronal cell death mechanisms in major neurodegenerative diseases. Int. J. Mol. Sci.19(10), 3082. 10.3390/ijms19103082 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cavas, T., Garanko, N. N. & Arkhipchuk, V. V. Induction of micronuclei and binuclei in blood, gill and liver cells of fishes subchronically exposed to cadmium chloride and copper sulphate. Food Chem. Toxicol.43(4), 569–574. 10.1016/j.fct.2004.12.014 (2005). [DOI] [PubMed] [Google Scholar]
  • 11.Sayed, A. E. D. H., Abd-Elkareem, M. & Abou Khalil, N. S. Immunotoxic effects of 4- nonylphenol on Clarias gariepinus: Cytopathological changes in hepatic melanomacrophages. Aquat. Toxicol.207, 83–90. 10.1016/j.bbr.2004.04.022 (2019). [DOI] [PubMed] [Google Scholar]
  • 12.Talapatra, S. N. & Banerjee, S. K. Detection of micronucleus and abnormal nucleus in erythrocytes from the gill and kidney of Labeo bata cultivated in sewage-fed fish farms. Food Chem. Toxicol.45(2), 210–215. 10.1016/j.fct.2006.07.022 (2007). [DOI] [PubMed] [Google Scholar]
  • 13.Thomsen, R. & Christensen, M. H. MolDock: A new technique for high-accuracy molecular docking. J. Med. Chem.49, 3315–3321. 10.1021/jm051197e (2006). [DOI] [PubMed] [Google Scholar]
  • 14.Meucci, V. & Arukwe, A. Transcriptional modulation of brain and hepatic estrogen receptor and P450arom isotypes in juvenile Atlantic salmon (Salmo salar) after waterborne exposure to the xenoestrogen, 4-nonylphenol. Aquat. Toxicol.77(2), 167–177. 10.1016/j.aquatox.2005.11.008 (2006). [DOI] [PubMed] [Google Scholar]
  • 15.Mittal, A. K. A note on cold anesthesia of poikilotherms. J. Fish Biol.13, 519–520. 10.1111/j.1095-8649.1978.tb03462.x (1978). [Google Scholar]
  • 16.Suman, R. C., & Gautam, G. J. Modulation of testicular activity in Indian stinging catfish Heteropneustes fossilis under acute exposure to 4-Nonylphenol. J. Environ. Biol. 43 (2022).
  • 17.Rosenfeld, C., Kousba, A. & Sultatos, L. G. Interactions of rat brain acetylcholinesterase with the detergent Triton X-100 and the organophosphate paraoxon. Toxicol. Sci.63(2), 208–213. 10.1093/toxsci/63.2.208 (2001). [DOI] [PubMed] [Google Scholar]
  • 18.Ellman, G. L., Courtney, K. D., AndresJr, V. & Featherstone, R. M. A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol.7(2), 88–95. 10.1016/0006-2952(61)90145-9 (1961). [DOI] [PubMed] [Google Scholar]
  • 19.Mishra, A. K., Gopesh, A. & Singh, K. P. Acute toxic effects of chlorpyrifos on pseudobranchial neurosecretory system, brain regions and locomotory behavior of an air-breathing catfish, Heteropneustes fossilis (Bloch 1794). Drug Chem. Toxicol.45(2), 670–679. 10.1080/01480545.2020.1762631 (2022). [DOI] [PubMed] [Google Scholar]
  • 20.Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem.72(1–2), 248–254. 10.1016/0003-2697(76)90527-3 (1976). [DOI] [PubMed] [Google Scholar]
  • 21.Das, K. C. & Das, C. K. Thioredoxin, a singlet oxygen quencher and hydroxyl radical scavenger: redox independent functions. Biochem. Biophys. Res. Commun.277(2), 443–447. 10.1006/bbrc.2000.3689 (2000). [DOI] [PubMed] [Google Scholar]
  • 22.Claiborne, A. J. F. C. P. Handbook of methods for oxygen radical research 283–284 (CRC Press, 1985). [Google Scholar]
  • 23.Rajizadeh, M. A. et al. Comparison of preventive and therapeutic effects of continuous exercise on acute lung injury induced with methotrexate. Exp. Physiol.108(9), 1215–1227. 10.1113/EP091162 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 24.Ohkawa, H., Ohishi, N. & Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem.95(2), 351–358 (1979). [DOI] [PubMed] [Google Scholar]
