Abstract
Muscle hematomas can exacerbate inflammation, delay healing, and reduce function after muscle injury. This study examined whether early hematoma removal promoted recovery in a rat model of tibialis anterior muscle laceration. Hematomas were surgically removed 6 h after injury and compared with untreated animals. Histological analysis revealed that the hematoma removal group had a significantly reduced hematoma size 24 h after injury and a significantly reduced abnormal tissue area on days 3 and 14. Furthermore, the hematoma removal group demonstrated better muscle strength recovery at 3, 14, and 28 days post-injury. Gene expression analysis of the injured muscle tissue revealed that the expression levels of several genes related to inflammation and inflammatory pain (IL-6, IL-10, IL-1β, TNF-α, IL-1Ra, COX-1, COX-2, NGF) and macrophage marker molecules (CD68, ADGRE1, CD206, Arg1) during the acute phase were significantly lower in the hematoma removal group compared to the control group. No significant differences were observed in the transcription levels of the genes related to myogenic differentiation. In summary, early surgical hematoma removal in a rat laceration model reduced inflammation and abnormal tissue volume and promoted muscle strength recovery. This study provides new evidence suggesting that early hematoma removal after skeletal muscle injury is beneficial.
Supplementary Information
The online version contains supplementary material available at 10.1038/s41598-026-37267-7.
Keywords: Skeletal muscle injury, Muscle hematoma, Surgical hematoma removal, Inflammation, Muscle recovery
Subject terms: Diseases, Medical research
Introduction
Skeletal muscle injuries are caused by excessive loads or external forces and are one of the most important traumatic injuries in daily life and sports1,2. These injuries are classified into three major types: contusions, strains, and lacerations2. Severe muscle injuries are often accompanied by the development of muscular hematoma3–5. Hematomas can cause inflammatory reactions and associated pain in the acute phase and can cause delayed healing and functional impairment due to the formation of fibrous tissue during the healing process6–9.
In clinical practice, acute management of muscle injuries is generally performed according to the protection, rest, ice, compression, and elevation (PRICE) protocol10. This approach aims to prevent further injury, minimize swelling and bleeding, and reduce hematoma size through conservative treatment11,12. The decision to remove a hematoma surgically is usually based on multiple factors, including the size of the hematoma, presence or absence of neurovascular impairment, risk of infection, functional impairment, possibility of developing compartment syndrome, and the patient’s natural healing ability11–13. A comparative study of 55 athletes treated for muscle injuries from 2013 to 2018 showed that hematoma removal significantly shortened the recovery period from an average of 32.4 days to 23.5 days. In addition, the recurrence rate of muscle injury after hematoma removal significantly decreased from 28.6 to 4%14,15. These results suggest that hematoma removal may have a positive effect on muscle injury healing; however, the basic knowledge on this procedure is insufficient. For example, surgical hematoma removal is a useful method to relieve acute pain3,16; however, to the best of our knowledge, no basic research has examined its mechanism or its effect on subsequent injury healing.
This study investigated the effect of surgical hematoma removal using histological, gene expression, and muscle strength analyses in a rat tibialis anterior (TA) muscle laceration model. We hypothesized that hematoma removal reduces local inflammation and fibrosis, thereby promoting functional recovery.
Results
This study was conducted in accordance with the experimental protocol shown in Fig. 1. In the TA muscle, where the hematoma was removed, the hematoma size 24 h after laceration was significantly smaller than that on the untreated contralateral side (Fig. 2). Subsequent histological evaluations at 3 and 14 days post-laceration showed that the abnormal area was significantly smaller in muscles that had undergone hematoma removal (Fig. 3). The inter-rater intraclass correlation coefficient (ICC) for abnormal area measurement was 0.987 (95% CI: 0.940–0.998). The ICC values calculated for raters 1 and 2, 1 and 3, and 2 and 3 were 0.984, 0.991, and 0.978, respectively, indicating excellent interrater reliability. In muscle strength assessment, the twitch force on day 3 post-laceration was 70 ± 18% of the contralateral side in the hematoma removal group and 49 ± 14% of the contralateral side in the no treatment group (p = 0.039, Fig. 4). The tetanic force was 77 ± 12% of the contralateral side in the hematoma removal group and 57 ± 13% of the contralateral side in the no treatment group (p = 0.016), with significantly better recovery observed in the hematoma removal group. Regarding the tetanic force, significantly higher ratios compared to the contralateral side were measured in the hematoma removal group than in the no-treatment group 14 and 28 days after injury. Furthermore, it was confirmed that the effect of hematoma removal on promoting muscle recovery did not differ between sexes, and that sham surgery without hematoma removal did not promote muscle recovery (Figs. S1 and S2).
