Skip to main content
PLOS Neglected Tropical Diseases logoLink to PLOS Neglected Tropical Diseases
. 2026 Feb 13;20(2):e0013890. doi: 10.1371/journal.pntd.0013890

Xenopsylla buxtoni fleas as a dominant species harboring multiple infections of Wolbachia lineages in the ancient plague epicenters of Iran

Shahin Seidi 1,2, Ehsan Mostafavi 1,2, Abbasali Raz 3, Fateh Karimian 4, Fariba Khanzadeh 5, Zeynab Hayati 4, Naseh Maleki-Ravasan 4,*
Editor: Rui Qi6
PMCID: PMC12904580  PMID: 41686866

Abstract

Fleas are permissive and euryxenous ectoparasites capable of transmitting numerous ancient and new pathogens among warm-blooded animals, including humans. Precise identification of flea species involved in disease transmission and understanding the highly specialized morphological characteristics associated with their ectoparasitic lifestyle is essential. Likewise, identifying endosymbionts such as Wolbachia—which have long-lasting and intimate relationships with their hosts—will enhance our knowledge of the epidemiology of flea-borne diseases and their control. Flea sampling was conducted in the western half of Iran, where the highest plague outbreaks have been reported over the past two centuries. A total of 1,439 fleas, comprising 623 males and 816 females, were detached from 223 hosts and were identified as Xenopsylla buxtoni, X. nuttalli, X. astia, Pulex irritans, Nosopsyllus iranus iranus, and Ctenophthalmus rettigi smiti. Also, 116 and 73 nucleotide sequences were analyzed to assess the genetic diversity and phylogenetic position of the fleas, and to determine their infection rate and Wolbachia supergroup. Molecular analysis of the COII and ITS2 genes confirmed the morphological distinctiveness of the six species. Xenopsylla buxtoni, the most abundant taxon, displayed Wolbachia infection rates of 62%-75% (x̄ = 69%). The Wolbachia sequences identified from the fleas were assigned to supergroups A, F, and B. The taxonomic position of X. buxtoni and its closely related species, X. nuttalli, in the conformis group was questioned due to significant genetic divergence. The impact of Wolbachia on flea ecology and its potential impact in controlling flea populations and flea-borne pathogens was highlighted.

Author summary

Fleas are important vectors of zoonotic diseases, including plague caused by Yersinia pestis. We investigated flea diversity and the presence of Wolbachia endosymbionts in western Iran—a region with a long history of plague outbreaks. Among 1,439 fleas collected from 223 hosts, six species were identified, with Xenopsylla buxtoni being the most common and showing high Wolbachia infection rates (62%–75%). Phylogenetic analysis revealed the presence of multiple Wolbachia supergroups (A, B, F), challenging existing assumptions about flea–symbiont co-evolution. We also observed significant genetic divergence between X. buxtoni and the closely related X. nuttalli, suggesting possible cryptic species that could complicate plague surveillance. Our findings highlight the ecological role of Wolbachia in fleas and its potential for use in targeted biocontrol strategies to reduce disease transmission. This study underscores the need to integrate symbiont-focused research into public health initiatives, particularly in plague-endemic areas.

Introduction

Fleas (Siphonaptera) are blood-sucking, laterally compressed ectoparasites that can infest a wide range of hosts, including humans, due to their jumping ability. Fleas as solenophagous (vessel feeder) insects, can directly damage their host’s blood vessels and, more importantly, spread various pathogens via the oral route through regurgitation of blood meals or the fecal route by fecal pellets [1,2]. Because of their morphological adaptations, ecological plasticity, and global distribution [3,4], fleas play significant and effective roles as vectors for several human diseases, including plague, murine typhus, flea-borne spotted fever, and cat scratch disease, which are caused by Y. pestis, Rickettsia typhi, R. felis, and Bartonella henselae, respectively. They also serve as intermediate hosts for tapeworms of Dipylidium caninum, Hymenolepis nana, and H. diminuta [2]. Because competent vectors and reservoir hosts persist in endemic areas, understanding flea biodiversity and the factors affecting their vectorial capacity is critical for public health surveillance and disease control.

Fleas comprise over 2,600 documented species globally [5], and their precise identification is critical due to their role as vectors of zoonotic pathogens. Traditional taxonomy has relied on morphological traits such as genital structures, setae, spines, ctenidia, and other diagnostic features [611], but this approach is often challenging—particularly in females—due to subtle variations in key structures and a high degree of morphological specialization linked to their ectoparasitic lifestyle [12,13]. To overcome these limitations, molecular markers have increasingly been integrated into flea systematics. Commonly used insect phylogenetic markers—including cytochrome c oxidase subunits I and II (COI and COII), 12S and 16S ribosomal DNA (rDNA), 18S and 28S rDNA, internal transcribed spacer (ITS), and EF-1a [1324], offer valuable tools for refining species boundaries. The ITS2 region exhibits considerable interspecific variability due to its high evolutionary rate [25], whereas COII shows strong concordance with morphological data in resolving phylogenetic relationships [23].

Endosymbiont are microbes that live inside hosts and maintain in long-term, intimate relationships with these microorganisms—may influence various aspects of host biology and behavior [26,27]. Wolbachia, a prominent intracellular bacterium, significantly impacts reproductive traits such as cytoplasmic incompatibility, male killing, feminization, and parthenogenesis. It al so contributes to fitness and lifespan, and plays roles in protect against biotic and abiotic stresses, immune hemostasis, host selection and mating behaviors, pathogen transmission capabilities, and host ecology and evolution [2832]. Wolbachia is primarily an endosymbiotic bacterium prevalent in insects; however, it is also found in other arthropods and nematodes. Despite their genetic diversity, all known strains are currently classified within the species Wolbachia pipientis and are grouped into 16–21 major clades—referred to as supergroups—based on genetic characteristics identified in various studies [33]. Supergroups A and B are common in arthropods, while supergroups C, D, and J are specific to nematodes. Supergroup F is mainly found in nematodes but can also be observed in some terrestrial arthropods [34].

With the established background, it is evident that fleas and their associated Wolbachia bacteria serve as a valuable model for investigating the interplay between these microorganisms and their hosts. Wolbachia is highly prevalent in flea populations [35], indicating its significant potential to influence flea reproductive success and, consequently, the transmission of flea-borne diseases. The detection of these three supergroups (A, B, and F) in flea species provides insight into the complex evolutionary history and ecological interactions of Wolbachia within their flea hosts and potentially their rodent reservoirs. While numerous factors are known to influence flea reproductive ecology (e.g., body size, age, and host density), the role of Wolbachia has been largely overlooked, particularly in feral flea populations. Understanding how Wolbachia influences flea biology and pathogen transmission could inform future vector surveillance and pave the way for Wolbachia-based biocontrol strategies, though targeted research is needed to validate these applications.

Fleas, with 119 species and subspecies in Iran [3639], pose a significant public health concern serving as vectors for various zoonotic diseases. The Pulicidae family, particularly the genus Xenopsylla, dominates the Iranian flea fauna and, along with other fleas, has been responsible for plague outbreaks in in past centuries [40]. During these outbreaks, the primary reservoirs and vectors were not always clearly identified or described. In the present study, hosts considered include rodents such as Meriones persicus and Microtus arvalis, which are known plague reservoirs, as well as foxes, which are also recognized as potential hosts and reservoirs in endemic areas. Given the continued presence of competent vectors and reservoir hosts in these regions, the risk of plague and other zoonotic diseases persists. A thorough understanding of flea biodiversity, the challenges in their morphological identification, and the potential impact of symbionts such as Wolbachia is therefore critical for enhancing surveillance and developing effective biocontrol strategies.

This study aimed to investigate the genetic diversity and phylogenetic relationships of key flea species in Iran’s ancient plague foci and to characterize their associations with Wolbachia endosymbionts. We used the nuclear ITS2 and mitochondrial COII markers to assess genetic structure within and among flea taxa and to evaluate its congruence with morphological characteristics and geographic origin. Additionally, we analyzed Wolbachia-specific genes (wsp, groEL, and gatB) to determine infection prevalence and assign bacterial strains to supergroups.

We hypothesized that (i) flea community composition and genetic structure differ between plague-endemic and non-endemic regions, (ii) Wolbachia prevalence and strain diversity vary among flea species and geographic locations, and (iii) patterns of Wolbachia infection are associated with the distribution of flea species. By integrating phylogenetic, genetic, and infection data across spatially distinct sites, this study aims to advance our understanding of flea bioecology, elucidate the potential role of Wolbachia in vector dynamics, and evaluate the feasibility of Wolbachia-based strategies for vector control.

Materials and methods

Ethics statement

The study procedure has been reviewed and approved by the Ethics Committee of the Pasteur Institute of Iran, Tehran (ethical code: IR.PII.REC.1400.047). All animal procedures were conducted in accordance with the European Community Directive 2010/63/EU on the protection of animals used for scientific purposes.

Description of study areas and specimen collection

Flea sampling was focused on the western half of Iran, where the highest outbreaks of plague have been reported over the past two centuries [41]. The most significant outbreak occurred in the Kurdistan region, where three forms of the plague—pneumonic, bubonic, and septicemic—were recorded. During the sylvatic outbreak of 1829–1833, Meriones spp. and their fleas were identified as the reservoir and vector hosts of the plague, respectively [4244]. This study selected 28 locations across 10 villages to trap rodents and collect their fleas, covering both the historical focus and neighboring villages (Fig 1). Another plague outbreak occurred in 1966 in Seyed-abad, southwest of Bukan in the West Azerbaijan Province of the country. Although the vector flea and reservoir host of the disease were not identified during this outbreak, evidence suggests the presence of the bubonic form of the disease [45]. Fifteen locations from two villages were selected for flea investigation in this focus (Fig 1). The third major outbreak of the plague occurred in various villages west of Sarab in East Azerbaijan Province in 1976. No human cases were reported during that outbreak; however; the circulation of fourteen isolates of Y. pestis had been confirmed in the foxes and rodents through their fleas [46]. Nineteen locations from four villages were selected for the flea survey in this focus (Fig 1). Additionally, five locations in the Tello region of Northeastern Tehran Province, central Iran, were chosen as control areas. While no plague outbreaks have been reported, this region has undergone significant environmental changes in recent years [47] (Fig 1). Specimens from Bushehr Province (Borazjan) in Southwestern Iran, which has a warm climate and a history of numerous plague outbreaks, were selected for comparison [41] (Fig 1). Live wooden traps were set adjacent to rodent burrows at dusk and monitored each morning for three consecutive days. Rodents were captured using Sherman live traps a standard technique in small mammal field studies [48]. GPS coordinates were recorded for all sampling points. Sampling was conducted from April to September 2022, coinciding with favorable weather conditions, peak rodent activity, and heightened flea abundance, across the 67 specified locations. After a vehicle collision, a dead red fox found on Akanlu Road in the Shirin Su District, Kabudarahang County, Hamadan Province, was also included in the sampling. The traps were checked on consecutive days, and the trapped specimens were transferred to a flat, shaded, wind- and stress-free area away from human habitation for flea collection. Rodents were restrained by their ears and tails using two long forceps, and fleas were gathered from their bodies by blowing into the hair of the captured animals over a tray of clean water [49]. Fleas were immediately collected from the water and preserved in 70% ethanol within sterile Eppendorf tubes. After flea collection, all rodents were safely released back into their natural habitats.