  • 25.Ololade, I. A. & Oginni, O. Toxic stress and hematological effects of nickel on African catfish, Clarias gariepinus, fingerlings. J. Environ. Chem. Ecotoxicol2(2), 014–019. 10.1016/0003-2697(79)90738-3 (2010). [Google Scholar]
  • 26.Erel, O. A novel automated method to measure total antioxidant response against potent free radical reactions. Clin. Biochem.37(2), 112–119. 10.1016/j.clinbiochem.2003.10.014 (2004). [DOI] [PubMed] [Google Scholar]
  • 27.Erel, O. A new automated colorimetric method for measuring total oxidant status. Clin. Biochem.38(12), 1103–1111. 10.1016/j.clinbiochem.2005.08.008 (2005). [DOI] [PubMed] [Google Scholar]
  • 28.Bartos, J. & Pesez, M. Colorimetric and fluorimetric determination of aldehydes and ketones. Pure Appl. Chem.51(8), 1803–1814 (1979). [Google Scholar]
  • 29.Bode, K., Link, C., Krammer, P. H. & Weyd, H. Flow-cytometric detection of low-level reactive oxygen species in cell lines and primary immune cells. Bio-Protoc.10(17), e3737–e3737. 10.21769/BioProtoc.3737 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Dhawan, A., Bajpayee, M. M., Pandey, A. K. & Parmar, D. Protocol for the single cell gel electrophoresis/comet assay for rapid genotoxicity assessment. Sigma1077(1), 1–10 (2003). [Google Scholar]
  • 31.Yahia, D. & Ali, M. F. Assessment of neurohepatic DNA damage in male Sprague-Dawley rats exposed to organophosphates and pyrethroid insecticides. Environ. Sci. Pollut. Res.25, 15616–15629. 10.1007/s11356-018-1776-x (2018). [DOI] [PubMed] [Google Scholar]
  • 32.Morris, G. M. et al. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem.30(16), 2785–2791. 10.1002/jcc.21256 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Rasinger, J. D., Lundebye, A. K., Penglase, S. J., Ellingsen, S. & Amlund, H. Methylmercury induced neurotoxicity and the influence of selenium in the brains of adult zebrafish (Danio rerio). Int. J. Mol. Sci.18(4), 725. 10.3390/ijms18040725 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Abraham, M. J. et al. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SoftwareX1, 19–25. 10.1016/j.softx.2015.06.001 (2015). [Google Scholar]
  • 35.Huang, J. et al. CHARMM36m: an improved force field for folded and intrinsically disordered proteins. Nat. Methods14(1), 71–73. 10.1038/nmeth.4067 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zoete, V., Cuendet, M. A., Grosdidier, A. & Michielin, O. SwissParam: a fast force field generation tool for small organic molecules. J. Comput. Chem.32(11), 2359–2368. 10.1002/jcc.21816 (2011). [DOI] [PubMed] [Google Scholar]
  • 37.Bussi, G., Donadio, D. & Parrinello, M. Canonical sampling through velocity rescaling. J. Chem. Phys.10.1063/1.2408420 (2007). [DOI] [PubMed] [Google Scholar]
  • 38.Parrinello, M. & Rahman, A. Polymorphic transitions in single crystals: A new molecular dynamics method. J. Appl. Phys.52(12), 7182–7190. 10.1063/1.328693 (1981). [Google Scholar]
  • 39.Hess, B., Bekker, H., Berendsen, H. J. & Fraaije, J. G. LINCS: a linear constraint solver for molecular simulations. J. Comput. Chem.18(12), 1463–1472 (1997). [Google Scholar]
  • 40.Darden, T., York, D. & Pedersen, L. Particle mesh Ewald: An N⋅ log (N) method for Ewald sums in large systems. J. Chem. Phys.98(12), 10089–10092. 10.1063/1.464397 (1993). [Google Scholar]
  • 41.Case, D. A. et al. Amber 2021: Reference Manual. 10.1021/acs.jcim.3c01531 (2021).