Fig. 1.
General experimental design. The rats were subjected to TA muscle laceration and assigned to either the hematoma removal or control (no treatment) group. Muscle samples were collected at multiple time points postinjury to analyze biochemical markers, gene expression profiles, and muscle contractile strength.
Fig. 2.
Hematoma removal and subsequent confirmation of hematoma size. (A) A hematoma observed at the injury site within the TA muscle at 6 h post-laceration. (B, C) Repeated irrigation using sterile saline until no residual hematoma was visible. Scale bar = 1 mm. (D–G) Injury sites at 24 h post-laceration. (D, F) Macroscopic findings; (E, G) HE staining. The black dotted lines indicate the hematoma region. (D, E) No treatment group; (F, G) Hematoma removal group. Scale bars = 2 mm. (H) Comparison of hematoma size at 24 h post-laceration. *p < 0.05, **p < 0.01.
Fig. 3.
Quantitative comparison of abnormal areas between two groups during the healing process. (A–D) Representative sagittal views of injury sites stained with HE at day 3 post-injury. (A, B) Untreated group on day 3 (scale bar = 2 mm in A, 1 mm in B). (C, D) Hematoma removal on day three (scale bar = 2 mm in C and 1 mm in D). Solid lines in panels (A) and (C) indicate areas in panels (B) and (D). (E–H) Representative sagittal views of injury sites stained with hematoxylin and eosin (HE) 14 days post-injury. (E, F) The untreated group on day 14 (scale bar = 2 mm in E, 1 mm in F). (G, H) Hematoma removal on day 14 (scale bars = 2 mm in G and 1 mm in H). Solid lines in panels (E) and (G) indicate the areas in panels (F) and (H). (I) Quantification of abnormal areas at 3, 14, and 28 days post injury (n = 4 per group). *p < 0.05.
Fig. 4.
Functional recovery post-laceration. Comparisons of twitch and tetanic force between the two groups on days 3, 14, and 28 post laceration. Values were normalized to those of uninjured contralateral muscles (n = 4 per group). *p < 0.05, **p < 0.01, ***p < 0.001.
Gene expression analysis of the injured muscle tissue on days 1 and 3, the acute phase after muscle injury, showed that the transcript levels of several genes related to inflammation and inflammatory pain (IL-6, IL-10, IL-1β, TNF-α, IL-1Ra, COX-1, COX-2, NGF) and macrophage marker molecules (CD68, ADGRE1, CD206, Arg1) were significantly lower in the hematoma removal group compared to the control group (Fig. 5). However, no significant differences were observed in the transcript levels of genes related to myogenic differentiation (Fig. 6).
Fig. 5.
Comparison of gene expression related to inflammation and macrophages. Gene expression analysis by quantitative polymerase chain reaction using samples obtained on days 1, 3, and 14 post laceration. Data are shown as mean ± SD (n = 4 per group). *p < 0.05, **p < 0.01, ***p < 0.001.
Fig. 6.
Comparison of gene expression related to myogenesis. Gene expression analysis by quantitative polymerase chain reaction using samples obtained on days 1, 3, 14, and 28 post laceration. Data was shown as mean ± SD (n = 4 per group). *p < 0.05, **p < 0.01, ***p < 0.001.