Fig 1. A map of flea sampling locations indicating areas of plague occurrence (East and West Azerbaijan, Hamadan, Bushehr Provinces) and non-occurrence (Tehran Province) in Iran (https://www.amar.org.ir).

Fig 1

Morphological identification of mammals and fleas

The genus and species of the captured rodents were determined based on standard external morphological characteristics, including color, head and body length, ear length, tail length, hind leg length, and dental features [50]. Fleas detached from each host and location were divided into two groups. The first group was employed for morphological identification, while the second group was utilized for molecular analyses, including flea phylogeny and the investigation of Wolbachia bacterial infection. The fleas in the first group were mounted with Pouri’s solution on microscope slides. The specimens were carefully examined morphologically under a light microscope (Olympus SZ40, Olympus Corporation, Tokyo, Japan) and identified with the help of a valid taxonomic key for Iranian fleas [5154]. Key diagnostic morphological features of each specimen were photographed for documentation.

Molecular survey of fleas and their Wolbachia infection

For molecular identification and phylogenetic analysis, one flea per species per sampling location was selected, yielding a total of 58 individual specimens for analysis based on mitochondrial COII and nuclear ITS2 gene sequences. For Wolbachia screening, up to eight fleas—comprising four males and four females where possible—were randomly selected per location and flea species, resulting in 102 total specimens screened using three Wolbachia-specific markers: wsp, groEL, and gatB. Fleas were chosen randomly from the pool of collected individuals while ensuring representation across host species and geographical sites, to minimize sampling bias and maximize coverage of flea-host-environment interactions. After superficially rinsing the fleas with alcohol 70% and centrifugation, the alcohol-free specimens were ground using a disinfected metal pestle, and total DNA was extracted from the fleas using the Sambio DNA extraction kit (South Korea; Lot: 17F19-16), following the manufacturer’s instructions. PCR amplification of molecular markers targeting flea phylogeny and Wolbachia infection was conducted using the primers and thermal conditions listed in Table 1, utilizing a Quants Biotech QB-96 thermal cycler. PCR was carried out in a total volume of 25 μL, which included 1–2 μL of DNA extract (~0.1 μg), 12.5 μL of 2 × Taq DNA Polymerase Master Mix RED (Ampliqon, Denmark), 1 μL of each primer (10 mM), and 8.5-9.5 μL of sterile water. All markers were amplified using conventional PCR, but wsp was amplified by semi-nested PCR, as explained before in detail [5562]. In all PCR assays, both positive and negative controls were included in each run to ensure the reliability and specificity of the amplification. The PCR products were visualized on 1.5% agarose gels stained with GreenViewer and documented using a UV transilluminator. The successful amplicons were purified and subsequently subjected to bidirectional Sanger sequencing by Genomin Company (Tehran, Iran).

Table 1. PCR primer sequences and thermal conditions used for the molecular systematics of fleas and determination of their Wolbachia/ filarial infection.

Marker Primer name Sequence (5′- 3′) Amplicon size (bp) Thermal conditions Reference
COII F-leu

R-lys
TCT AAT ATG GCA GAT TAG TGC

GAG ACC AGT ACT TGC TTT CAG TC
780 bp one cycle of 5 min at 95°C, 35 cycles of 30 sec at 94°C, 30 sec at 55°C, and 30 sec at 72°C, with a final step of 5 min at 72°C. [55]
ITS2 ITS2D

ITS2R
CAC TGC GCT CGT GGA TCT AT

TTT AGG GGG TAG TCT CAC CTG
480 bp one cycle of 5 min at 94°C, 33 cycles of 30 sec at 94°C, 30 sec at 48°C, and 30 sec at 72°C, with a final step of 7 min at 72°C. [60]
wsp 81F

691R

183F
TGG TCCA ATAAGTGATGAAGAAAC

AAAAATTAAACGCTACTCCA

AAGGAACCG AAGTTCATG
632 bp one cycle of 5 min at 95°C, 35 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C, with a final step of 7 min at 72°C. [56]
groEL groEL-F

groEL-R
GGTGAGCAGTTRCARSAAGC TARCCRCGRTCAAAYTGCATRCCA 491 bp one cycle of 3 min at 94°C, 38 cycles of 30 sec at 94°C, 30 sec at 50°C, and 30 sec at 72°C, with a final step of 10 min at 72°C. [57]
gatB gatB F1

gatB R1
GAKTTAAAYCGYGCAGGBGTT

TGGYAAYTCRGGYAAAGATGA
497 bp one cycle of 3 min at 94°C, 37 cycles of 30 sec at 94°C, 45 sec at 48°C, and 90 sec at 72°C, with a final step of 7 min at 72°C. [58]
5.8S-18S UNI-1R

FIL-1F
CGCAGCTAGCTGCGTTCTTCATCG

GTGCTGTAACCATTACCGAAAGG
712-771 bp nest-one: one cycle of 7 min at 94°C, 40 cycles of 20 sec at 94°C, 20 sec at 60°C, and 30 sec at 72°C, with a final step of 10 min at 72°C. [59]
18S rDNA-ITS1 FIL-2F

FIL-2R
GGTGAACCTGCGGAAGGATC

TGCTTATTAAGTCTACTTAA
286-344 bp nest-two: one cycle of 7 min at 94°C, 35 cycles of 20 sec at 94°C, 20 sec at 50°C, and 20 sec at 72°C, with a final step of 10 min at 72°C. [59]

Survey of filarial nematodes associated with fleas

Screening for potential filarial nematode infections in fleas was conducted using PCR with primers designed by Tang et al., [59] targeting the 18S rDNA-ITS1 nuclear marker—a region commonly used in filarial diagnostics. The PCR protocol followed the methodology described by Khanzadeh et al [63,64]. Only samples that tested positive for Wolbachia supergroup F were included in the screening, as members of this Wolbachia supergroup are known endosymbionts of certain filarial nematodes. Primer sequences and PCR conditions are detailed in Table 1.

Sequence and phylogenetic analyses

A total of 116 nucleotide sequences were analyzed to assess flea genetic diversity and phylogenetic relationships, derived from 58 individual fleas (each sequenced for both mitochondrial COII and nuclear ITS2 markers). For Wolbachia screening, 73 sequences were generated from 102 flea specimens screened, representing successful amplifications of one or more of the three Wolbachia genes (wsp, groEL, and gatB). These sequences were used independently to investigate the genetic diversity of Iranian flea populations and were combined with sequences retrieved from GenBank to reconstruct phylogenetic trees. The quality of the raw sequence data was initially verified using Chromas 2.6.6 software (Technelysium Pty Ltd., South Brisbane, Australia). BLAST (Basic Local Alignment Search Tool) searches were performed against the GenBank database to compare under-investigated sequences. Multiple sequence alignments were generated using the MUSCLE program embedded in MEGA X software [65]. Basic sequence statistics, including polymorphic and parsimony-informative sites (i.e., alignment positions with at least two nucleotide states, each occurring in two or more sequences), were analyzed using the Sequence Data Explorer tool within the MEGA X software. Inter- and intra-taxa divergences for the COII and ITS2 genes were estimated using the Kimura Two-Parameter (K2P) distance model within MEGA X [65]. Phylogenetic relationships were inferred using the Maximum Likelihood (ML) method with K2P correction models implemented in MEGA X. Bootstrap support (BS) assessed internal node confidence with 1,000 replicates. The sequences acquired in this study have been deposited in the GenBank database.

Results

Morphological identification of mammals and fleas

A total of 223 mammals were examined from the endemic plague foci in the Provinces of East Azerbaijan (Sarab), West Azerbaijan (Seyd-abad), Hamadan (Akanlu), and non-endemic northeast of Tehran (Tello) (Fig 1). The animals comprised 222 rodents, especially Meriones persicus (n = 210) and Microtus arvalis (n = 12), and one fox (Vulpes vulpes). All examined mammals harbored fleas, except for six M. arvalis. Additionally, this study included two previously collected specimens of X. astia from M. persicus in Bushehr (Borazjan). In total, 1,439 fleas were collected, consisting of 623 males and 816 females. These fleas taxonomically belonged to six species: X. buxtoni (n = 1,169), X. nuttalli (n = 171), X. astia (n = 2), P. irritans (n = 54), N. iranus iranus (n = 40), and C. rettigi smiti (n = 3), representing four genera and three families (Pulicidae, Ceratophyllidae, and Ctenophthalmidae). Table 2 presents detailed information on the flea species, including their abundance, host species, sampling locations, and other relevant data. All collected flea species displayed the expected morphological characteristics for their respective taxa. The diagnostic features of males and females of the six species— X. buxtoni, X. nuttalli, X. astia, N. iranus iranus, P. irritans, and C. rettigi smiti—are illustrated in Figs A-F in S1 Text, which were photographed under a microscope [5154].

Table 2. Data on the fleas under study including their number, taxonomy, sex, host, sampling location, and Wolbachia infection rates with different markers.

Sampling sites Host Species Total (M, F) No. of sequences determined for each marker No. Wolbachia⁺ (F, M)/ Total Tested Wolbachia prevalence (%)
Plague-endemic COII ITS2 Wsp gatB groEL
Hamedan (Akanlu) Vulpes vulpes

(n = 1)
P. irritans 54 (22,32) 1 1 7 7 8 (6,4) 10/13 77%
Meriones persicus

(n = 64)
X. buxtoni 481 (224,257) 19 19 7 4 5 (9,7) 16/23 70%
Microtus arvalis

(n = 3)
0 0 0 0 0 0 0 0
Meriones persicus

(n = 9)
N. iranus iranus 19 (12,7) 2 2 1 1 (1,1) 2/5 40%
West Azerbaijan

(Seyed-Abad)
Meriones persicus

(n = 54)
X. buxtoni 317 (145,172) 13 14 3 2 4 (7,6) 13/21 62%
East Azerbaijan

(Sarab)
Meriones persicus

(n = 25)
X. buxtoni 172 (62,110) 6 6 2 3 3 (5,4) 9/12 75%
Microtus arvalis

(n = 1)
0 0 0 0 0 0 0 0
Meriones persicus

(n = 17)
X. nuttalli 171 (77,94) 7 7 4 2 2 (4,1) 5/9 56%
Meriones persicus

(n = 12)
N. iranus iranus 17 (4,13) 1 1 1 1 (1,0) 1/3 33%
Microtus arvalis

(n = 6)
C. rettigi smiti 3 (1,2) 1 1 0/1 0
Bushehr

(Borazjan)
Meriones persicus

(n = 1)
X. astia 1 (0,1) 1 1 0/1 0
Non-endemic
Tehran (Tello) Meriones persicus

(n = 26)
X. buxtoni 199 (73,126) 5 5 1 2 3 (6,3) 9/12 75%
Microtus arvalis

(n = 2)
0 0 0 0 0 0 0 0
Meriones persicus

(n = 2)
N. iranus iranus 4 (2,2) 1 1 0/2 0
Total (5) 223 6 1439 (623,816) 58 58 26 21 26 (39,26) 65/102 64%

Abbreviations: M and F stand for male and female specimens.