  • 42.Miller, B. R. III. et al. MMPBSA. py: an efficient program for end-state free energy calculations. J. Chem. Theory Comput.8(9), 3314–3321. 10.1021/ct300418h (2012). [DOI] [PubMed] [Google Scholar]
  • 43.Valdés-Tresanco, M. S., Valdés-Tresanco, M. E., Valiente, P. A. & Moreno, E. gmx_MMPBSA: a new tool to perform end-state free energy calculations with GROMACS. J. Chem. Theory Comput.17(10), 6281–6291. 10.1021/acs.jctc.1c00645 (2021). [DOI] [PubMed] [Google Scholar]
  • 44.Chitra, K. C., Latchoumycandane, C. & Mathur, P. P. Effect of nonylphenol on the antioxidant system in epididymal sperm of rats. Arch. Toxicol.77(5), 280–284. 10.1007/s00204-003-0449-4 (2003). [DOI] [PubMed] [Google Scholar]
  • 45.Hemalatha, S. & Banerjee, T. K. Bioaccumulation and toxic effects of nonylphenol in the fish Clarias batrachus: Histopathological and biochemical changes. Environ. Toxicol.27(2), 83–91. 10.1002/tox.20613 (2012).20549643 [Google Scholar]
  • 46.Jortner, B. S. Neuropathological assessment in acute neurotoxic states. The “dark” neuron. J Med CBR Def, 3(3) (2005).
  • 47.Bose, M. J., Ilavazhahan, M., Tamilselvi, R. & Viswanathan, M. Effect of heavy metals on the histopathology of gills and brain of fresh water fish Catla catla. Biomed. Pharmacol. J.6(1), 99–105 (2015). [Google Scholar]
  • 48.Schwaiger, J., Fent, K., Stecher, H., Ferling, H. & Negele, R. D. Effects of sublethal concentrations of triphenyltinacetate on rainbow trout (Oncorhynchus mykiss). Arch. Environ. Contam. Toxicol.30, 327–334 (1996). [Google Scholar]
  • 49.Eisler, R. Lead hazards to fish, wildlife, and invertebrates: a synoptic review (No. 14). US Fish and Wildlife Service, Patuxent Wildlife Research Center (1988).
  • 50.Gordon, J. N., Taylor, A. & Bennett, P. N. Lead poisoning: case studies. Br. J. Clin. Pharmacol.53(5), 451. 10.1046/j.1365-2125.2002.01580.x (2002). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Tandon, S. K. et al. Reversal of cadmium induced oxidative stress by chelating agent, antioxidant or their combination in rat. Toxicol. Lett.145(3), 211–217. 10.1016/s0378-4274(03)00265-0 (2003). [DOI] [PubMed] [Google Scholar]
  • 52.Zhang, Y. M. et al. Heavy metal accumulation and tissue damage in goldfish Carassius auratus. Bull. Environ. Contam. Toxicol.10.1007/s00128-005-0875-9 (2005). [DOI] [PubMed] [Google Scholar]
  • 53.Sarma, K., Pal, A. K., Sahu, N. P., Ayyappan, S. & Baruah, K. Dietary high protein and vitamin C mitigates endosulfan toxicity in the spotted murrel, Channa punctatus (Bloch, 1793). Sci. Total. Environ.407(12), 3668–3673. 10.1016/j.scitotenv.2009.02.031 (2009). [DOI] [PubMed] [Google Scholar]
  • 54.Erhunmwunse, N. O., Ekaye, S. A., Ainerua, M. O. & Ewere, E. E. Histopathological changes in the brain tissue of Africa catfish exposure to glyphosate herbicide. J. Appl. Sci. Environ. Manag.18(2), 275–280 (2014). [Google Scholar]
  • 55.Tongo, I. I. Toxicological studies on the Effects of Agricultural pesticides (Endosulfan and Diazinon) on Adult Bufo regularis (Reuss, 1833). In: Doctoral dissertation, PhD Thesis, University of Benin, 271 (2010).