The effects of hematoma removal and the anti-inflammatory drug meloxicam administration were compared in animals 3 days after muscle injury (Fig. 7). The meloxicam group showed a significant improvement in twitch force compared with the no treatment group (Fig. 7A). However, a comparison of the hematoma removal group and the Meloxicam group revealed significantly greater improvements in both tetanic force and twitch force in the hematoma removal group. Histological evaluation revealed that the abnormal area in the hematoma removal group was smaller than in the meloxicam group (Fig. 7B). Meanwhile, gene expression analysis revealed significantly lower expression of several inflammation, inflammatory pain, and macrophage markers, including COX-2, in the Meloxicam group (Fig. 7C).
Fig. 7.
Comparison of the effects of hematoma removal and Meloxicam, commonly used nonsteroidal anti-inflammatory drug. (A) Functional recovery post-laceration. Comparisons of twitch and tetanic force among groups at day 3. (B) Quantification of abnormal areas at day 3 (n = 4 per group). (C) Gene expression analysis by quantitative polymerase chain reaction using samples obtained at day 3 post-laceration. Data was shown as mean ± SD (n = 4 per group). *p < 0.05, **p < 0.01, ***p < 0.001.
Discussion
In this study, using a rat laceration model, we demonstrated that removing the muscular hematoma 6 h after laceration injury suppressed the expression of inflammation-related genes in the acute and subacute phases, reduced the formation of abnormal tissue, and promoted muscle strength recovery.
The 2016 GOTS expert meeting recommended that in cases of muscular injury with hematoma, evaluation should occur within 48 h and removal should be carried out within two–five days post-trauma17. Another report emphasized the importance of early hematoma removal to avoid coagulation complications, which could complicate subsequent procedures3. This study showed that removing the hematoma within six hours of injury reduced the volume of the hematoma 24 h after injury and had a positive effect on subsequent recovery. However, sufficient preparation of the medical system at clinics and hospitals is necessary to perform early hematoma removal. The timing of hematoma removal after injury is also an important topic for future research on the initial treatment of muscle injuries.
Several clinical studies have revealed the relationship between muscular hematoma removal and tissue damage or abnormal tissue formation18,19. In addition, a study examining the effects of hematoma aspiration using a rat intracerebral hematoma model confirmed that hematoma aspiration reduced the hematoma, lesion volume, and neutrophil infiltration around the hematoma20. Although the tissues and organs were different, the effects of muscular hematoma removal on tissue damage and healing were similar to those observed in this study. Hematoma removal is thought to reduce tissue damage and the volume of abnormal tissue formed through two mechanisms: a reduction in the area occupied by the hematoma, inflammation, and macrophage infiltration17,21.
To investigate the mechanism by which hematoma removal contributes to recovery after muscle injury, we compared it with the anti-inflammatory drug meloxicam treatment. Although the expression of multiple inflammation-related factors, including COX-2, and macrophage marker molecules was more strongly suppressed in the meloxicam group, muscle strength recovery was better in the hematoma removal group. These findings suggest that the therapeutic effect of hematoma removal is primarily related to the injured tissue formation22. Previous studies on muscle recovery have consistently shown that a reduction in injured and fibrotic tissues and an increase in regenerated fibers contribute to improved functional outcomes23,24. For example, treatment with losartan alone or in combination with muscle-derived stem cells promoted muscle regeneration and improved muscle strength in a mouse contusion injury model19,25–27. While this study did not confirm an enhancement of muscle regeneration, there was a significant difference in the volume of scar tissue interposed between healthy and intact tissues, which may have affected the muscle output. Furthermore, excessive inflammation and increased macrophage activity have been shown to inhibit satellite cell recruitment and impair muscle regeneration and strength recovery28. While the inflammatory response is known to be essential for tissue regeneration29, hematoma removal may also be valuable as a method for suppressing excessive inflammatory responses, and this remains a topic of future research.