Molecular identification of fleas

DNA sequences of six morphologically identified flea species were successfully amplified and sequenced for the COII (~780 bp) and ITS2 (~480 bp) markers from 58 locations. The resulting sequences have been deposited in the GenBank under the accession numbers OR059306-OR059362 and OR939694 for COII and also OR081769-OR081825 and PQ164822 for ITS2 Table A in S1 Text). Analysis of the COII sequences revealed 224 (34%) polymorphic sites (i.e., nucleotide positions showing more than one variant among flea samples), of which 151 (23%) were parsimony-informative. There were also 188 (39%) polymorphic sites, with 60 (22%) being parsimony-informative in the ITS2 gene sequences. Multiple sequence alignments of COII of the sequences for X. buxtoni revealed nucleotide polymorphisms. In Tello, a T to C substitution was observed at position 167 in some populations. In Hamadan, multiple substitutions were observed: T to A at position 126, T to C at position 179, and T to A at position 309. In Sarab, no nucleotide variations were detected; however, in Bukan, a T to C substitution occurred at position 296 in some individuals. Despite these nucleotide substitutions, no changes in the translated protein sequences were observed at the amino acid level, resulting in 100% intraspecific amino acid similarity among the analyzed X. buxtoni populations. Furthermore, in X. nuttalli from Sarab, a T to C substitution at position 678 was observed, but this replacement did not result in any amino acid changes, maintaining 100% intraspecific amino acid similarity. In contrast, in N. iranus iranus from Sarab, a T to C substitution at position 386 led to an amino acid change from isoleucine to valine. BLAST analysis of X. buxtoni sequences revealed 92.31% similarity to X. gerbilli minax (KU880673) and 92.01% to X. conformis conformis (MF136073). Interestingly, X. nuttalli sequences demonstrated 99.56% similarity to X. conformis conformis (MF136073). X. astia sequences exhibited 92.12% similarity to X. gerbilli minax (KU880673) and 92.09% to X. conformis conformis (MF136073). P. irritans sequences displayed 100% resemblance and query coverage with a similar sequence within the species (LR991748). C. rettigi smiti sequences showed the highest similarity (97.14%) to C. agyrtes (KM890873). Additionally, N. iranus iranus sequences showed 95.64% similarity to N. laeviceps laeviceps (PP838812) (Table B in S1 Text). Multiple sequence alignments of the ITS2 gene of X. buxtoni from four locations, X. nuttalli from different stations in Sarab, and N. iranus iranus from three study locations did not reveal any intraspecific divergence. BLAST analysis of the ITS2 marker from the six studied flea species revealed a diverse range of results. The sequences of X. buxtoni exhibited 83.02% similarity to Synopsyllus fonquernii and 90.50% similarity to X. cheopis (DQ295059). The sequences of X. nuttalli demonstrated 100% identity with X. nuttalli (OR769686), while those of X. astia exhibited 82.18% similarity to X. cheopis (DQ295059). Sequences of P. irritans displayed 99.77% similarity to a sequence within the same species (KX982861). The sequences of N. iranus iranus exhibited 98.17% similarity to N. barbarus (LT703445) and 94.69% to Citellophilus sparsilis (AY072641). The sequences of C. rettigi smiti exhibited 80.95% similarity to both C. apertus allani (LR594433) and C. baeticus boisseauorum (LR594433) (Table B in S1 Text).

Genetic distance between studied fleas

Molecular analysis of the COII and ITS2 genes confirmed the morphological distinctiveness of three Xenopsylla species: X. buxtoni, X. nuttalli, and X. astia. These findings further supported the separation of Xenopsylla species from P. irritans. The analysis revealed significant genetic distances between Xenopsylla species and representatives of other families, namely N. iranus iranus (Ceratophyllidae) and C. rettigi smiti (Ctenophthamidae), corroborating the observed morphological differences. COII gene sequence similarity among the six species investigated ranged from 70.5% to 98.5%. Notably, while X. buxtoni demonstrated the highest COII sequence similarity with X. astia, its morphological affinities were aligned more closely with X. nuttalli. Furthermore, the most significant genetic divergence based on COII was observed between X. nuttalli and C. rettigi smiti (Table C in S1 Text and Fig 2). ITS2 gene sequence similarity among the six studied flea species ranged from 80.8% to 84.8%. The highest genetic similarity was observed between X. buxtoni and X. nuttalli, consistent with their close morphological resemblance. Additionally, the highest genetic divergence was observed between X. astia and P. irritans (Table D in S1 Text and Fig 2).

Fig 2. Sequence similarity of six flea species and their infecting Wolbachia based on COII/ITS2 and wsp/groEL/gatB markers.

Fig 2

Comparisons were highlighted with distinct colors to facilitate the tracing of relationships (Original image by the authors).

Phylogenetic analysis of fleas

An ML phylogenetic tree was reconstructed based on the COII gene, including 30 species representing five genera and four families within the order Siphonaptera. The six flea species studied were accurately placed within their respective lineages, supported by high bootstrap values (Bootstrap Support: 97–100%). Even at the subspecies level, ML analyses strongly supported the monophyly of N. iranus iranus and C. rettigi smiti, both with a BS > 95%. At the genus level, all four genera—Pulex, Xenopsylla, Nosopsyllus, and Ctenophthalmus—were correctly identified as polyphyletic. The family Pulicidae (BS = 68%), which includes Pulex and Xenopsylla as sister groups, was supported as monophyletic. The family Ceratophyllidae, which contains Nosopsyllus, was found to be the sister group of the Ctenophthalmidae clade, which includes Ctenophthalmus (Fig 3).

Fig 3. A maximum likelihood tree deduced from 566 bp of the COII gene, offering the phylogenetic position of flea taxa under study, alongside other sequences retrieved from the GenBank.

Fig 3

The colors indicate the different statuses of the species in each genus. Only eleven representatives of the 58 sequences determined in this study (solid circles) were included in the tree. Three sequences of Tunga penetrans (DQ844696), Tunga trimamilata (AY425827), and Tunga libis (EU336014) were set as outgroups. Bootstrap Support (BS) values (1,000 replicates) are shown at nodes as percentages. Clades with BS ≥ 70% are considered well-supported.

The phylogenetic analysis based on the ITS2 gene (Fig 4) included 23 species, representing six genera and four families within the Siphonaptera. At the subspecies level, ML analyses strongly supported the monophyly of N. iranus iranus (BS > 95%) and C. rettigi smiti (BS > 95%). At the species level, six species formed distinct monophyletic lineages, each with high BS (>95%). At the genus level, all six genera—Pulex, Xenopsylla, Nosopsyllus, Neopsylla, Citellophilus, and Ctenophthalmus—were strongly confirmed as monophyletic. At the family level, the Pulicidae (BS > 95%), comprising Pulex and Xenopsylla as sister groups, and the Ceratophyllidae (BS > 95%), comprising Citellophilus and Nosopsyllus, were both affirmed to be monophyletic. The family Ceratophyllidae, which includes Nosopsyllus, is positioned as the sister group to the Ctenophthalmidae clade, which comprises Ctenophthalmus.

Fig 4. A maximum likelihood tree deduced from 548 bp of the ITS2 gene presenting the phylogenetic position of flea taxa under study, alongside other sequences retrieved from the GenBank.

Fig 4

The colors indicate the different statuses of the species in each genus. Only eleven representatives of the 58 sequences determined in this study (solid circles) were included in the tree. Three sequences of Tunga penetrans (DQ844707 and, AY425818) and Tunga trimamilata (AY425820) were set as outgroup. Bootstrap Support (BS) values (1,000 replicates) are shown at nodes as percentages. Clades with BS ≥ 70% are considered well-supported.

Prevalence and supergroup classification of Wolbachia, and detection of filarial nematodes in fleas

All flea samples of X. buxtoni, X. nuttalli, and N. iranus iranus that tested positive for Wolbachia supergroup F were negative for filarial nematode infection. The PCR method successfully amplified Wolbachia wsp, groEL, and gatB gene sequences in an average of 64% of the fleas tested, of which 60% were males and 40% were females. The highest infection rate was found in P. irritans (77%), and the lowest rates were recorded for N. iranus iranus (0%), C. rettigi smiti (0%), and X. astia (0%). X. buxtoni displayed an average infection rate of 69%, with rates ranging from 62% to 70% for specimens from West Azerbaijan and Hamadan Provinces and reaching 75% for specimens from East Azerbaijan and Tehran Provinces. Other flea species showed Wolbachia infection rates of 56% for X. nuttalli and 33%-40% for N. iranus iranus (Table 2). No significant differences in Wolbachia infection rates were observed among flea species or between plague-endemic and non-endemic regions (p > 0.05). However, infection prevalence was significantly higher in female fleas compared to males (73% vs. 53%; p = 0.002) (Table E in S1 Text).

The Wolbachia sequences analyzed in this study identified three distinct supergroups: A, B, and F in fleas, each exhibiting varying prevalence rates (Figs 5, 6, 7 and Table A in S1 Text). Supergroup A was the most prevalent, infecting 50% of the specimens. Supergroup F was detected in 33% of the fleas, while supergroup B was found in 27%. Co-infections involving multiple subgroups were also observed. Approximately 14% of the specimens exhibited infections with both supergroups F and B, and 6% were infected with three supergroups A, F, and B. Around 1% of fleas were infected with supergroups F and A, and 7% with supergroups A and B. BLAST analysis of the wsp gene sequences showed that the Wolbachia infecting the flea species X. buxtoni, X. nuttalli, and N. iranus iranus exhibited 99.81% identity to the Wolbachia strains found in the insect Coptotermes acinaciformis (AJ833931) and 90.56% identity to the Wolbachia strain in Ctenocephalides felis (CP051157). The Wolbachia sequences from the three mentioned flea species were classified within supergroup F. However, the wsp sequence from P. irritans was categorized in supergroup A, demonstrating 100% identity with other isolates from different dipteran/lepidopteran insect species (OZ034724, DQ380871, and OZ035007). The presence of multiple Wolbachia supergroups in fleas may be attributed to wsp gene recombination events, as previously suggested by Baldo et al [66].