  • 56.Zatta, P., Lucchini, R., van Rensburg, S. J. & Taylor, A. The role of metals in neurodegenerative processes: aluminum, manganese, and zinc. Brain Res. Bull.62(1), 15–28. 10.1016/s0361-9230(03)00182-5 (2003). [DOI] [PubMed] [Google Scholar]
  • 57.Rizk, M. Z. et al. Possible therapeutic role of grape (Vitis vinifera) leaves polyphenolic extract in the regression of aluminium-induced Alzheimer’s disease in rats. J Mater Environ Sci9(7), 2098–2108 (2018). [Google Scholar]
  • 58.Beltran-Solis, K., García-Mendoza, E., Sánchez-Serrano, S. & López, L. M. Domoic acid affects brain morphology and causes behavioral alterations in two fish species. Sci. Rep.13(1), 21729. 10.1038/s41598-023-49041-0 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Durán, E., Ocana, F. M., Martín-Monzón, I., Rodríguez, F. & Salas, C. Cerebellum and spatial cognition in goldfish. Behav. Brain Res.259, 1–8. 10.1016/j.bbr.2013.10.039 (2014). [DOI] [PubMed] [Google Scholar]
  • 60.Paulin, M. G. The role of the cerebellum in motor control and perception. Brain, Behav. Evol.41(1), 39–50. 10.1159/000113822 (1993). [DOI] [PubMed] [Google Scholar]
  • 61.Sahu, V. K., Karmakar, S., Kumar, S. & Shukla, S. P. Kumar K Triclosan toxicity alters behavioral and hematological parameters and vital antioxidant and neurological enzymes in Pangasianodon hypophthalmus (Sauvage, 1878). Aquat. Toxicol.202, 145–152. 10.1016/j.aquatox.2018.07.009 (2018). [DOI] [PubMed] [Google Scholar]
  • 62.Lushchak, V. I. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol.101(1), 13–30. 10.1016/j.aquatox.2010.10.006 (2011). [DOI] [PubMed] [Google Scholar]
  • 63.Monnet-Tschudi, F., Zurich, M. G., Boschat, C., Corbaz, A. & Honegger, P. Involvement of environmental mercury and lead in the etiology of neurodegenerative diseases. Rev. Environ. Health21(2), 105–118 (2006). [DOI] [PubMed] [Google Scholar]
  • 64.Campos-Shimada, L. B. et al. Superoxide dismutase: a review and a modified protocol for activities measurements in rat livers. Arch. Physiol. Biochem.126(4), 292–299. 10.1080/13813455.2018.1520891 (2020). [DOI] [PubMed] [Google Scholar]
  • 65.Fridovich, I. Superoxide radical: an endogenous toxicant. Annu. Rev. Pharmacol. Toxicol.23(1), 239–257. 10.1146/annurev.pa.23.040183.001323 (1983). [DOI] [PubMed] [Google Scholar]
  • 66.Hong, C. & Ouyang, L. Reactive oxygen species over production and superoxide dismutase exhaustion promoting the intervertebral disc degeneration. Biomed. J. Sci. Tech. Res.16(1), 1–6. 10.26717/BJSTR.2019.16.002801 (2019). [Google Scholar]
  • 67.Li, Z. H. et al. Modulation of antioxidant defence system in brain of rainbow trout (Oncorhynchus mykiss) after chronic carbamazepine treatment. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol.151(1), 137–141. 10.1016/j.cbpc.2009.09.006 (2010). [DOI] [PubMed] [Google Scholar]
  • 68.Whitaker, J. R., Voragen, A. G., & Wong, D. W. (Eds.). Handbook of food enzymology (Vol. 122). CRC Press (2002).