This study had several limitations. First, the timing of hematoma removal was only examined 6 h after muscle injury. Because the timing at which hematoma removal is possible varies in actual clinical settings, it is necessary to examine the effects of multiple hematoma removals on muscle injury healing. Second, the laceration injuries used in this study differed from muscle contusions and strains, which account for the majority of muscle injuries in clinical practice. Future studies using other muscle-injury models are warranted. Third, resting the affected area after muscle injury is essential; however, there are limitations to studying this in animal models. Therefore, clinical research within ethically acceptable limits is desirable. Finaly, Finally, the mechanism by which hematoma removal has a therapeutic effect on acute and subacute recovery after muscle injury remains unclear. This study suggests that the mechanism of action is a reduction in abnormal tissue formation and suppression of excessive inflammation, but further detailed verification is needed.
In conclusion, this study demonstrates that early removal of muscular hematoma after skeletal muscle injury can attenuate inflammation, reduce abnormal tissue formation, and contribute to improved muscle strength recovery. These findings support those of previous reports emphasizing the benefits of early hematoma evacuation in limiting tissue damage and preserving muscle function. Although the optimal timing and applicability to different injury types remain to be clarified, our results suggest that prompt hematoma management could be an important consideration in the initial treatment strategy for muscle injuries.
Methods
Ethics statement
All animal experimental protocols were approved by the Osaka University Animal Care and Use Committee (approval no.04-003-003), and all procedures adhered to the ARRIVE guidelines. All methods were performed in accordance with the relevant guidelines and regulations. The anesthesia and euthanasia methods used for experimental animals were those recommended by the American Veterinary Medical Association (AVMA), and this study did not involve animals that are part of the IUCN Policy Statement on Research on Endangered Species or the Convention on Trade in Endangered Species of Wild Fauna and Flora (CTA).
Animal model
A total of 92 eight-week-old Lewis rats (94 males and 8 females; CLEA Japan, Japan) were used in this study. Male rats weighed 260–290 g, and female rats weighed 170–200 g. As with many previous reports, male rats were the primary subjects. A small number of female rats were used to examine sex-related differences in the main results. Animals were housed under a 12-hour light/dark cycle at a constant temperature (23 ± 2 °C) with ad libitum access to food and water. A mixture of three agents was administered intraperitoneally to achieve analgesia and sedation: medetomidine (Domitor; Nippon Zenyaku Kogyo Co. Ltd., Koriyama, Japan) 0.3 mg/kg; midazolam (Dormicum; Maruishi Pharmaceutical Co. Ltd., Osaka, Japan) 4.0 mg/kg; and butorphanol (Vetorphale; Meiji Seika Pharma Co. Ltd., Tokyo, Japan) 5.0 mg/kg. A TA muscle laceration model was established on the left hind limb, following the procedure described by Abreu et al.15, in which animals were anesthetized via subcutaneous injection of a combination of medetomidine, midazolam, and butorphanol, followed by atipamezole for reversal. Hair on the surgical site was removed using an electric shaver and depilatory cream. The left hind limb was immobilized, and a longitudinal skin incision was made to expose the TA muscle. The fascia was carefully incised and a standardized laceration was created at 60% of the muscle length from the distal insertion, involving 75% of the muscle width and 50% of its thickness (Fig. 2a). The fascia and skin were sutured in layers and the animals were allowed unrestricted movement postoperatively.
Surgical removal of hematoma
Six hours post-laceration, the animals were re-anesthetized using the same protocol. The previous skin and fascial incisions were reopened to expose the wound. Hematoma evacuation was performed by repeated irrigation using 150 µl of sterile saline aspirated via a pipette (200 µl capacity) until the semi-coagulated hematoma was completely removed (Fig. 2a–c). In the sham surgery group, only the skin and fascial incisions were reopened and re-sutured. In this group, hematoma removal was not performed.