Fig 5. Maximum likelihood phylogenetic tree deduced from 528 bp of the wsp gene sequences determining the supergroup position of Wolbachia endosymbionts of fleas among other reference sequences retrieved from the GenBank.

Fig 5

Isolates identified in this study are marked with colored diamonds. Bootstrap Support (BS) values (1,000 replicates) are shown at nodes as percentages. Clades with BS ≥ 70% are considered well-supported. Bootstrap values lower than 50% are omitted from the branches. The bar indicates substitutions per site. Abbreviations: PIMA: Pulex irritans male from the Akanlu; XBFT: Xenopsylla buxtoni female from Tello; XNFS: Xenopsylla nuttalli female from Sarab; XBMB: Xenopsylla buxtoni male from Sarab; XBMA: Xenopsylla buxtoni male from Akanlu; XBFB: Xenopsylla buxtoni female from Bukan; NIFS: Nosopsyllus iranus iranus female from Sarab; NIFA: Nosopsyllus iranus iranus female from Akanlu.

Fig 6. Maximum likelihood phylogenetic tree deduced from 493 bp of the groEL gene sequences determining the supergroup position of Wolbachia endosymbionts of fleas among other reference sequences retrieved from the GenBank.

Fig 6

Isolates identified in this study are marked with colored diamonds. Two sequences of Anaplasma phagocytophilum (KF778380, KY4937984) and an Ehrlichia sp. (AY425820) were set as outgroups. Bootstrap Support (BS) values (1,000 replicates) are shown at nodes as percentages. Clades with BS ≥ 70% are considered well-supported. Bootstrap values lower than 50% are omitted from the branches. The bar indicates substitutions per site. Abbreviations: XBMT: Xenopsylla buxtoni male from Tello; XNFS: Xenopsylla nuttalli female from Sarab; XBMS: Xenopsylla buxtoni male from Sarab; XBMA: Xenopsylla buxtoni male from Akanlu; XBFB: Xenopsylla buxtoni female from Bukan; NIFS: Nosopsyllus iranus iranus female from Sarab; PIFA: Pulex irritans female from Akanlu.

Fig 7. A maximum likelihood phylogenetic tree deduced from 548 bp of the gatB gene sequences determining the supergroup position of Wolbachia endosymbionts of fleas among other reference sequences retrieved from the GenBank.

Fig 7

Isolates identified in this study are marked with colored diamonds. Bootstrap Support (BS) values (1,000 replicates) are shown at nodes as percentages. Clades with BS ≥ 70% are considered well-supported. Bootstrap values lower than 50% are omitted from the branches. The bar indicates substitutions per site. Abbreviations: XBMA: Xenopsylla buxtoni male from Akanlu; XNFS: Xenopsylla nuttalli female from Sarab; XBFS: Xenopsylla buxtoni female from Sarab; PIFA: Pulex irritans female from Akanlu; NIMA: Nosopsyllus iranus iranus male from Akanlu; XBFT: Xenopsylla buxtoni female from Tello; XBFB: Xenopsylla buxtoni female from Bukan.

Analysis of groEL gene sequences showed that the sequences of Wolbachia isolated from the flea X. buxtoni, X. nuttalli, and N. iranus iranus exhibited 100% similarity to Wolbachia strains found in various insects, including Tribolium confusum (AY714798) and Tholera decimalis (OZ034777). The Wolbachia sequences of these three flea species were classified within supergroup B. However, the groEL sequence of the symbiotic Wolbachia P. irritans was categorized in supergroup A, showing 100% resemblance to isolates from other insects, such as Aporus unicolor and Chalcis sispes. Phylogenetic analysis based on gatB gene sequences indicated that all Wolbachia isolates identified in this study clustered within supergroup A. These sequences were identical to those found in insect hosts, including Udea olivalis, Epagoge grotiana, and Nomada hirtipes.

Discussion

The current study presents the first comprehensive analysis of flea diversity and the associated Wolbachia symbionts in rodent populations across both endemic and non-endemic plague regions in the western half of Iran. By combining morphological and molecular characterization, we identified six distinct flea species, predominantly X. buxtoni. Molecular screening revealed widespread Wolbachia infections across three supergroups (A, B, and F), with prevalence rates varying by species and ranging from 33% to 77%. A significant difference in infection rates was observed between supergroups A and B (P < 0.02) (Table E in S1 Text).

Phylogenetic analyses based on ITS2 and COII gene markers confirmed the morphological identification of four flea species: C. rettigi smiti, N. iranus iranus, P. irritans, and X. astia. The significant genetic divergence observed between X. buxtoni and X. nuttalli—particularly in both COII and ITS2 sequences—suggests potential cryptic diversity within the conformis group, a morphologically defined subgroup of Xenopsylla that includes X. buxtoni, X. nuttalli, and X. conformis. Although traditional taxonomy has grouped these species based on shared morphological traits (e.g., absence of genal and pronotal combs, genital structures), our molecular data reveal deep evolutionary splits that are not reflected in current classifications. This discrepancy has important taxonomic and epidemiological implications: if X. buxtoni and X. nuttalli represent distinct evolutionary lineages, their vector competence for Y. pestis and other pathogens may differ significantly, affecting plague surveillance and risk assessment. We therefore recommend integrative taxonomic studies combining high-resolution morphological analysis, multi-locus molecular markers (e.g., COI, 28S, EF-1α), and broader geographic sampling across the Palearctic region to clarify species boundaries and refine the systematic framework of the conformis group.

The molecular identification of X. buxtoni, N. iranus iranus, X. nuttalli, X. astia, and C. rettigi smiti was hindered primarily by the lack of related species sequences in the GenBank. Nevertheless, this research significantly enriched genomic databases by depositing COII and ITS2 sequences, thereby providing valuable resources for future molecular studies on flea populations.

The phylogenetic study of fleas based on ITS2 and COII gene sequences revealed a strong congruence between molecular and morphological classifications of fleas at the subspecies, species, and genus levels. However, significant genetic distances were observed in some cases, potentially reflecting the absence of homologous sequences in the GenBank for the studied specimens. This observation aligns with previous studies that documented high levels of genetic diversity within specific flea species [12,55].

Integrating molecular analysis with traditional morphological classification has proven invaluable in modern systematic studies, especially when morphological differences are subtle. Historical classifications of X. buxtoni and X. nuttalli, based on minor morphometric distinctions, established by Hopkins and Rothschild (1953) and Haeselbarth (1966) [67,68], warrant re-evaluation of specific current taxonomic group using contemporary molecular approaches. Our analysis of ITS2 nucleotide sequences from populations of six flea species revealed unexpected genetic similarity, despite their diverse geographical origins. This finding suggests that the observed patterns are more likely the result of human-mediated introductions rather than long-distance geographical isolation.

MtDNA COI and COII markers have proven effective for resolving flea phylogenies. COI exhibited higher nucleotide diversity, while COII demonstrated greater amino acid diversity, it should be noted that this diversity reflects intraspecific variation [69]. Additionally, COII revealed the smallest genetic distance between the closely related species X. buxtoni and X. nuttalli, highlighting its valuable utility in distinguishing closely related taxa.

This study reports, for the first time, the presence of the endosymbiont Wolbachia in the fleas X. buxtoni, X. nuttalli, and N. iranus iranus, with a high infection prevalence of 60%. Although Wolbachia has previously been detected in other flea species, including Ctenocephalides canis, C. felis, Echidnophaga gallinacea, and Polygenus gwyni (25%), infection rates in these species have generally been lower [70]. Prevalence rates for these species range from 7% in C. canis to 24% in E. gallinacea and 21% in C. felis, which are significantly lower than the prevalence observed in X. buxtoni, X. nuttalli, N. iranus iranus, and P. irritans. The high prevalence detected in the present study corroborates findings from other flea species, such as T. penetrans, P. simulans (94%), Archaeopsylla erinaceid (95%), and Orchopeas howardi (80%), which exhibit infection rates ranging from 80% to 100% [7072]. Consistent with previous research, we observed a higher prevalence of Wolbachia in female than male fleas [73,74]. The female-biased Wolbachia infection pattern observed in this study aligns with its canonical mode of maternal transmission, whereby the bacterium is passed through the egg cytoplasm from mother to offspring. Because males represent an evolutionary dead end for Wolbachia, high infection prevalence in females is essential for its persistence in host populations. This sex bias may further reinforce Wolbachia-induced reproductive manipulations—such as cytoplasmic incompatibility—that enhance the relative fitness of infected females. Altogether, the elevated Wolbachia prevalence in female fleas likely results from a combination of strict maternal inheritance and sex-specific host–symbiont interactions that jointly drive the maintenance and spread of the endosymbiont in natural flea populations [75,76]. The high similarity of Wolbachia strains identified in X. buxtoni, X. nuttalli, and N. iranus iranus (Fig 2) may reflect host shifts and suggest the potential for horizontal transmission of Wolbachia among these species [77]. In male fleas, Wolbachia may influence sexual differentiation and development by modulating DNA methylation patterns of sex-determining genes, similar to mechanisms observed in other insect species [7880]. While Wolbachia is known to confer certain benefits to female hosts, its overall role in arthropods is often parasitic, potentially affecting host fitness by altering iron homeostasis and enhancing immunity against viral infections and onchocercoid nematodes [8183]. Future studies will investigate the role of the Wolbachia lineages found in the studied fleas and their interactions with the pathogens they transmit.

The present study, along with others, demonstrates that fleas are frequently infected with multiple Wolbachia types [84]. Earlier sequence analyses of C. felis (strain wCte) had placed it in supergroups B or F, based on limited genetic data [85,86]. However, recent genome-based studies have provided a more refined understanding of Wolbachia diversity in C. felis. Notably, strains wCfeT and wCfeJ have been shown to form paraphyletic clades associated with supergroups A and B, exhibiting close relationships with supergroup C [84]. A recent study by Beliavskaia et al. further clarified this complexity, revealing that wCfeT belongs to supergroup I and wCfeJ to supergroup V, highlighting the evolutionary diversity of Wolbachia in fleas [87]. In the present study, phylogenetic analyses of Wolbachia strains from four flea species—X. buxtoni, X. nuttalli, N. iranus iranus, and P. irritans—revealed conflicting supergroup assignments depending on the genetic marker used. Strains clustered primarily in supergroups A and B based on groEL, whereas wsp placed them in A and F. In contrast, all strains resolved exclusively within supergroup A in the gatB-based phylogeny. These inconsistencies likely stem from differences in evolutionary rates among loci, recombination in the wsp gene, horizontal transfer of Wolbachia strains, or potential primer bias affecting amplification efficiency across divergent lineages [56].