  • 69.Subash, S. & Subramanian, P. Morin a flavonoid exerts antioxidant potential in chronic hyperammonemic rats: a biochemical and histopathological study. Mol. Cell. Biochem.327, 153–161. 10.1007/s11010-009-0053-1 (2009). [DOI] [PubMed] [Google Scholar]
  • 70.Yuan, H. X., Sima, Y. H. & Xu, S. Q. Differential effects of 4-n-nonylphenol on glutathione, glutathione S-transferase, and glutathione peroxidase on gonads in different developmental stages in the Bombyx mori (Lepidoptera: Bombycidae). Ann. Entomol. Soc. Am.106(6), 832–839 (2013). [Google Scholar]
  • 71.Patel, U. N. et al. Assessment of neurotoxicity following single and co-exposure of cadmium and mercury in adult zebrafish: behavior alterations, oxidative stress, gene expression, and histological impairment in brain. Water Air Soil Pollut.232(8), 340. 10.1007/s11270-021-05274-1 (2021). [Google Scholar]
  • 72.Gutierrez-Gomez, A. A. et al. β-Estradiol induced oxidative stress in gill, brain, liver, kidney and blood of common carp (Cyprinus carpio). Electron. J. Biol.12(1), 53–63 (2016). [Google Scholar]
  • 73.Morrow, J. D. et al. Increase in circulating products of lipid peroxidation (F2-isoprostanes) in smokers—smoking as a cause of oxidative damage. N. Engl. J. Med.332(18), 1198–1203. 10.1056/NEJM199505043321804 (1995). [DOI] [PubMed] [Google Scholar]
  • 74.Banerjee, B. D., Seth, V., Bhattacharya, A., Pasha, S. T. & Chakraborty, A. K. Biochemical effects of some pesticides on lipid peroxidation and free-radical scavengers. Toxicol. Lett.107(1–3), 33–47. 10.1016/S0378-4274(99)00029-6 (1999). [DOI] [PubMed] [Google Scholar]
  • 75.Abd-Elkareem, M., Abou Khalil, N. S. & Sayed, A. H. Hepatotoxic responses of 4-nonylphenol on African catfish (Clarias gariepinus): antixoidant and histochemical biomarkers. Fish Physiol. Biochem.44, 969–981. 10.1007/s10695-018-0485-1 (2018). [DOI] [PubMed] [Google Scholar]
  • 76.Aydogan, M., Korkmaz, A., Barlas, N. & Kolankaya, D. The effect of vitamin C on bisphenol A, nonylphenol and octylphenol induced brain damages of male rats. Toxicology249(1), 35–39. 10.1016/j.tox.2008.04.002 (2008). [DOI] [PubMed] [Google Scholar]
  • 77.Mohamed, W. A., El-Houseiny, W., Ibrahim, R. E. & Abd-Elhakim, Y. M. Palliative effects of zinc sulfate against the immunosuppressive, hepato-and nephrotoxic impacts of nonylphenol in Nile tilapia (Oreochromis niloticus). Aquaculture504, 227–238. 10.1111/j.1095-8649.1978.tb03462.x (2019). [Google Scholar]
  • 78.Wu, M., Xu, H., Shen, Y., Qiu, W. & Yang, M. Oxidative stress in zebrafish embryos induced by short-term exposure to bisphenol A, nonylphenol, and their mixture. Environ. Toxicol. Chem.30(10), 2335–2341. 10.1002/etc.634 (2011). [DOI] [PubMed] [Google Scholar]
  • 79.Tabassum, H., Ashafaq, M., Parvez, S. & Raisuddin, S. Role of melatonin in mitigating nonylphenol-induced toxicity in frontal cortex and hippocampus of rat brain. Neurochem. Int.104, 11–26. 10.1016/j.neuint.2016.12.010 (2017). [DOI] [PubMed] [Google Scholar]
  • 80.Desai, J. K. et al. Neurotoxicity of 4-nonylphenol in adult zebrafish: Evaluation of behaviour, oxidative stress parameters and histopathology of brain. Environ. Pollut.334, 122206. 10.1016/j.envpol.2023.122206 (2023). [DOI] [PubMed] [Google Scholar]
  • 81.Aliakbarzadeh, F. et al. Adverse effects of polystyrene nanoplastic and its binary mixtures with nonylphenol on zebrafish nervous system: From oxidative stress to impaired neurotransmitter system. Environ. Pollut.317, 120587. 10.1016/j.envpol.2022.120587 (2023). [DOI] [PubMed] [Google Scholar]
  • 82.Mommsen, T. P., Vijayan, M. M. & Moon, T. W. Cortisol in teleosts: dynamics, mechanisms of action, and metabolic regulation. Rev. Fish Biol. Fisheries9, 211–268 (1999). [Google Scholar]
  • 83.Spiga, F. et al. ACTH-dependent ultradian rhythm of corticosterone secretion. Endocrinology152(4), 1448–1457. 10.1210/en.2010-1209 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Sadoul, B. & Geffroy, B. Measuring cortisol, the major stress hormone in fishes. J. Fish Biol.94(4), 540–555. 10.1111/jfb.13904 (2019). [DOI] [PubMed] [Google Scholar]
  • 85.Davis, K. B., & McEntire, M. Comparison of the cortisol and glucose stress response to acute confinement among white bass, Morone chrysops, striped bass, Morone saxatilis, and sunshine bass, Morone chrysops X Morone saxatilis. J. World Aquac. Soc., 40(4) (2009).