Muscle force measurement
Maximal isometric force of the TA muscle was assessed using a nerve-stimulated muscle contraction protocol. Hair was removed from the region extending from the ankle to 3 cm above the ischial tuberosity using an electric shaver, followed by the application of a depilatory cream (Veet, Reckitt Benckiser, France) for 5 min. After complete hair removal, the skin and superficial fascia were incised along the anterior aspect of the limb from the ankle to the ischium using ophthalmic scissors. The distal tendon of the TA muscle was carefully dissected, transected, and secured using a surgical suture thread (Alfresa, Japan), which was then connected to a force transducer (Unk Esunk Center, Japan). To enable electrical stimulation, the gluteus maximus tendon was retracted to expose the sciatic nerve. The nerve was gently isolated from the surrounding fascia and a nerve stimulation probe (Unique Medical, Japan) was positioned in direct contact with the sciatic nerve. Electrical stimulation was applied and the resulting isometric contraction of the TA muscle was recorded using a force transducer system. Muscle force data were collected and analyzed to quantify functional recovery.
Tissue processing and frozen section preparation
Following the completion of the experimental period, the rats were humanely euthanized by vascular exsanguination under anesthesia using isoflurane (VTRS, VIATRIS, USA). Excised TA muscle tissue was rapidly frozen in liquid nitrogen and stored at − 80 °C. Prior to sectioning, muscle samples were trimmed by removing one-quarter of the total muscle length from both the proximal and distal ends. The middle portion was embedded in a sagittal orientation and sectioned at 8 μm using a Leica CM1860UV cryostat (Leica, Germany). The central sections were used for staining, and the remaining tissue was processed for RNA extraction using TRIzol reagent.
Tissue processing and frozen section preparation
Three nonoverlapping sections were randomly selected for each sample. Images were acquired using a BX53/DP74 microscope (Olympus) to ensure complete sagittal coverage. ImageJ software (Image-Pro Plus, Version 9.0; Media Cybernetics, USA) was used for area quantification.
Measurements of hematoma size and abnormal area after injury
To evaluate the extent of tissue damage following injury, we measured the size of the hematoma and abnormal muscle area on histological sections stained with hematoxylin and eosin (H&E). A hematoma was defined as a clearly demarcated, non-muscular region characterized by the accumulation of erythrocytes and fibrin, often presenting as a darkly stained, amorphous area with loss of normal muscle architecture, as previously described30. Abnormal areas were defined as regions showing disrupted muscle fiber alignment, increased interstitial space, and cellular infiltration, consistent with the prior criteria for muscle injury31. For each lesion, three cryosections containing the largest hematoma or abnormal area were selected for quantification. Images of the sections were captured under a light microscope (×40 magnification), and the regions of interest were manually outlined using the ImageJ software (National Institutes of Health, USA). The area (in mm²) of both the hematoma and the abnormal region was calculated using the “Polygon Selection” tool, followed by the “Measure” function under standardized threshold settings. Calibration was performed using a scale bar for each image to ensure consistent pixel-to-distance conversion across all samples. All measurements were performed by 3 independent investigators who were blinded to the experimental conditions. The average of three sections was used as the representative value for each sample.
Gene expression analysis
Total RNA was extracted from lacerated TA muscle tissue using TRIzol reagent (Invitrogen) and purified using a PureLink RNA Purification Kit (Thermo Fisher Scientific). cDNA was synthesized using a High-Capacity RNA-to-cDNA Kit (Thermo Fisher Scientific). Quantitative real-time PCR (qRT-PCR) was performed using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) and gene-specific primers (Table 1). GAPDH was used as the internal control, and relative mRNA expression levels were calculated using the ΔΔCt method.
Table 1.