The conflicting supergroup assignments obtained from wsp, groEL, and gatB highlight the limitations of single-marker approaches and underscore that these findings require validation through more robust genomic methods, such as MLST or whole-genome sequencing, to resolve the true phylogenetic placement and potential recombination events among Wolbachia lineages.

The detection of Wolbachia strains belonging to supergroups A, B, and F across multiple flea species indicates considerable symbiont diversity [47]. Although all samples positive for supergroup F were negative for filarial nematode infection (see Results), the co-occurrence of multiple supergroups within individual fleas suggests potential for intra-host interactions, horizontal transfer, or recombination among lineages [8889]. Further genomic studies are warranted to investigate the presence of cytoplasmic incompatibility loci and to assess whether recombination—particularly in hypervariable genes such as wsp—has contributed to the observed phylogenetic incongruence. Despite marker-specific inconsistencies, our findings provide robust evidence of extensive Wolbachia diversity in Iranian flea populations and underscore the need for whole-genome or multi-locus approaches to resolve the evolutionary relationships among these strains.

The broad host range and high vector competence of X. buxtoni, X. nuttalli, N. iranus iranus, and P. irritans [39] in transmitting numerous significant pathogens—such as Y. pestis, R. felis and B. henselae [4244,46,90]—underscore the urgent need for effective control strategies targeting these flea species. Vector control based on specific Wolbachia strains offers a promising biological approach, exploiting the ability of the bacteria to induce reproductive manipulations and maternal transmission in arthropods to reduce vector populations [91]. This potential has not yet been experimentally validated in fleas. The influence of endosymbionts on critical factors affecting vectorial capacity, such as longevity and reproductive success, may also be modulated by environmental conditions [26,92]. Future studies should experimentally assess the impact of specific Wolbachia strains on flea fitness, reproduction, and pathogen transmission to evaluate their feasibility as biocontrol agents.

The recently identified wCfeJ strain of C. felis contains an antitoxin operon similar to the wPip cinAB operon, which has been shown to induce CI in flies. The presence of Wolbachia supergroup F in the fleas analyzed in this study, which is closely related to this strain, suggests the potential for discovering similar genomic regions in these fleas, further supporting the role of Wolbachia in reproductive interference [84]. This observation, although not investigated in our study, suggests the theoretical possibility that Wolbachia-mediated reproductive manipulation could influence flea population dynamics; however, experimental studies are needed to evaluate its feasibility for vector control. Furthermore, the Wolbachia strain identified in this study, belonging to supergroup F, is phylogenetically closely related to Wolbachia strains found in termites (Coptotermes). Although supergroup F remains relatively understudied in termites, several key biological functions have been attributed to Wolbachia in termite symbioses. These functions include the induction of CI, protection against pathogens, and enhancement of reproductive success, wood digestion, and immune function [93].

The high sequence similarity and close phylogenetic relationships observed between Wolbachia supergroups A and B in various flea species, along with their similarity to strains found in bees, butterflies, and flies, suggest that Wolbachia endosymbionts are transmitted not only vertically from mother to offspring but also horizontally [88,93]. Furthermore, studies have demonstrated that Wolbachia can be transmitted across species through host switching, a phenomenon that is more common than previously thought for supergroups A and B. Host switching has even been observed between distantly related species, further highlighting the adaptability and widespread nature of Wolbachia transmission [33].

A comparison between plague-endemic and non-endemic areas as a control region revealed no significant differences in flea fauna composition and the presence of Wolbachia infection. X. buxtoni was the dominant flea species in both regions, suggesting that its mere presence may not be a decisive in determining plague endemicity. Molecular analysis using ITS2 and COII gene markers confirmed no intraspecific genetic variation between X. buxtoni and N. iranus iranus across both areas. The prevalence of Wolbachia infection was similar between plague-endemic and non-endemic regions, with supergroups A, B, and F all identified in X. buxtoni. In contrast, N. iranus iranus from the non-endemic region showed no evidence of Wolbachia infection; however, this observation is based on only two specimens. Given the limited sample size, no definitive conclusions can be drawn regarding the absence of Wolbachia in this flea species or its potential role in regional transmission dynamics. Further research is needed to explore the role of Wolbachia in flea ecology and its interactions with other pathogens. These findings underscore the complexity of plague ecology and suggest that factors beyond flea species composition and Wolbachia infection may contribute to plague persistence in endemic regions.

As previously noted, the risk of human plague is highest where natural plague foci intersect with human populations, and flea-associated microbiota are often biased toward pathogenic bacteria [47]. While our study identified diverse Wolbachia lineages in fleas, further research is needed to assess their potential relevance to vector control or disease mitigation.

Conclusion

By identifying X. buxtoni as the dominant flea species and detecting Wolbachia infections across three supergroups, the current study highlights the intricate host-parasite interactions within different ecosystems. Phylogenetic analyses revealed significant genetic diversity both within and between flea species, emphasizing the need for further studies to refine flea taxonomy, particularly within the conformis group, and to better understand the evolutionary forces shaping these populations. The study highlights the importance of integrating both morphological and molecular approaches to achieve a comprehensive understanding of flea diversity. The high prevalence of Wolbachia in plague-carrying fleas likely reflects their critical role in flea biology, host-parasite dynamics, and the transmission of flea-borne diseases. These findings also lay the groundwork for future studies investigating the influence of Wolbachia on flea bioecology and its potential applications in controlling flea populations and the pathogens they transmit.

Supporting information

S1 Text

Fig A. Specific identification characters of Xenopsylla buxtoni. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a shallow occipital groove and a straight ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The oval bulga of spermathecal characterized by a slightly swollen, dark hilla at the base. E: The penis-plate uniformly widened to an obtuse apex, lacking a produced dorso-apical angle. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: The hind tarsus with only one apical bristle on segment II that extends beyond segment IV. H: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. I: The hind tibia in males with tiny, fine bristles between the fourth and fifth pair of dorsal bristles (Original image by the authors). Fig B. Specific identification characters of Xenopsylla nuttalli. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a shallow occipital groove and a straight ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The oval bulga of spermatheca characterized by a slightly swollen, dark hilla at the base. E: The penis-plate uniformly widened to an obtuse apex, without a produced dorso-apical angle. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: The hind tarsus with two apical bristles on segment II extending beyond segment IV. H: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. (I) The hind tibia in males with tiny, fine bristles between the fourth and fifth pair of dorsal bristles (Original image by the authors). Fig C. Specific identification characters of Xenopsylla astia. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a deep occipital groove and undulate ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The subspherical bulga of spermatheca characterized by a swollen hilla at the base twice as wide as the bulga. E: The penis-plate notably broad, with a pronounced convexity at apex, and pre-apically undulating ventral outline. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: Sternum IV-VII of the abdomen often with more than 13 bristles on the two sides together and an outer surface of it. VIII rarely with fewer than 30 including marginal row. H: Sternum VIII typically with 14–27 bristles on each side, the antepygidial bristle located submarginally, flanked by smaller bristles. I: The male’s fore tarsal segment V with three sub-apical plantar spiniform bristles (Original image by the authors). Fig D. Specific identification characters of Nosopsyllus iranus iranus. A: Female with a smooth anterior margin of the head and genal comb absent, while a pronotal comb always present, typically containing less than 24 spines on the two sides together. B: Fracticipit, occipital groove shallow and a straight ventral outline. C: The apical bristle of segment II of the hind tarsus reaching beyond segment IV. D: Spermatheca with a globular bulga, and shorter than the hilla. E: The posterior margin of the fixed process slopes forward in the middle, movable process of clasper slender with triangular apex, acetabular setas arising above the point of articulation of movable process. F: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. G: The posterior margin of the Sternum VII in the female with two protrusions and a distinct depression. H: The penis plate resembles a dagger, with a sharp tip. I: The apical arm of sternum IX in males with a long beak-shaped projection (Original image by the authors). Fig E. Specific identification characters of Pulex irritans. A: The head with a smooth anterior margin without a tubercle. B: Club of antenna asymmetrical, the anterior segments foliaceous and leaning backwards. C: Genal, pre-ocular, and post-antennal setae of the head. D: Sternite VII of females with a sinus and 4/5 setae on each side. E: Clasper with P1 very large and completely covering P2 and P3, ovoid but with the posterio-distal angle nearly straight; P2 and P3 about three-quarters length of P1. F: The penis-plate resembles a dagger with a sharp tip. G: The spermatheca with a subglobular bulga and a hilla longer than the bulga. H: Dorsal aedeagal sclerite (das) of males long and slender. I: The ventral margin of the hind coxa with a row of 6–20 spiniform setae near the apex, often irregular and forming a patch (Original image by the authors). Fig F. Specific identification characters of Ctenophthalmus rettigi smiti. A: The pronotal comb with 18 spines, and the labial palp without a curved apical bristle. B: Genal comb horizontal, with three peg-like spines all of visible in side view and directed obliquely backward. Frons with two rows of bristles. C: The shallow occipital groove and the straight ventral outline in males. The eye is greatly reduced but present in males. D: Fixed process undivided; movable process elongated triangular, with about 10 sensilla along anterior margin, aedeagus with preapical dorsal expansion. E: The apical bristle of segment II of the hind tarsus reaching beyond segment IV. F: The antennal club unmodified and consists of nine segments. G: External coxal ridge present. H: Tooth at apex of hind tibia generally pointed. I: Fracticipit and occiput with three rows of bristles (Original image by the authors). Table A. Data on the fleas and associated Wolbachia including abundance, species identification, sampling locations, and GenBank accession numbers for five COII, ITS2, wsp, groEL, gatB markers. Table B. Megablast results for the sequences obtained in this study and the reference species identified from GenBank with the highest identity and minimum genetic distance. Table C. Genetic distances ± standard deviations (SD) among studied flea species based on 660–732 bp of COII gene sequences. Table D. Genetic distances ± standard deviations (SD) among studied flea species based on 333–486 bp of ITS2 gene sequences. Table E. Comparison of Wolbachia infection prevalence among flea populations by sex, geographic location, and bacterial supergroup.

(DOCX)

pntd.0013890.s001.docx (4.8MB, docx)

Acknowledgments

The authors would like to express their gratitude to Aria Sohrabi, Hamed Hanifi, Seyed Adel Hosseini, Amir Hossein Omidi, and Ahmad Mahmoudi for their valuable guidance and assistance in collecting biological samples. We also extend our sincere thanks to the officials and staff of the healthcare centers in the four provinces studied, whose support made this work possible.

Data Availability

All data are available in the manuscript and its supporting information. Sequence data obtained from Sanger sequencing are available in the NCBI GenBank database under the following accession numbers: OR059362 and OR939694 for the COII gene; OR081769–OR081825 and PQ164822 for ITS2; PQ186735–PQ186771 for wsp; PQ203799–PQ203819 for gatB; and PQ203772–PQ203797 for groEL.