  • 86.Faught, E., Aluru, N. & Vijayan, M. M. The molecular stress response. In Fish Physiology Vol. 35 113–166 (Academic Press, 2016). 10.1016/B978-0-12-802728-8.00004-7. [Google Scholar]
  • 87.Das, C., Thraya, M. & Vijayan, M. M. Nongenomic cortisol signaling in fish. Gen. Comp. Endocrinol.265, 121–127. 10.1016/j.ygcen.2018.04.019 (2018). [DOI] [PubMed] [Google Scholar]
  • 88.Scott, A. P. & Ellis, T. Measurement of fish steroids in water—a review. Gen. Comp. Endocrinol.153(1–3), 392–400. 10.1016/j.ygcen.2006.11.006 (2007). [DOI] [PubMed] [Google Scholar]
  • 89.Satou, M. et al. Telencephalic and preoptic areas integrate sexual behavior in hime salmon (landlocked red salmon, Oncorhynchus nerka): Results of electrical brain stimulation. Physiol. Behav.33, 441–447. 10.1016/00319384(84)90167-7 (1984). [DOI] [PubMed] [Google Scholar]
  • 90.Lovasova, E. & Sesztakova, E. Total antioxidant status–a possible marker of environmental influences on animal organism. Slovak J. Anim. Sci.42(Supplement), 42–45 (2009). [Google Scholar]
  • 91.Limberaki, E. et al. Cortisol levels and serum antioxidant status following chemotherapy. Health3(08), 512. 10.4236/health.2011.38085 (2011). [Google Scholar]
  • 92.Kagawa, N. & Mugiya, Y. Brain HSP70 mRNA expression is linked with plasma cortisol levels in goldfish (Carassius auratus) exposed to a potential predator. Zoolog. Sci.19(7), 735–740. 10.2108/zsj.19.735 (2002). [DOI] [PubMed] [Google Scholar]
  • 93.Carnevali, O. & Maradonna, F. Exposure to xenobiotic compounds: looking for new biomarkers. Gen. Comp. Endocrinol.131(3), 203–208. 10.1016/S0016-6480(03)00105-9 (2003). [DOI] [PubMed] [Google Scholar]
  • 94.Maradonna, F. & Carnevali, O. Vitellogenin, zona radiata protein, cathepsin D and heat shock protein 70 as biomarkers of exposure to xenobiotics. Biomarkers12(3), 240–255. 10.1080/13547500601070859 (2007). [DOI] [PubMed] [Google Scholar]
  • 95.Ribecco, C., Hardiman, G., Šášik, R., Vittori, S. & Carnevali, O. Teleost fish (Solea solea): a novel model for ecotoxicological assay of contaminated sediments. Aquat. Toxicol.109, 133–142. 10.1016/j.aquatox.2011.12.0025 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Moon, B. H. et al. A single administration of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin that produces reduced food and water intake induces long-lasting expression of corticotropin-releasing factor, arginine vasopressin, and proopiomelanocortin in rat brain. Toxicol. Appl. Pharmacol.233(2), 314–322. 10.1016/j.taap.2008.09.001 (2008). [DOI] [PubMed] [Google Scholar]
  • 97.Wang, H., Yang, X., Zhang, Z. & Xu, H. Both calcium and ROS as common signals mediate Na2SeO3-induced apoptosis in SW480 human colonic carcinoma cells. J. Inorg. Biochem.97(2), 221–230. 10.1016/s0162-0134(03)00284-8 (2003). [DOI] [PubMed] [Google Scholar]
  • 98.Kotb, A. M., Abd-Elkareem, M., Abou Khalil, N. S. & Sayed, A. E. D. H. Protective effect of Nigella sativa on 4-nonylphenol-induced nephrotoxicity in Clarias gariepinus (Burchell, 1822). Sci. Total. Environ.619, 692–699. 10.1016/j.scitotenv.2017.11.131 (2018). [DOI] [PubMed] [Google Scholar]