Primer sequences for real-time reverse transcriptase (RT)-polymerase chain reaction (PCR).
| Genes | Primer sequences (5’-3’) |
|---|---|
| COX-1 |
(Forward) GCC GGA TTG GTG GGG GTA G (Reverse) AGG GGC AGG TCT TGG TCT TGG TGT TG |
| COX-2 |
(Forward) CTG TAT CCC GCC CTG CTG GTG (Reverse) ACT TGC GTT GAT GGT GGC TGT CT |
| NGF |
(Forward) TGA CTC CAA GCA CTG GAA CTC AT (Reverse) GTT TGT CGT TTG TTT GTC ACG C |
| ADGRE1 |
(Forward) ACA CCC TTG GGA GCT ACT TC (Reverse) AGC TGC AGT TGT AGG AAC CT |
| CD68 |
(Forward) TGT ACC TGA CCC AGG GTG GAA (Reverse) GAA TCC AAA GGT AAG CTG TCC GTA A |
| CD206 |
(Forward) CTC TAA GCG CCA TCT CCG TT (Reverse) ATG ATC TGC GAC TCC GAC AC |
| ARG-1 |
(Forward) CCA GTA TTC ACC CCG GCT AC (Reverse) ACA AGA CAA GGT CAA CGC CA |
| IL-1Ra |
(Forward) AAG ACC TTC TAC CTG AGG AAC AAC C (Reverse) GCC CAA GAA CAC AAC ATT CCG AAA GTC |
| IL-10 |
(Forward) GCAGGACTTTAAGGGTTACTTGG (Reverse) GGGGAGAAATCGATGACAGC |
| TNF-α |
(Forward) GCT CCC TCT CAT CAG TTC CA (Reverse) TGT GGG TGA GGA GGA GCA CAT AG |
| IL-6 |
(Forward) TGT GCA ATG GCA ATT CTG AT (Reverse) GAG CAT TGG AAG TTG GGG TA |
| IL-1β |
(Forward) AGG CTT CCT TGT GCA AGT GT (Reverse) TGA GTG ACA CTG CCT TCC TG |
| TGF-β |
(Forward) TGC TGT AAC CTT CCC AGG ACC A (Reverse) GTG AGG GGG TAG CGA CAG CAC |
| GAPDH |
(Forward) GGC ACA GTC AAG GCT GAG AAT G (Reverse) ATG GTG GTG AAG ACG CCA GTA |
COX, cyclooxygenase; NGF, nerve growth factor; ADGRE, adhesion G protein-coupled receptor; CD, cluster of differentiation; ARG, arginase; IL, interleukin; TNF, tumor necrosis factor; TGF, transforming growth factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Preparation and administration of meloxicam
The drug solution was adjusted and administered based on previous reports32,33. Meloxicam (FUJIFILM, Japan) was dissolved in dimethyl sulfoxide (DMSO) to prepare a stock solution (30 mg/mL), which was subsequently diluted with sterile 0.9% sodium chloride solution to obtain a final injectable solution with a concentration of 1.2 mg/mL Meloxicam was administered by subcutaneous injection immediately after surgery, followed by repeated injections at 24-hour intervals. The target dose for each injection was 0.2 mg per 100 g body weight, corresponding to an injection volume of 0.5 mL of the prepared solution per rat.
Statistical analysis
All data are presented as means ± standard error of the mean (SEM). Statistical analyses were performed using GraphPad Prism software (version 9.0; GraphPad Software, San Diego, CA, USA). Differences between the two groups were assessed using an unpaired two-tailed Student’s t-test. A one-way analysis of variance was used for comparisons between more than two groups, one-way analysis of variance (ANOVA). Statistical significance was set at p < 0.05. significant.
Supplementary Information
Below is the link to the electronic supplementary material.
Acknowledgements
We would like to thank Editage (www.editage.jp) for the English language editing. This study was supported by JSPS KAKENHI grants (grant # JP 20K11360 to T. K. and grant # JP 22K19751 to N. K.).
Author contributions
Y.R.: Data curation, formal analysis, Investigation, Methodology, Writing of the original draftT.K.: Conceptualization, Data curation, formal analysis, funding acquisition, Investigation, Methodology, Writing – original draft, writing – review, and editingR.M.: Investigation, Writing – review & editing.Z.Z.: Investigation, Writing – review & editing.R.H.: Investigation, Writing – review & editing.K.E.: Supervision, Writing – review & editingH.T.: Supervision, Writing – review & editingK.N.: Conceptualization, Funding acquisition, Supervision, Writing – review & editing.
Funding
This study was supported by JSPS KAKENHI grants (grant # JP 20K11360 to T. K. and grant # JP 22K19751 to N. K.).
Data availability
The datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Kieb, M., Lorbach, O. & Engelhardt, M. Muscle injuries: diagnostics and treatments. Orthopade39, 1098–1107 (2010). [DOI] [PubMed] [Google Scholar]
- 2.Edouard, P. et al. Traumatic muscle injury. Nat. Rev. Dis. Primers. 9, 56 (2023). [DOI] [PubMed] [Google Scholar]
- 3.Quiñones, P. K., Hattori, S., Yamada, S., Kato, Y. & Ohuchi, H. Ultrasonography-Guided muscle hematoma evacuation. Arthrosc. Tech.8, e721–e725 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Paoletta, M. et al. Ultrasound imaging in Sport-Related muscle injuries: pitfalls and opportunities. Med. (Kaunas)57, 785 (2021). [DOI] [PMC free article] [PubMed]
- 5.Xiao, W., Liu, Y. & Chen, P. Macrophage depletion impairs skeletal muscle regeneration: the roles of Pro-fibrotic Factors, Inflammation, and oxidative stress. Inflammation39, 2016–2028 (2016). [DOI] [PubMed] [Google Scholar]
- 6.Gardner, T., Kenter, K. & Li, Y. Fibrosis following acute skeletal muscle injury: mitigation and reversal potential in the clinic. J. Sports Med. (Hindawi Publ. Corp.)2020, 7059057 (2020). [DOI] [PMC free article] [PubMed]
- 7.Alessandrino, F. & Balconi, G. Complications of muscle injuries. J. Ultrasound. 16, 215–222 (2013). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Kasemkijwattana, C. et al. Development of approaches to improve the healing following muscle contusion. Cell. Transpl.7, 585–598 (1998). [DOI] [PubMed] [Google Scholar]
- 9.Fernandes, T. L., Pedrinelli, A. & Hernandez, A. J. Muscle injury - physiopathology, diagnosis, treatment and clinical presentation. Rev. Bras. Ortop. (Sao Paulo). 46, 247–255 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Beggs, I. Biological basis of treatments of acute muscle injuries: a short review. Semin Musculoskelet. Radiol.24, 256–261 (2020). [DOI] [PubMed] [Google Scholar]
- 11.SantAnna, J. P. C., Pedrinelli, A., Hernandez, A. J. & Fernandes, T. L. Muscle injury: pathophysiology, diagnosis, and treatment. Rev. Bras. Ortop. (Sao Paulo). 57, 1–13 (2022). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Sales, R. M. et al. Treatment of acute thigh muscle injury with or without hematoma puncture in athletes. Rev. Bras. Ortop. (Sao Paulo). 54, 6–12 (2019). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Palatucci, V. et al. Spontaneous muscle haematomas: management of 10 cases. Transl Med. UniSa. 10, 13–17 (2014). [PMC free article] [PubMed] [Google Scholar]
- 14.Trunz, L. M. et al. Effectiveness of hematoma aspiration and Platelet-rich plasma muscle injections for the treatment of hamstring strains in athletes. Med. Sci. Sports Exerc.54, 12–17 (2022). [DOI] [PubMed] [Google Scholar]
- 15.Abreu, P., Marzuca-Nassr, G. N., Hirabara, S. M. & Curi, R. Experimental model of skeletal muscle laceration in rats. Methods Mol. Biol.1735, 397–401 (2018). [DOI] [PubMed] [Google Scholar]
- 16.De la Corte-Rodriguez, H. & Rodriguez-Merchan, E. C. Treatment of muscle haematomas in haemophiliacs with special emphasis on percutaneous drainage. Blood Coagul Fibrinolysis. 25, 787–794 (2014). [DOI] [PubMed] [Google Scholar]
- 17.Hotfiel, T. et al. Nonoperative treatment of muscle injuries - recommendations from the GOTS expert meeting. J. Exp. Orthop.5, 24 (2018). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Liu, H. et al. Case report: Ultrasound-guided percutaneous drainage combined with lavage using urokinase: an economical and effective treatment for muscular hematomas in hemophiliacs. Front. Surg.10, 1023329 (2023). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Taylor, D. C., Dalton, J. D., Seaber, A. V. & Garrett, W. E. Experimental muscle strain injury. Early functional and structural deficits and the increased risk for reinjury. Am. J. Sports Med.21, 190–194 (1993). [DOI] [PubMed] [Google Scholar]
- 20.Sang, Y. H. et al. Rat model of intracerebral hemorrhage permitting hematoma aspiration plus intralesional injection. Exp. Anim.62, 63–69 (2013). [DOI] [PubMed] [Google Scholar]
- 21.Baoge, L. et al. Treatment of skeletal muscle injury: a review. ISRN Orthop.2012, 689012 (2012). [DOI] [PMC free article] [PubMed]
- 22.Laumonier, T. & Menetrey, J. Muscle injuries and strategies for improving their repair. J. Exp. Orthop.3, 15 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Marmolejo-Martínez-Artesero, S., Romeo-Guitart, D., Venegas, V., Marotta, M. & Casas, C. NeuroHeal improves muscle regeneration after injury. Cells10, 586 (2020). [DOI] [PMC free article] [PubMed]
- 24.Sato, K. et al. Improvement of muscle healing through enhancement of muscle regeneration and prevention of fibrosis. Muscle Nerve. 28, 365–372 (2003). [DOI] [PubMed] [Google Scholar]
- 25.Bayer, M. L. et al. Role of tissue perfusion, muscle strength recovery, and pain in rehabilitation after acute muscle strain injury: a randomized controlled trial comparing early and delayed rehabilitation. Scand. J. Med. Sci. Sports. 28, 2579–2591 (2018). [DOI] [PubMed] [Google Scholar]
- 26.Hadipour-Lakmehsari, S. & Al Mouaswas, S. Reduction of pain and improved muscle biology with the administration of Losartan and delayed exercise in a murine trauma model. J. Physiol.598, 631–632 (2020). [DOI] [PubMed] [Google Scholar]
- 27.Kobayashi, M. et al. The combined use of Losartan and muscle-Derived stem cells significantly improves the functional recovery of muscle in a young mouse model of contusion injuries. Am. J. Sports Med.44, 3252–3261 (2016). [DOI] [PubMed] [Google Scholar]
- 28.Tidball, J. G., Flores, I., Welc, S. S., Wehling-Henricks, M. & Ochi, E. Aging of the immune system and impaired muscle regeneration: A failure of Immunomodulation of adult myogenesis. Exp. Gerontol.145, 111200 (2021). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Chazaud, B. Inflammation and skeletal muscle regeneration: leave it to the Macrophages! Trends Immunol.41, 481–492 (2020). [DOI] [PubMed] [Google Scholar]
- 30.Nishida, Y. et al. Chronic expanding hematoma with a significantly high Fluorodeoxyglucose uptake on 18F-fluorodeoxyglucose positron emission tomography, mimicking a malignant soft tissue tumor: a case report. J. Med. Case Rep.8, 349 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Santocildes, G., Viscor, G., Pagès, T. & Torrella, J. R. Simulated altitude is medicine: intermittent exposure to hypobaric hypoxia and cold accelerates injured skeletal muscle recovery. J. Physiol.602, 5855–5878 (2024). [DOI] [PubMed] [Google Scholar]
- 32.Alemán-Laporte, J. et al. Behavioral assessment of Tramadol and meloxicam effects on postoperative pain in a rat craniotomy model. J. Am. Assoc. Lab. Anim. Sci.64, 1–10 (2025). [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Chen, P. H., Boyd, K. L., Fickle, E. K. & Locuson, C. W. Subcutaneous meloxicam suspension pharmacokinetics in mice and dose considerations for postoperative analgesia. J. Vet. Pharmacol. Ther.39, 356–362 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.