Funding Statement

This work was supported by the Pasteur Institute of Iran, (Pasteur Institute of Iran to NM-R, EM, and AR) grant number 1904. This study was also part of the first author’s postdoctoral project. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Bouchet F, Lavaud F. Solenophagy and telmophagy: biting mechanisms among various hematophagous insects. Allerg Immunol (Paris). 1999;31(10):346–50. [PubMed] [Google Scholar]
  • 2.Bitam I, Dittmar K, Parola P, Whiting MF, Raoult D. Fleas and flea-borne diseases. Int J Infect Dis. 2010;14(8):e667-76. doi: 10.1016/j.ijid.2009.11.011 [DOI] [PubMed] [Google Scholar]
  • 3.Medvedev SG. Adaptations of fleas (Siphonaptera) to parasitism. Entmol Rev. 2017;97(8):1023–30. doi: 10.1134/s0013873817080012 [DOI] [Google Scholar]
  • 4.Krasnov BR. Functional and Evolutionary Ecology of Fleas: A Model for Ecological Parasitology. Cambridge University Press. 2008. [Google Scholar]
  • 5.Hastriter M, RL B. Robert E. Lewis world species flea (Siphonaptera) list. O Bánki Y, Roskov M, Döring D et al Catalogue of Life Checklist (Version 2023–06–22). 2023. https://doiorg/1048580/dfsr-48fy [Google Scholar]
  • 6.Houyong W. Fauna Sinica: Insecta. Siphonaptera. Science Press. 2007. [Google Scholar]
  • 7.Jordan K. Suctoria-fleas. In: n editor, editor. A Handbook for the Identification of Insects of Medical Importance. England: Jarrold and Sons. 1948. p. 211–45. [Google Scholar]
  • 8.Holland GP. Evolution, Classification, and Host Relationships of Siphonaptera. Annu Rev Entomol. 1964;9(1):123–46. doi: 10.1146/annurev.en.09.010164.001011 [DOI] [Google Scholar]
  • 9.Wang DunQing WD, Liu JingYuan LJ. A new family of flea, Liuopsyllidae fam. nov. (Insecta: Siphonaptera). Acta Entomologica Sinica. 1994;37(3):364-369. [Google Scholar]
  • 10.Medvedev S. Classification of fleas (order Siphonaptera) and its theoretical foundations. Entomological Review. 1998;78(9):1080–93. [Google Scholar]
  • 11.Medvedev SG. Morphological basis of the classification of fleas (Siphonaptera). Entomological Review. 1994;73(30–51). [Google Scholar]
  • 12.Zhou S, Liu W, Zeng Z, Wang J, Han T, Xu G, et al. Taxonomy and phylogeny of rodents parasitic fleas in southeastern China with description of a new subspecies of Ctenophthalmus breviprojiciens. Sci Rep. 2024;14(1):28316. doi: 10.1038/s41598-024-79492-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Zurita A, Callejón R, García-Sánchez ÁM, Urdapilleta M, Lareschi M, Cutillas C. Origin, evolution, phylogeny and taxonomy of Pulex irritans. Med Vet Entomol. 2019;33(2):296–311. doi: 10.1111/mve.12365 [DOI] [PubMed] [Google Scholar]
  • 14.Maleki Ravasan N, Shayeghi M, Najibi B, Oshaghi MA. Infantile nosocomial myiasis in iran. J Arthropod Borne Dis. 2012;6(2):156–63. [PMC free article] [PubMed] [Google Scholar]
  • 15.Karimian F, Oshaghi MA, Sedaghat MM, Waterhouse RM, Vatandoost H, Hanafi-Bojd AA, et al. Phylogenetic analysis of the oriental-Palearctic-Afrotropical members of Anopheles (Culicidae: Diptera) based on nuclear rDNA and mitochondrial DNA characteristics. Jpn J Infect Dis. 2014;67(5):361–7. doi: 10.7883/yoken.67.361 [DOI] [PubMed] [Google Scholar]
  • 16.Maleki-Ravasan N, Solhjouy-Fard S, Beaucournu J-C, Laudisoit A, Mostafavi E. The Fleas (Siphonaptera) in Iran: Diversity, Host Range, and Medical Importance. PLoS Negl Trop Dis. 2017;11(1):e0005260. doi: 10.1371/journal.pntd.0005260 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Khanzadeh F, Khaghaninia S, Maleki-Ravasan N, Oshaghi MA, Adler PH. Black flies (Diptera: Simuliidae) of the Aras River Basin: Species composition and floral visitation. Acta Trop. 2020;209:105536. doi: 10.1016/j.actatropica.2020.105536 [DOI] [PubMed] [Google Scholar]
  • 18.Namaki-Khameneh R, Khaghaninia S, L Disney RH, Maleki-Ravasan N. The scuttle flies (Diptera: Phoridae) of Iran with the description of Mahabadphora aesthesphora as a new genus and species. PLoS One. 2021;16(10):e0257899. doi: 10.1371/journal.pone.0257899 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Skuhrovec J, Gosik R, Maleki-Ravasan N, Karimian F, Tahghighi A. Morphological and molecular inference of immature stages of Larinus hedenborgi (Col: Curculionidae), a trehala-constructing weevil. Org Divers Evol. 2021;22(1):161–76. doi: 10.1007/s13127-021-00511-1 [DOI] [Google Scholar]
  • 20.Moin-Vaziri V, Djadid ND, Hoosh-Deghati H, Atta H, Raz AA, Seyyed-Tabaei SJ, et al. Molecular Detection of Plasmodium Infection among Anophelinae Mosquitoes and Differentiation of Biological Forms of Anopheles Stephensi Collected from Malarious Areas of Afghanistan and Iran. Ethiop J Health Sci. 2022;32(2):269–78. doi: 10.4314/ejhs.v32i2.7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Azrizal-Wahid N, Sofian-Azirun M, Low VL. New insights into the haplotype diversity of the cosmopolitan cat flea Ctenocephalides felis (Siphonaptera: Pulicidae). Vet Parasitol. 2020;281:109102. doi: 10.1016/j.vetpar.2020.109102 [DOI] [PubMed] [Google Scholar]
  • 22.Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proc Natl Acad Sci U S A. 2004;101(41):14812–7. doi: 10.1073/pnas.0406166101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wang G, Li C, Zheng W, Song F, Guo X, Wu Z, et al. An evaluation of the suitability of COI and COII gene variation for reconstructing the phylogeny of, and identifying cryptic species in, anopheline mosquitoes (Diptera Culicidae). Mitochondrial DNA A DNA Mapp Seq Anal. 2017;28(5):769–77. doi: 10.1080/24701394.2016.1186665 [DOI] [PubMed] [Google Scholar]
  • 24.Maleki-Ravasan N, Bahrami A, Vatandoost H, Shayeghi M, Koosha M, Oshaghi MAJ. Molecular characterization and phylogenetic congruence of Hydropsyche sciligra (Tricoptera: Hydropsychidae) using mitochondrial and nuclear markers. J JoA-BD. 2017;11(1):60 [PMC free article] [PubMed] [Google Scholar]
  • 25.Mishra S, Sharma G, Das MK, Pande V, Singh OP. Intragenomic sequence variations in the second internal transcribed spacer (ITS2) ribosomal DNA of the malaria vector Anopheles stephensi. PLoS One. 2021;16(6):e0253173. doi: 10.1371/journal.pone.0253173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Flatau R, Segoli M, Khokhlova I, Hawlena H. Wolbachia’s role in mediating its flea’s reproductive success differs according to flea origin. FEMS Microbiol Ecol. 2018;94(10):10.1093/femsec/fiy157. doi: 10.1093/femsec/fiy157 [DOI] [PubMed] [Google Scholar]
  • 27.McLean AHC, Parker BJ, Hrček J, Henry LM, Godfray HCJ. Insect symbionts in food webs. Philos Trans R Soc Lond B Biol Sci. 2016;371(1702):20150325. doi: 10.1098/rstb.2015.0325 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Maleki-Ravasan N, Akhavan N, Raz A, Jafari M, Zakeri S, Dinparast Djadid N. Co-occurrence of pederin-producing and Wolbachia endobacteria in Paederus fuscipes Curtis, 1840 (Coleoptera: Staphilinidae) and its evolutionary consequences. Microbiologyopen. 2019;8(7):e00777. doi: 10.1002/mbo3.777 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bi J, Wang Y-F. The effect of the endosymbiont Wolbachia on the behavior of insect hosts. Insect Sci. 2020;27(5):846–58. doi: 10.1111/1744-7917.12731 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Detcharoen M, Arthofer W, Jiggins FM, Steiner FM, Schlick-Steiner BC. Wolbachia affect behavior and possibly reproductive compatibility but not thermoresistance, fecundity, and morphology in a novel transinfected host, Drosophila nigrosparsa. Ecol Evol. 2020;10(10):4457–70. doi: 10.1002/ece3.6212 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kaur R, Shropshire JD, Cross KL, Leigh B, Mansueto AJ, Stewart V, et al. Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe. 2021;29(6):879–93. doi: 10.1016/j.chom.2021.03.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chamankar B, Maleki-Ravasan N, Karami M, Forouzan E, Karimian F, Naeimi S, et al. The structure and diversity of microbial communities in Paederus fuscipes (Coleoptera: Staphylinidae): from ecological paradigm to pathobiome. Microbiome. 2023;11(1):11. doi: 10.1186/s40168-022-01456-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gomes TMFF, Wallau GL, Loreto ELS. Multiple long-range host shifts of major Wolbachia supergroups infecting arthropods. Sci Rep. 2022;12(1):8131. doi: 10.1038/s41598-022-12299-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sinha A, Li Z, Poole CB, Ettwiller L, Lima NF, Ferreira MU, et al. Multiple lineages of nematode-Wolbachia symbiosis in supergroup F and convergent loss of bacterioferritin in filarial Wolbachia. Genome Biol Evol. 2023;15(5):evad073. doi: 10.1093/gbe/evad073 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yudina M, Bykov R, Kotti B, Vysochina N, Stakheev V, Broshkov A. Wolbachia infection in flea populations (Insecta: Siphonaptera). Zhurnal Obshchei Biologii. 2018;79(3):237–46. [Google Scholar]
  • 36.Ghasemi F, Miri M, Rajabloo M. First record of Ischnopsyllus intermedius (Siphonaptera) as a ectoparasite of Myotis blythii (Chiroptera) from southwest of Iran. Small Mammal Mail. 2016;8:3–7. [Google Scholar]
  • 37.Yousefi A, Ghorbani MN, Salehi-Guilandeh S. Leptopsylla algira costai (Siphonaptera: Leptopsyllidae): new host and new geographical record. J Coast Life Med. 2016;4:953–4. [Google Scholar]
  • 38.Piazak N, Assmar M, Karimi Y. First report on the occurrence of Stenoponia tripectinata spinellosa jordan 1958 (Siphonaptere: stenoponiinae) in Iran. Journal of Entomological Society of Iran. 1984;7(1, 2):3–8. [Google Scholar]
  • 39.Maleki-Ravasan N, Solhjouy-Fard S, Beaucournu JC, Laudisoit A, Mostafavi E. The fleas (Siphonaptera) in Iran: diversity, host range, and medical importance. PLoS Negl. Trop. Dis. 2017. 9;11(1):e0005260. doi: 10.1371/journal.pntd.0005260 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Miarinjara A, Bland DM, Belthoff JR, Hinnebusch BJ. Poor vector competence of the human flea, Pulex irritans, to transmit Yersinia pestis. Parasit Vectors. 2021;14(1):317. doi: 10.1186/s13071-021-04805-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hashemi Shahraki A, Carniel E, Mostafavi E. Plague in Iran: its history and current status. Epidemiol Health. 2016;38:e2016033. doi: 10.4178/epih.e2016033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Baltazard M, Bahmanyar M, Mofidi C, Seydian B. Kurdistan plague focus. Bull World Health Organ. 1952;5(4):441–72. [PMC free article] [PubMed] [Google Scholar]
  • 43.Baltazard M, Bahmanyar M. Research on plague in India. Bulletin of the World Health Organization. 1960;23(2–3):169–215. [PMC free article] [PubMed] [Google Scholar]
  • 44.Baltazard M, Bahmanyar M. Research on plague in Java. Bulletin of the World Health Organization. 1960;23(2–3):217–46. [PMC free article] [PubMed] [Google Scholar]
  • 45.Mohammadpour R, Mostafavi E. A Historical Report of Plague Outbreak in Northwestern Iran, 1966. JoMMID. 2018;6(1):20–4. doi: 10.29252/jommid.6.1.20 [DOI] [Google Scholar]
  • 46.Karimi P. Discovery of a new focus of zoonotic plague in the eastern Azarbaidjan region of Iran. Bull Soc Pathol Exot Filiales. 1980;73(1):28–35. [PubMed] [Google Scholar]
  • 47.Seidi S, Raz A, Maleki-Ravasan N, Forouzan E, Karimian F, Sebbane F, et al. The interplay between species and locations shapes vector fleas microbial communities in plague foci: pathogens rather than symbionts?. Front Cell Infect Microbiol. 2025;15:1568103. doi: 10.3389/fcimb.2025.1568103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hanski I. Landscape ecology of small mammals. Springer Science & Business Media. 1999. [Google Scholar]
  • 49.Baltazard M, Eftekhari M. Techniques de récolte, de manipulation et d’élevage des puces de rongeurs. Bulletin of the World Health Organization. 1957;16(2):436. [PMC free article] [PubMed] [Google Scholar]
  • 50.Darvish J. Morphological comparison of fourteen species of the genus Meriones Illiger, 1811 (Rodentia: Gerbillinae) from Asia and North Africa. Iranian Journal of Animal Biosystematics. 2011;7(1):49–74. doi: 10.22067/ijab.v7i1.25506 [DOI] [Google Scholar]
  • 51.Asmari M, Piazak N, Karimi Y. An illustrated key for flea of Iran. Pasteur Institute of Iran. 1979. [Google Scholar]
  • 52.Hubbard CA. An illustrated catalogue of the Rothschild collection of fleas (Siphonaptera) in the British Museum, vol. I. Tungidae and Pulicidae. Science. 1954;120(3110):215–6. [Google Scholar]
  • 53.Lewis RE. Fleas (Siphonaptera). Medical Insects and Arachnids. Springer Netherlands. 1993. p. 529–75. doi: 10.1007/978-94-011-1554-4_16 [DOI] [Google Scholar]
  • 54.Hopkins GHE, Rothschild M. An illustrated catalogue of the Rothschild collection of fleas (Siphonaptera) in the British Museum. Trustees of the British Museum. 1953. [Google Scholar]
  • 55.Whiting MF, Whiting AS, Hastriter MW, Dittmar K. A molecular phylogeny of fleas (Insecta: Siphonaptera): origins and host associations. Cladistics. 2008;24(5):677–707. doi: 10.1111/j.1096-0031.2008.00211.x [DOI] [Google Scholar]
  • 56.Zhou W, Rousset F, O’Neil S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proc Biol Sci. 1998;265(1395):509–15. doi: 10.1098/rspb.1998.0324 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Wang Z, Su X-M, Wen J, Jiang L-Y, Qiao G-X. Widespread infection and diverse infection patterns of Wolbachia in Chinese aphids. Insect Sci. 2014;21(3):313–25. doi: 10.1111/1744-7917.12102 [DOI] [PubMed] [Google Scholar]
  • 58.Paraskevopoulos C, Bordenstein SR, Wernegreen JJ, Werren JH, Bourtzis K. Toward a Wolbachia multilocus sequence typing system: discrimination of Wolbachia strains present in Drosophila species. Curr Microbiol. 2006;53(5):388–95. doi: 10.1007/s00284-006-0054-1 [DOI] [PubMed] [Google Scholar]
  • 59.Tang T-HT, López-Vélez R, Lanza M, Shelley AJ, Rubio JM, Luz SLB. Nested PCR to detect and distinguish the sympatric filarial species Onchocerca volvulus, Mansonella ozzardi and Mansonella perstans in the Amazon Region. Mem Inst Oswaldo Cruz. 2010;105(6):823–8. doi: 10.1590/s0074-02762010000600016 [DOI] [PubMed] [Google Scholar]
  • 60.Luchetti A, Mantovani B, Pampiglione S, Trentini M. Molecular characterization of Tunga trimamillata and T. penetrans (Insecta, Siphonaptera,Tungidae): taxonomy and genetic variability. Parasite. 2005;12(2):123–9. doi: 10.1051/parasite/2005122123 [DOI] [PubMed] [Google Scholar]
  • 61.Karami M, Moosa-Kazemi SH, Oshaghi MA, Vatandoost H, Sedaghat MM, Rajabnia R, et al. Wolbachia Endobacteria in Natural Populations of Culex pipiens of Iran and Its Phylogenetic Congruence. J Arthropod Borne Dis. 2016;10(3):347–63. [PMC free article] [PubMed] [Google Scholar]
  • 62.Karimian F, Vatandoost H, Rassi Y, Maleki-Ravasan N, Choubdar N, Koosha M, et al. wsp-based analysis of Wolbachia strains associated with Phlebotomus papatasi and P. sergenti (Diptera: Psychodidae) main cutaneous leishmaniasis vectors, introduction of a new subgroup wSerg. Pathog Glob Health. 2018;112(3):152–60. doi: 10.1080/20477724.2018.1471438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Khanzadeh F, Maleki-Ravasan N, Adler PH, Karimian F, Kudela M. First report of filarial nematodes in the genus Onchocerca infecting black flies (Diptera: Simuliidae) in Iran. Sci Rep. 2023;13(1):14585. doi: 10.1038/s41598-023-41890-z [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Khanzadeh F, Khaghaninia S, Maleki-Ravasan N, Koosha M, Oshaghi MA. Molecular detection of Dirofilaria spp. and host blood-meal identification in the Simulium turgaicum complex (Diptera: Simuliidae) in the Aras River Basin, northwestern Iran. Parasit Vectors. 2020;13(1):548. doi: 10.1186/s13071-020-04432-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol Biol Evol. 2018;35(6):1547–9. doi: 10.1093/molbev/msy096 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Baldo L, Lo N, Werren JH. Mosaic nature of the wolbachia surface protein. J Bacteriol. 2005;187(15):5406–18. doi: 10.1128/JB.187.15.5406-5418.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Hopkins GHE, Eothschild M. An Illustrated Catalogue of the Rothschild Collection of Fleas (Siphonaptera) in the British Museum (Natural History) with Keys and Short Descriptions for the Identification of Families, Genera, Species and Subspecies. British Museum (Natural History). 1953. [Google Scholar]
  • 68.Haeselbarth E, Segerman J, Zumpt F. The arthropod parasites of vertebrates in Africa south of the Sahara (Ethiopian region). Insecta excl. Phthiraptera ed. 1966. [Google Scholar]
  • 69.Lawrence AL, Brown GK, Peters B, Spielman DS, Morin-Adeline V, Šlapeta J. High phylogenetic diversity of the cat flea (Ctenocephalides felis) at two mitochondrial DNA markers. Med Vet Entomol. 2014;28(3):330–6. doi: 10.1111/mve.12051 [DOI] [PubMed] [Google Scholar]
  • 70.Gorham CH, Fang QQ, Durden LA. Wolbachia endosymbionts in fleas (Siphonaptera). J Parasitol. 2003;89(2):283–9. doi: 10.1645/0022-3395(2003)089[0283:WEIFS]2.0.CO;2 [DOI] [PubMed] [Google Scholar]
  • 71.Heukelbach J, Bonow I, Witt L, Feldmeier H, Fischer P. High infection rate of Wolbachia endobacteria in the sand flea Tunga penetrans from Brazil. Acta Trop. 2004;92(3):225–30. doi: 10.1016/j.actatropica.2004.08.005 [DOI] [PubMed] [Google Scholar]
  • 72.Manoj RRS, Latrofa MS, Bezerra-Santos MA, Sgroi G, Samarelli R, Mendoza-Roldan JA, et al. Molecular detection and characterization of the endosymbiont Wolbachia in the European hedgehog flea, Archaeopsylla erinacei. Infect Genet Evol. 2022;97:105161. doi: 10.1016/j.meegid.2021.105161 [DOI] [PubMed] [Google Scholar]
  • 73.Flatau R, Segoli M, Hawlena H. Wolbachia Endosymbionts of Fleas Occur in All Females but Rarely in Males and Do Not Show Evidence of Obligatory Relationships, Fitness Effects, or Sex-Distorting Manipulations. Front Microbiol. 2021;12:649248. doi: 10.3389/fmicb.2021.649248 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Onder Z, Ciloglu A, Duzlu O, Yildirim A, Okur M, Yetismis G, et al. Molecular detection and identification of Wolbachia endosymbiont in fleas (Insecta: Siphonaptera). Folia Microbiol (Praha). 2019;64(6):789–96. doi: 10.1007/s12223-019-00692-5 [DOI] [PubMed] [Google Scholar]
  • 75.Cordaux R, Bouchon D, Grève P. The impact of endosymbionts on the evolution of host sex-determination mechanisms. Trends Genet. 2011;27(8):332–41. doi: 10.1016/j.tig.2011.05.002 [DOI] [PubMed] [Google Scholar]
  • 76.Pascar J, Chandler CH. A bioinformatics approach to identifying Wolbachia infections in arthropods. PeerJ. 2018;6:e5486. doi: 10.7717/peerj.5486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Gomes TMFF, Wallau GL, Loreto ELS. Multiple long-range host shifts of major Wolbachia supergroups infecting arthropods. Sci Rep. 2022;12(1):8131. doi: 10.1038/s41598-022-12299-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Negri I, Pellecchi M. Sex Steroids in Insects and the Role of the Endosymbiont Wolbachia:A New Perspective. Sex Hormones. InTech. 2012. doi: 10.5772/26892 [DOI] [Google Scholar]
  • 79.Beukeboom LW, Kamping A, van de Zande L. Sex determination in the haplodiploid wasp Nasonia vitripennis (Hymenoptera: Chalcidoidea): a critical consideration of models and evidence. Semin Cell Dev Biol. 2007;18(3):371–8. doi: 10.1016/j.semcdb.2006.12.015 [DOI] [PubMed] [Google Scholar]
  • 80.Field LM, Lyko F, Mandrioli M, Prantera G. DNA methylation in insects. Insect Mol Biol. 2004;13(2):109–15. doi: 10.1111/j.0962-1075.2004.00470.x [DOI] [PubMed] [Google Scholar]
  • 81.Teixeira L, Ferreira A, Ashburner M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol. 2008;6(12):e2. doi: 10.1371/journal.pbio.1000002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Kambris Z, Cook PE, Phuc HK, Sinkins SP. Immune activation by life-shortening Wolbachia and reduced filarial competence in mosquitoes. Science. 2009;326(5949):134–6. doi: 10.1126/science.1177531 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Epis S, Varotto-Boccazzi I, Crotti E, Damiani C, Giovati L, Mandrioli M, et al. Chimeric symbionts expressing a Wolbachia protein stimulate mosquito immunity and inhibit filarial parasite development. Commun Biol. 2020;3(1):105. doi: 10.1038/s42003-020-0835-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Driscoll TP, Verhoeve VI, Brockway C, Shrewsberry DL, Plumer M, Sevdalis SE, et al. Evolution of Wolbachia mutualism and reproductive parasitism: insight from two novel strains that co-infect cat fleas. PeerJ. 2020;8:e10646. doi: 10.7717/peerj.10646 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Dittmar K, Whiting MF. New Wolbachia endosymbionts from Nearctic and Neotropical fleas (Siphonaptera). J Parasitol. 2004;90(5):953–7. doi: 10.1645/GE-186R [DOI] [PubMed] [Google Scholar]
  • 86.Casiraghi M, Bordenstein SR, Baldo L, Lo N, Beninati T, Wernegreen JJ, et al. Phylogeny of Wolbachia pipientis based on gltA, groEL and ftsZ gene sequences: clustering of arthropod and nematode symbionts in the F supergroup, and evidence for further diversity in the Wolbachia tree. Microbiology (Reading). 2005;151(Pt 12):4015–22. doi: 10.1099/mic.0.28313-0 [DOI] [PubMed] [Google Scholar]
  • 87.Beliavskaia A, Tan K-K, Sinha A, Husin NA, Lim FS, Loong SK, et al. Metagenomics of culture isolates and insect tissue illuminate the evolution of Wolbachia, Rickettsia and Bartonella symbionts in Ctenocephalides spp. fleas. Microb Genom. 2023;9(7):mgen001045. doi: 10.1099/mgen.0.001045 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Baldo L, Lo N, Werren JH. Mosaic nature of the wolbachia surface protein. J Bacteriol. 2005;187(15):5406–18. doi: 10.1128/JB.187.15.5406-5418.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Shaikevich E, Bogacheva A, Rakova V, Ganushkina L, Ilinsky Y. Wolbachia symbionts in mosquitoes: Intra- and intersupergroup recombinations, horizontal transmission and evolution. Mol Phylogenet Evol. 2019;134:24–34. doi: 10.1016/j.ympev.2019.01.020 [DOI] [PubMed] [Google Scholar]
  • 90.Seyf A. Iran and the great plague, 1830-1831. Studia Islamica. 1989;69:151–65. [PubMed] [Google Scholar]
  • 91.Montenegro D, Cortés-Cortés G, Balbuena-Alonso MG, Warner C, Camps M. Wolbachia-based emerging strategies for control of vector-transmitted disease. Acta Trop. 2024;260:107410. doi: 10.1016/j.actatropica.2024.107410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Salunke BK, Salunkhe RC, Dhotre DP, Khandagale AB, Walujkar SA, Kirwale GS, et al. Diversity of Wolbachia in Odontotermes spp. (Termitidae) and Coptotermes heimi (Rhinotermitidae) using the multigene approach. FEMS Microbiol Lett. 2010;307(1):55–64. doi: 10.1111/j.1574-6968.2010.01960.x [DOI] [PubMed] [Google Scholar]
  • 93.Van Meer MM, Witteveldt J, Stouthamer R. Phylogeny of the arthropod endosymbiont Wolbachia based on the wsp gene. Insect Mol Biol. 1999;8(3):399–408. doi: 10.1046/j.1365-2583.1999.83129.x [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Text

Fig A. Specific identification characters of Xenopsylla buxtoni. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a shallow occipital groove and a straight ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The oval bulga of spermathecal characterized by a slightly swollen, dark hilla at the base. E: The penis-plate uniformly widened to an obtuse apex, lacking a produced dorso-apical angle. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: The hind tarsus with only one apical bristle on segment II that extends beyond segment IV. H: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. I: The hind tibia in males with tiny, fine bristles between the fourth and fifth pair of dorsal bristles (Original image by the authors). Fig B. Specific identification characters of Xenopsylla nuttalli. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a shallow occipital groove and a straight ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The oval bulga of spermatheca characterized by a slightly swollen, dark hilla at the base. E: The penis-plate uniformly widened to an obtuse apex, without a produced dorso-apical angle. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: The hind tarsus with two apical bristles on segment II extending beyond segment IV. H: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. (I) The hind tibia in males with tiny, fine bristles between the fourth and fifth pair of dorsal bristles (Original image by the authors). Fig C. Specific identification characters of Xenopsylla astia. A: Female with a smooth anterior margin of the head and without both genal and pronotal combs. B: Male with a deep occipital groove and undulate ventral outline. C: Mesopleuron of a female with a pleural rod and the suture that separates the sternum from the episternum of the metathorax. D: The subspherical bulga of spermatheca characterized by a swollen hilla at the base twice as wide as the bulga. E: The penis-plate notably broad, with a pronounced convexity at apex, and pre-apically undulating ventral outline. F: Abrupt narrowing of the hind coxa below the middle of the posterior margin. G: Sternum IV-VII of the abdomen often with more than 13 bristles on the two sides together and an outer surface of it. VIII rarely with fewer than 30 including marginal row. H: Sternum VIII typically with 14–27 bristles on each side, the antepygidial bristle located submarginally, flanked by smaller bristles. I: The male’s fore tarsal segment V with three sub-apical plantar spiniform bristles (Original image by the authors). Fig D. Specific identification characters of Nosopsyllus iranus iranus. A: Female with a smooth anterior margin of the head and genal comb absent, while a pronotal comb always present, typically containing less than 24 spines on the two sides together. B: Fracticipit, occipital groove shallow and a straight ventral outline. C: The apical bristle of segment II of the hind tarsus reaching beyond segment IV. D: Spermatheca with a globular bulga, and shorter than the hilla. E: The posterior margin of the fixed process slopes forward in the middle, movable process of clasper slender with triangular apex, acetabular setas arising above the point of articulation of movable process. F: The male’s fore tarsal segment V with two sub-apical plantar spiniform bristles. G: The posterior margin of the Sternum VII in the female with two protrusions and a distinct depression. H: The penis plate resembles a dagger, with a sharp tip. I: The apical arm of sternum IX in males with a long beak-shaped projection (Original image by the authors). Fig E. Specific identification characters of Pulex irritans. A: The head with a smooth anterior margin without a tubercle. B: Club of antenna asymmetrical, the anterior segments foliaceous and leaning backwards. C: Genal, pre-ocular, and post-antennal setae of the head. D: Sternite VII of females with a sinus and 4/5 setae on each side. E: Clasper with P1 very large and completely covering P2 and P3, ovoid but with the posterio-distal angle nearly straight; P2 and P3 about three-quarters length of P1. F: The penis-plate resembles a dagger with a sharp tip. G: The spermatheca with a subglobular bulga and a hilla longer than the bulga. H: Dorsal aedeagal sclerite (das) of males long and slender. I: The ventral margin of the hind coxa with a row of 6–20 spiniform setae near the apex, often irregular and forming a patch (Original image by the authors). Fig F. Specific identification characters of Ctenophthalmus rettigi smiti. A: The pronotal comb with 18 spines, and the labial palp without a curved apical bristle. B: Genal comb horizontal, with three peg-like spines all of visible in side view and directed obliquely backward. Frons with two rows of bristles. C: The shallow occipital groove and the straight ventral outline in males. The eye is greatly reduced but present in males. D: Fixed process undivided; movable process elongated triangular, with about 10 sensilla along anterior margin, aedeagus with preapical dorsal expansion. E: The apical bristle of segment II of the hind tarsus reaching beyond segment IV. F: The antennal club unmodified and consists of nine segments. G: External coxal ridge present. H: Tooth at apex of hind tibia generally pointed. I: Fracticipit and occiput with three rows of bristles (Original image by the authors). Table A. Data on the fleas and associated Wolbachia including abundance, species identification, sampling locations, and GenBank accession numbers for five COII, ITS2, wsp, groEL, gatB markers. Table B. Megablast results for the sequences obtained in this study and the reference species identified from GenBank with the highest identity and minimum genetic distance. Table C. Genetic distances ± standard deviations (SD) among studied flea species based on 660–732 bp of COII gene sequences. Table D. Genetic distances ± standard deviations (SD) among studied flea species based on 333–486 bp of ITS2 gene sequences. Table E. Comparison of Wolbachia infection prevalence among flea populations by sex, geographic location, and bacterial supergroup.

(DOCX)

pntd.0013890.s001.docx (4.8MB, docx)

Data Availability Statement

All data are available in the manuscript and its supporting information. Sequence data obtained from Sanger sequencing are available in the NCBI GenBank database under the following accession numbers: OR059362 and OR939694 for the COII gene; OR081769–OR081825 and PQ164822 for ITS2; PQ186735–PQ186771 for wsp; PQ203799–PQ203819 for gatB; and PQ203772–PQ203797 for groEL.


Articles from PLOS Neglected Tropical Diseases are provided here courtesy of PLOS

RESOURCES