  • 99.Banks, W. A. Physiology and pathology of the blood-brain barrier: implications for microbial pathogenesis, drug delivery and neurodegenerative disorders. J. Neurovirol.5(6), 538–555. 10.3109/13550289909021284 (1999). [DOI] [PubMed] [Google Scholar]
  • 100.Cserr, H. F. & Bundgaard, M. Blood-brain interfaces in vertebrates: a comparative approach. Am. J. Physiol.-Regul., Integr. Comp. Physiol.246(3), R277–R288. 10.1152/ajpregu.1984.246.3.R277 (1984). [DOI] [PubMed] [Google Scholar]
  • 101.Toimela, T. & Tahti, H. Mitochondrial viability and apoptosis induced by aluminum, mercuric mercury and methylmercury in cell lines of neural origin. Arch. Toxicol.78, 565–574. 10.1007/s00204-004-0575-y (2004). [DOI] [PubMed] [Google Scholar]
  • 102.Yokel, R. A. Aluminum chelation principles and recent advances. Coord. Chem. Rev.228(2), 97–113 (2002). [Google Scholar]
  • 103.Abbott, N. J., Patabendige, A. A., Dolman, D. E., Yusof, S. R. & Begley, D. J. Structure and function of the blood–brain barrier. Neurobiol. Dis.37(1), 13–25. 10.1016/j.nbd.2009.07.030 (2010). [DOI] [PubMed] [Google Scholar]
  • 104.Hurley, P. J. & Bunz, F. ATM and ATR: components of an integrated circuit. Cell Cycle6(4), 414–417. 10.4161/cc.6.4.3886 (2007). [DOI] [PubMed] [Google Scholar]
  • 105.Yin, H., Xu, L. & Porter, N. A. Free radical lipid peroxidation: mechanisms and analysis. Chem. Rev.111(10), 5944–5972. 10.1021/cr200084z (2011). [DOI] [PubMed] [Google Scholar]
  • 106.Stadtman, E. R. & Levine, R. L. Free radical-mediated oxidation of free amino acids and amino acid residues in proteins. Amino Acids25, 207–218. 10.1007/s00726-003-0011-2 (2003). [DOI] [PubMed] [Google Scholar]
  • 107.Gong, Y. & Han, X. D. Nonylphenol-induced oxidative stress and cytotoxicity in testicular Sertoli cells. Reprod. Toxicol.22(4), 623–630. 10.1016/j.reprotox.2006.04.019 (2006). [DOI] [PubMed] [Google Scholar]
  • 108.Okai, Y. et al. Protective effect of antioxidants against para-nonylphenol-induced inhibition of cell growth in Saccharomyces cerevisiae. FEMS Microbiol. Lett.185(1), 65–70. 10.1111/j.1574-6968.2000.tb09041.x (2000). [DOI] [PubMed] [Google Scholar]
  • 109.Okai, Y., Sato, E. F., Higashi-Okai, K. & Inoue, M. Effect of endocrine disruptor para-nonylphenol on the cell growth and oxygen radical generation in Escherichia coli mutant cells deficient in catalase and superoxide dismutase. Free. Radic. Biol. Med.37(9), 1412–1418. 10.1016/j.freeradbiomed.2004.07.001 (2004). [DOI] [PubMed] [Google Scholar]
  • 110.Okai, Y., Sato, E. F., Higashi-Okai, K. & Inoue, M. Enhancing effect of the endocrine disruptor para-nonylphenol on the generation of reactive oxygen species in human blood neutrophils. Environ. Health Perspect.112(5), 553–556. 10.1289/ehp.6584 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Ahel, M., McEvoy, J. & Giger, W. Bioaccumulation of the lipophilic metabolites of nonionic surfactants in freshwater organisms. Environ. Pollut.79(3), 243–248. 10.1016/0269-7491(93)90096-7 (1993). [DOI] [PubMed] [Google Scholar]
  • 112.Ali, T. et al. Genotoxicity and repair capability of Mus musculus DNA following the oral exposure to Tramadol. Saudi J. Biol. Sci.27(1), 12–17. 10.1016/j.sjbs.2019.03.008 (2020). [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 113.Halm, S. et al. Exposure to exogenous 17β-oestradiol disrupts P450aromB mRNA expression in the brain and gonad of adult fathead minnows (Pimephales promelas). Aquat. Toxicol.60(3–4), 285–299. 10.1016/S0166-445X(02)00011-5 (2002). [DOI] [PubMed] [Google Scholar]
  • 114.Noaksson, E., Linderoth, M., Bosveld, A. T. & Balk, L. Altered steroid metabolism in several teleost species exposed to endocrine disrupting substances in refuse dump leachate. Gen. Comp. Endocrinol.134(3), 273–284. 10.1016/S0016-6480(03)00267-3 (2003). [DOI] [PubMed] [Google Scholar]
  • 115.Gelinas, D., Pitoc, G. A. & Callard, G. V. Isolation of a goldfish brain cytochrome P450 aromatase cDNA: mRNA expression during the seasonal cycle and after steroid treatment. Mol. Cell. Endocrinol.138(1–2), 81–93. 10.1016/S0303-7207(98)00015-X (1998). [DOI] [PubMed] [Google Scholar]
  • 116.Gonzalez, A. & Piferrer, F. Aromatase activity in the European sea bass (Dicentrarchus labrax L.) brain. Distribution and changes in relation to age, sex, and the annual reproductive cycle. Gen. Comp. Endocrinol.132(2), 223–230. 10.1016/S0016-6480(03)00086-8 (2003). [DOI] [PubMed] [Google Scholar]
  • 117.Pettersen, E. F. et al. UCSF Chimera—a visualization system for exploratory research and analysis. J. Comput. Chem.25(13), 1605–1612. 10.1002/jcc.20084 (2004). [DOI] [PubMed] [Google Scholar]
  • 118.Kah, O. & Dufour, S. Conserved and divergent features of reproductive neuroendocrinology in teleost fishes. In Hormones and Reproduction of Vertebrates 15–42 (Academic Press, 2011). 10.1016/B978-0-12-375009-9.10002-5. [Google Scholar]
  • 119.Chaube, R., Sharma, S., Senthilkumaran, B., Bhat, S. G. & Joy, K. P. Expression profile of kisspeptin2 and gonadotropin-releasing hormone2 mRNA during photo-thermal and melatonin treatments in the female air-breathing catfish Heteropneustes fossilis. Fish Physiol. Biochem.46, 2403–2419. 10.1007/s10695-020-00888-4 (2020). [DOI] [PubMed] [Google Scholar]
  • 120.Chaube, R., Rawat, A. & Joy, K. P. Molecular cloning and characterization of brain and ovarian cytochrome P450 aromatase genes in the catfish Heteropneustes fossilis: Sex, tissue and seasonal variation in, and effects of gonadotropin on gene expression. Gen. Comp. Endocrinol.221, 120–133. 10.1016/j.ygcen.2015.06.004 (2015). [DOI] [PubMed] [Google Scholar]
  • 121.Suman, Gaurav, P., Joshi, M., Chaube, R. & Jiwatram, G. G. Toxicogenomic profiling of endocrine disruptor 4-Nonylphenol in male catfish Heteropneustes fossilis with respect to gonads. Sci. Rep.15(1), 14307. 10.1038/s41598-025-92226-y (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Material 1 (306.5KB, pdf)

Data Availability Statement

All data supporting the findings of this study will be available upon request and the datasets generated and/or analysed during the current study are available in the name i.e.,AChE of *Danio rerio* and its UniProt id [**Q9DDE3**](https:/www.uniprot.org/uniprotkb/Q9DDE3/entry).


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES