Abstract
Host expansion facilitates tephritid flies to expand their ranges. Unraveling the mechanisms of host expansion will help to efficiently control these pests. Our previous works showed mitochondrial complex I genes Ndufs1, Ndufs3, and Ndufa7 being upregulated during host expansion of Bactrocera tau (Walker), one of the highly hazardous species of tephritids. However, their roles in the host expansion of B. tau remain unknown. Here, using clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR‐associated nuclease 9 (Cas9) editing system for the first time, a stable homozygous Ndufa7 strain (Btndufa7−/− ), heterozygous Ndufs1 (Btndufs1+/− ), and Ndufs3 strains (Btndufs3+/− ) were obtained from F3 generation of B. tau, after gene knockout. Reduced sizes of larvae and pupae of the Ndufa7 knockout strain were first observed. Notably, the mean values of fitness estimation (pupal numbers, single‐pupal weight and emergence rate) and Ndufa7 gene expression in the Ndufa7 knockout strain were slightly reduced on 2 native hosts (summer squash and cucumber), while it sharply decreased on the novel host banana and the potential host pitaya, compared with those of the wild‐type strain. Furthermore, the Ndufa7 knockout strain did not survive on the novel host guava. These results suggested that Ndufa7 disturbs the survival on native hosts, expansion to novel hosts, and further expansion to potential hosts of B. tau. Homozygous lethality occurred after the knockout of Ndufs1 or Ndufs3, suggesting that these 2 genes play a role in the early development of B. tau. This study revealed that Ndufa7 is a target gene for the management of tephritids and opens a new avenue for pest control research.
Keywords: Bactrocera tau, gene knockout, host expansion, invasive pests, mitochondrial complex I gene, tephritids
The role of 3 mitochondrial complex I gene in host expansion of Bactrocera tau was verified by CRISPR/Cas9 gene editing system. A stable homogenous strain (Btndufa7‐/‐) of B.tau was established after silencing Ndufa7. The reduced size of larvae and pupae of Ndufa7 knockout strain was first found.Then different levels of fitness and relative expression of Ndufa7 gene of B.tau on various host plants were found in Ndufa7 knockout strain. These results shown that Ndufa7 has a role in disturbing native hosts survival, novel hosts and potential host expansion of B.tau. Heterozygous B.tau strains Btndufs1+/‐ and Btndufs3+/‐ were obtained respectively in F3 generation and homozygous lethality occurred after knockout Ndufs1 and Ndufs3 genes. This result suggested that the two genes respectively had a role in tephritids early development.

Introduction
Host expansion refers to herbivores’ abilities to use novel hosts but not lose their abilities to use native hosts (Piñero et al., 2017). This phenomenon is common among phytophagous insects, including highly hazardous pests. Host expansion facilitates the spread of pests and causes severe damage (Charlery de la Masselière et al., 2017). Therefore, revealing the mechanisms of host expansion in herbivorous pests can help develop efficient ways to manage these pests.
Tephritid flies (Diptera) are invasive herbivorous pests that damage fruit and vegetables (Garcia et al., 2020). Host expansion is typical in tephritids such as Zeugodacus cucurbitae (Coquillett) (Vayssières et al., 2007), Rhagoletis pomonella (Walsh), and Bactrocera tau (Walker) (Shi et al., 2020a). B. tau, which mainly attacks hosts of the family Cucurbitaceae, is a highly hazardous species (Christenson & Foote, 1960). Recently, B. tau has expanded from native Cucurbitaceae hosts to other hosts across different genera (Sumrandee et al., 2011), such as Leguminosae (e.g., Phaseolus vulgaris L.) (Sumrandee et al., 2011), Myrtaceae (e.g., Psidium guajava L.) (Hasyim et al., 2008), and Sapotaceae (e.g., Manilkara zapota L.) (Huang et al., 2005). Overall, the host range of B. tau has expanded to include more than 80 species (Huang et al., 2005). Many of these novel hosts to which B. tau successfully expands are plants of tropical and sub‐tropical species (Zhang & Chen, 2018). Currently, B. tau is expanding northward in China. This species has been reported in Shanxi and Gansu (Wang et al., 1994; Yang et al., 1994), two northern Chinese provinces. The risk of B. tau expanding to other hosts, including temperate hosts, is increasing.
Tephritids must adapt to volatile organic compounds (VOCs) and other secondary metabolites in the novel host fruits to successfully expand and use a new host (Shi et al., 2022b). Different chemical stressors in different hosts drive multifaceted adaptations in flies, including behavioral, physical, and even neurological adaptations (Tallamy, 2000). Regardless of the adaptation type, gene activity is strongly involved in regulating these processes. Thus, exploring which genes contribute to the host expansion of tephritids is important for the development of new control technologies, such as RNA interference (RNAi) methods.
Taking B. tau as an example, high‐throughput sequencing has been used to search for genes related to host expansion in our previous works (Shi et al., 2020a). The subunits of mitochondrial complex I (CI), namely, Ndufs1, Ndufs3, and Ndufa7 (Su et al., 2016; Xiao et al., 2022) of B. tau feeding on the novel host banana were upregulated, but not feeding on native Cucurbitaceae hosts (Shi et al., 2020a). Moreover, the associated oxidative phosphorylation (OXPHOS) pathways of B. tau feeding on novel host bananas were highly enriched (Shi et al., 2020a). The OXPHOS pathway is mainly responsible for energy metabolism, which begins with mitochondrial CI (Ali & Dholaniya, 2022). Enrichment of the OXPHOS pathway further suggests that CI genes are involved in this process. Therefore, we hypothesized mitochondrial CI genes probably play roles in the host expansion of B. tau. Their roles in host expansion need to be further verified.
Host expansion of tephritids is a series of complex biological processes involving development, detoxification, digestion and so forth, which require a supply of energy. Here, we speculated that mitochondrial CI genes may be closely associated with the host expansion of invasive insects. In the present study, we focused on 3 mitochondrial CI genes (Ndufa7, Ndufs1, and Ndufs3) and examined whether they affected the host expansion ability of the invasive insect B. tau.
Materials and methods
Insects
Pumpkin (Cucurbita moschata) fruits damaged by B. tau were brought to the Yunnan University Laboratory in Yuanjiang County, Yuxi, Yunnan Province. These fruits were placed in a sandbox in a cage (30 cm × 30 cm × 60 cm) to hatch into pupae. After the pupae emerged into adults, only B. tau flies were continuously screened and reared. B. tau flies were fed fresh pumpkin slices to enlarge the population for subsequent experiments and were reared in a room at 25 ± 1 °C and 80% relative humidity.
Knockout of the 3 CI genes
Knockout gene selection and polymerase chain reaction (PCR) We targeted 3 mitochondrial CI genes, Ndufs1, Ndufs3, and Ndufa7, for knockout. Total RNA was extracted from an adult B. tau individual using TRIzol reagent (Invitrogen, CA, USA). Then, 1 µg of total RNA was reverse transcribed into complementary DNA (cdna) using a PrimeScript RT reagent Kit (Takara, Dalian, China). The protein‐coding regions of the 3 CI genes were amplified separately from the cdna templates using their respective primers (Table 1A). These primers were designed based on the corresponding sequences from Z. cucurbitae (LOC105212758, LOC105211095, and LOC105208622), a species related to B. tau. The PCR amplification was conducted using 2 × Tag PCR MasterMix (TIANGEN, Beijing, China) and a 3‐step generic PCR cycle: 95°C for 3 min, followed by 20 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min; then by 15 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for 1 min.
Table 1.
Primers and sequences
| (A) Primers used for polymerase chain reaction amplification of the 3 target genes. | |
|---|---|
| Primers (target sequencing) | Sequences |
| Ndufa7‐ID‐S (5′–3′) | GTGATGTTGCGACACTTCTTC |
| Ndufa7‐ID‐A (3′–5′) | CGCCAGGTGTTGGTAACTT |
| Ndufs1‐ID‐S (5′–3′) | AATTGTCGCATGTGCCTTGTA |
| Ndufs1‐ID‐A (3′–5′) | CGCCATAGCCTGATCTTGAAG |
| Ndufs3‐ID‐S (5′–3′) | ATATGTAGCCGAATGCCTTC |
| Ndufs3‐ID‐A (3′–5′) | GACTTCATTACACGAATCCAG |
| (B) Single guide RNA (sgRNA) target sequences and sgRNA sequences for the 3 complex I (CI) genes. | ||
|---|---|---|
| Genes | Target sequences (5ʹ–3ʹ) | sgRNA sequences (5ʹ–3ʹ) |
| Ndufa7 | CCTGGTGGTCCAGCACATTTAAT | GTTAAATGTGCTGGACCACC |
| Ndufs1 | CCGAGATGACCAGAAAAGCACGT | GCGTGCTTTTCTGGTCATCT |
| Ndufs3 | GAGGTTCTAATTGCACCTGAGGG | GAGGTTCTAATTGCACCTGA |
| (C) Primers used for gene expression determination. | |||
|---|---|---|---|
| Genes | Primer names | Primer sequences | Sizes of products |
| GAPDH | |||
| (reference gene) | GAPDH‐S (5ʹ–3ʹ) | TCGACAAGGCTTCTGCTCACT | 146 bp |
| Ndufa7 | GAPDH‐A (3′–5′) | GGTGCAAGAGGCATTAGATACGA | |
| Ndufa7‐S (5ʹ–3ʹ) | CTGACAAGGGCACCGCTAA | 252 bp | |
| Ndufa7‐A (3′–5′) | TGCCGACTGTGCGAGTTGTA | ||
Cloning and phylogenetic analysis The PCR amplification products were separated using 1.0% agarose gel electrophoresis, and the target amplicons were purified using a TaKaRa MiniBEST Agarose Gel DNA Extraction Kit (Takara, Dalian, China). Purified products were subsequently inserted into the pBlueScript SK vector (ZEYE, Shanghai, China) for sequencing. Amino acid sequences of the coding region (CDS) of B. tau for each CI gene were isolated.
The amino acid sequences of the 3 CI genes in the CDS region were subjected to homology analysis with those of other species using the National Center for Biotechnology Information (NCBI) PROTEIN BLAST (Basic Local Alignment Search Tool) to ensure 3 genes before gene knockout. The sequences were aligned using ClustalW, and a maximum likelihood phylogenetic tree was constructed based on the evaluated Dayhoff matrix model using MEGA v7.0 (Kumar et al., 2016) with 1 000 bootstrap replicates.
Gene knockout ribonucleoprotein (RNP) constructs Three Cas9 (clustered regularly interspaced short palindromic repeats [CRISPR]‐associated nuclease 9) – sgRNA (single guide RNA) RNP complexes were constructed separately to knock out each CI gene. Each RNP comprised a Cas9 protein and a sgRNA component. Each sgRNA was designed separately based on the sequences of the coding regions of each gene using the online tool CRISPR RGEN (http://crispor.tefor.net/). The 3 knockout sites are shown in Figs. 1 and 2. The sgRNA sites and protospacer adjacent motif (PAM) of each gene were designed to target exon 2 of Ndufa7 (marked in Fig. 1) and Ndufs1 and exon 4 of Ndufs3 (marked in Fig. 2). The sgRNA targets and sequences are listed in Table 1B. Three sgRNAs were produced with a MEGAshortscrip T7 Transcription Kit (Thermo Fisher Scientific, Vilnius, Lithuania), purified via a GeneArt Precision sgRNA Synthesis Kit (Invitrogen, Vilnius, Lithuania), and stored at −80 °C. The corresponding Cas9 protein (Invitrogen, Vilnius, Lithuania) was mixed with the sgRNAs and incubated at 37 °C for 30 min to form 3 independent Cas9‐sgRNA RNP (300 ng/µL sgRNA and 500 ng/µL Cas9 protein).
Fig. 1.

Information about the Ndufa7 strain of Bactrocera tau. Single guide RNA (sgRNA) target region is in exon 2. Yellow highlighting shows the sgRNA target sequence, and the 3 underlined bases are the protospacer adjacent motif (PAM) sites. WT represents the wild‐type sequence and its chromatogram. KO represents the mutational sequence of the F3 homozygotes (Bndufa7 −/−) and its chromatogram. The red dotted lines represent the deleted bases (−47).
Fig. 2.

Information about the Ndufs1 and Ndufs3 strains of Bactrocera tau. (A) Single guide RNA (sgRNA) target region of Ndufs1 is in exon 2. WT represents the wild‐type sequence, and KO represents the mutational sequence of the F3 heterozygotes (Bndufs1 +/−) after the Ndufs1 knockout; (B) sgRNA target region of Ndufs3 is in exon 4. WT represents the wild‐type sequence, and KO represents the mutational sequence of the F3 heterozygotes (Bndufs3 +/−) after the Ndufs3 knockout. The yellow highlights represent the sgRNA target sequences, and the 3 underlined bases are the protospacer adjacent motif (PAM) sites. The red dotted lines represent the deleted bases (−8 for Bndufs1 +/−, −4 for Bndufs3 +/−).
Three strains of B. tau after gene knockout Approximately 1 500 eggs collected from wild‐type females of B. tau after mating were used for Cas9‐sgRNA RNP injection. The eggs were cleaned with ultrapure water and then washed in a 1% sodium hypochlorite solution to remove the chorion. The eggs were placed in rows on microscope slides for microinjection. The eggs were covered with Halocarbon oil 700 (Sigma, MO, USA) before injection. Each of the 3 Cas9‐sgRNA RNP was injected into approximately 500 eggs. A microinjection system (Drummond, AL, USA) was used to inject RNP into the posterior pole of each egg within 30 min of egg laying. The injected eggs were then placed 3 isolated larval incubators (1 each RNP) for hatching. The larvae in each incubator were then transferred to 3 separate cages for adult emergence. Three gene strains of B. tau were established in 3 isolated cages and named NA7‐KO for the Ndufa7 knockout strain, NS1‐HT and NS3‐HT for B. tau strains after Ndufs1 and Ndufs3 knockout, respectively. The wild‐type strain of B. tau was named BAT‐WT.
Adults emerging from the injected eggs were regarded as zero generation (F0) for each strain. The F0 generation flies were crossed with wild‐type flies (WT). DNA was extracted from the whole bodies of F0 flies using a TiANamp Genomic DNA Kit (TIANGEN, Beijing, China), after which PCR amplification and sequencing were performed. PCR amplification was performed under the conditions described above (see “Knockout gene selection and PCR”). F0 fly genotypes were identified, and flies harboring mutations and WT alleles were retained. After the F0 flies of each strain laid eggs that hatched into the F1 generation, the F1 generation flies of each strain were crossed with BAT‐WT. Similarly, F1 flies laid eggs, and their genotypes were identified using sequencing. F1 generation flies with 2 types of alleles were maintained and their F2 generation offspring were crossed with one another. Individuals of the F3 generations were obtained, and F3 individuals, including dead and living individuals, were sequenced. As many homozygous flies as possible were obtained for each gene strain after identifying the F3 flies.
Fitness estimation
Host plants determination We screened host fruits to examine whether the host fitness of B. tau reared on various host fruits changed before and after gene knockout (3 CI genes). Based on previous reports (Huang et al., 2005; Lin et al., 2005; Hasyim et al., 2008; Zhang & Chen, 2018; Shi et al., 2020a; Shi et al., 2022b) and odor attraction test of some fruits (see Fig. S1), 2 native cucurbit hosts (summer squash, Cucurbita pepo var. fastigata L.; cucumber, Cucumis sativus L.), and 2 novel hosts (banana, Musa paradisiaca Colla; guava, Psidium guajava) were tested first. Pitaya (Hylocereus undulatus Britt) and apple (Malus pumila Million, a temperate fruit) were hypothesized to be potential hosts of B. tau based on our odor attraction test (Fig. S1). In the present study, we attempted to estimate the possibility of B. tau expanding to 2 hosts. Notably, although apple odors attracted B. tau, we found that B. tau laid very few eggs on apples and B. tau did not rear on apples continuously after actual rearing of B. tau on this host. Therefore, we did not use apples in subsequent tests. Therefore, summer squash, cucumber, banana, guava, and pitaya fruits were used to continuously evaluate the fitness of B. tau.
Fitness estimation before gene knockout We first performed a fitness evaluation of BAT‐WT in the 5 hosts previously mentioned. In total, 150 BAT‐WT adults reared on pumpkin fruits were evenly transferred to 5 cages with different host fruits. Each cage contained 30 BAT‐WT adults, including 15 females and 15 males. Slices and whole fruits were provided to B. tau for feeding and laying eggs, respectively, in each cage. The B. tau adults were reared continuously for at least 3 generations on different hosts.
Three indices, including pupal number (PN), single‐pupal weight (SG), and emergence rate (ER), were used to estimate the fitness of Z. cucurbitae, Bactrocera zonata (Saunders), and B. tau on different hosts (Hafsi et al., 2016; Shi et al., 2017c). The mean values of each index from 3 generations (F3–F5) of each host were determined.
Fitness estimation after gene knockout We obtained a stable homogenous F3 generation only in NA7‐KO after gene knockout using the CRISPR‐Cas9 system. Homogenous lethality occurred in both the Ndufs1 and Ndufs3 strains. Therefore, we only estimated the fitness of the NA7‐KO in the 5 hosts. Adults from the F3 generation of NA7‐KO were transferred to 5 different expansion phases of host plants for at least 3 generations of rearing. Next, the mean values of the indices (PN, SG, and ER) from 3 continuous generations (F3–F5) were calculated to estimate host fitness for NA7‐KO on 5 host plants.
Relative expression levels of the Ndufa7 gene
Given the homogenous F3 generation of Ndufa7 B. tau strains, the relative gene expression levels of Ndufa7 were tested before and after the gene knockout. We first examined whether the relative expression of Ndufa7 in BAT‐WT changed when B. tau flies were fed native (summer squash and cucumber), novel (banana and guava) or potential host fruits (pitaya). Next, we examined whether the relative expression of the Ndufa7 gene of NA7‐KO changed when B. tau fed on the various hosts. This examination was conducted using quantitative real‐time PCR (qPCR) according to the manufacturer's instruction by using the StepOnePlus Real‐Time PCR System (Thermo Fisher Scientific, MA, USA). Gene‐specific primers are listed in Table 1C. GAPDH was used as an internal reference. The 3rd instar larvae of BAT‐WT and NA7‐KO reared on various hosts were collected for 3 continuous generations (F3–F5), and the relative gene expression levels of each generation were estimated. The mean values of the relative gene expression levels of BAT‐WT and NA7‐KO from continuous generations (F3–F5) were also estimated.
Statistical analysis
Data are presented as means ± standard error (SEs). The statistical significance of the differences was determined using SPSS v23.0 (SPSS, IL, USA). Differences between fitness indices and gene expression levels pre‐ and post‐gene knockout were compared using unpaired t‐tests. Statistical significance was set at *P < 0.05; **P < 0.01; ***P < 0.001.
Results
Knockout of 3 CI genes
Homology comparison The amino acid sequences of B. tau in the coding region of each target gene were obtained, that is, 98, 736 and 264 amino acids in Ndufa7, Ndufs1, and Ndufs3, respectively (Fig. S2). The amino acid sequences of each gene were phylogenetically analyzed and compared with those of other homologous species to ensure the 3 target genes before gene knockout. The amino acid variations in the coding region of each gene of B. tau and its top 4 BLAST hits are shown in Fig. S2. The Ndufa7 amino acid sequence of BAT‐WT was highly homologous to those of other tephritids, such as Z. cucurbitae, Bactrocera dorsalis, and Anastrepha ludens (Loew) (see Figs. 3A and S2). The amino acid sequences of Ndufs1 and Ndufs3 in BAT‐WT were highly homologous to those of other tephritid species, including Bactrocera oleae (Rossi), Z. cucurbitae, B. dorsalis, and Bactrocera tryoni (Froggatt) (Figs. 3B,C, and S2). These results suggested that the 3 target genes belong to the mitochondrial CI of tephritids (Diptera).
Fig. 3.

Phylogenetic trees constructed based on the results of homologous comparisons of the 3 complex I (CI) genes from other homologous species of Bactrocera tau. (A) Phylogenetic tree of Ndufa7 amino acid sequences of B. tau and its homologous species; (B) phylogenetic tree of Ndufs1 amino acid sequences of B. tau and its homologous species; (C) phylogenetic tree of Ndufs3 amino acid sequences of B. tau and its homologous species.
ER and B. tau strain identification After gene knockout, pupae of the F3 generation of each strain were obtained through several rounds of crossing using the F0–F2 knockouts. The emergence rates of the F3 pupae were 54%, 23%, and 30% for NA7‐KO, NS1‐HT, and NS3‐HT, respectively.
The enclosed F3 adults of the NA7‐KO were identified as homozygous (Btndufa7−/−) based on sequencing chromatograms (Figs. 1 and S3). It showed that the NA7‐KO F0 to F2 individuals were heterozygous, but the F3 individuals were homozygous (unimodal chromatograms). However, the individuals of the NS1‐HT and NS3‐HT from the F0 to F3 generations were identified as heterozygous (Btndufs1 +/− and Btndufs3 +/−, multimodal chromatograms) without homozygous individuals, as shown in Fig. S3. Some dead F3 pupae or adults of NS1‐HT and NS3‐HT were randomly selected for sequencing. Most of the sequences from dead B. tau were homozygous according to unimodal chromatograms (74% of F3 dead flies of NS1‐HT and 82% of F3 dead flies of NS3‐HT). Therefore, homozygous lethality occurred in NS1‐HT and NS3‐HT.
Deleted nucleobases and phenotype variation The deleted parts of the 3 strains were evaluated after gene knockout (Figs. 1 and 2). In total, 47, 8, and 4 bp nucleobases of Ndufa7, Ndufs1, and Ndufs3, respectively, were deleted.
Eggs with young layers (Fig. 4A) were selected to be injected with knockout RNP because they are more active. There were no apparent differences in the phenotypes of eggs before and after the knockout among the 3 strains (Fig. 4A, B). However, differences in phenotypes were observed between larvae and pupae pre‐ and post‐knockout (Figs. 4C,D). In particular, the post‐knockout larvae and pupae from the NA7‐KO F3 generation were significantly smaller than those from the pre‐knockout generations. However, no noticeable phenotypic differences were observed in larvae or pupae post‐knockout for the other 2 gene strains (NS1‐HT and NS3‐HT).
Fig. 4.

Comparison of the Bactrocera tau phenotypes pre‐ and post‐knockout. (A) Eggs of B. tau pre‐knockout (red circle indicating young layer); (B) eggs of B. tau post‐knockout; (C) comparison of larvae pre‐ and post‐knockout. The upper panel shows the larvae of the wild‐type, and the lower panel shows the larvae of the strains after post‐knockout. (D) Comparison of pupae pre‐ and post‐knockout. The upper panel shows pupae of the wild‐type, and the lower panel shows pupae of the strains post‐knockout. A scale bar is provided in each image. Ndufa7 (Bndufa7 −/−), Ndufs1 (Bndufs1 +/−), and Ndufs3 (Bndufs3 +/−) are 3 complex I (CI) genes (gene type for B. tau of F3 generation post‐knockout).
Fitness variation in Ndufa7 pre‐ and post‐knockout
Fitness was estimated using 3 fitness indices (SG, PN, and ER) for B. tau reared on native, novel, and potential hosts pre‐ and post‐knockout of the Ndufa7 gene.
First, the 3 fitness indices showed that both BAT‐WT and NA7‐KO flies could continuously rear well on 2 native cucurbit hosts when transferred from the native pumpkin host (Fig. 5A). However, the 3 fitness indices of NA7‐KO reared on the 2 native hosts decreased slightly compared with that of NA7‐WT (P < 0.05, Fig. 5A), suggesting that Ndufa7 knockout impaired the adaptability of B. tau to spread to the 2 native hosts. Second, the 3 fitness indices showed that BAT‐WT flies reared well on novel hosts banana and guava for continuous generations (Fig. 5A). NA7‐KO flies could still continuously rear on banana. However, there were significant decreases in the fitness indices of NA7‐KO reared on banana compared with those of BAT‐WT (P < 0.01, Fig. 5A). Furthermore, NA7‐KO could not rear guava at all, thus lacking fitness data (Fig. 5A). These results suggested that Ndufa7 knockout largely impaired the adaptability of B. tau to the 2 novel hosts after expansion from the pumpkin host. Finally, BAT‐WT and NA7‐KO flies could continuously rear well on a potential host, pitaya. However, there were significant decreases in the fitness indices of NA7‐KO compared with those of BAT‐WT (P < 0.01, Fig. 5A), indicating that Ndufa7 knockout had a large effect on the adaptability of B. tau to a potential host, that is, pitaya, after host expansion from pumpkin hosts.
Fig. 5.

Fitness variation and relative gene expression levels of Ndufa7. (A) Fitness of Bactrocera tau on various hosts. Ndufa7 pre‐knockout (pre‐KO) (purple columns): mean values of each index (single‐pupal weight [SG], pupal number [PN] and emergence rate [ER]) from continuous 3 generations (from F3 to F5) of B. tau before Ndufa7 knockout. Ndufa7 Post‐KO (pink columns): mean values of each index from continuous 3 generations (from F3 to F5) NA7‐KO of B. tau. Significant differences between mean values of Ndufa7 pre‐KO and Ndufa7 post‐KO were estimated by t‐test and indicated by asterisks (* P < 0.05; ** P < 0.01). Note: NA7‐KO cannot rear on guava at all (no data). (B) Mean values of relative gene expression levels of Ndufa7. Given only homogenous F3 generation of Ndufa7 B. tau strains, relative expression levels of the Ndufa7 gene were tested before and after Ndufa7 knockout. Ndufa7 pre‐KO (dark green columns): means of Ndufa7 expression levels of B. tau larvae from continuous 3 generations (F3–F5) that were reared on 5 various hosts before Ndufa7 knockout. Ndufa7 post‐KO (light green columns): means of Ndufa7 expression levels of B. tau larvae from continuous 3 generations (F3–F5) that were reared on 4 hosts after Ndufa7 knockout. Differences between mean values of Ndufa7 pre‐KO and Ndufa7 post‐KO were estimated using a t‐test. The significance is indicated by asterisks (**P < 0.01; ***P < 0.001). Note: NA7‐KO did not survive on guava (no data).
Therefore, the Ndufa7 gene was involved in the survival of B. tau on native hosts and in the expansion of B. tau to novel and potential hosts.
Relative expression levels of Ndufa7 gene
We also examined the relative gene expression levels of Ndufa7 following B. tau rearing on native, novel, and potential hosts pre‐knockout of the Ndufa7 gene to further understand the role of Ndufa7 in host expansion of B. tau. However, NA7‐KO did not survive on guava; therefore, we did not test Ndufa7 expression in NA7‐KO on guava (no data) but only on the 4 remaining hosts (summer squash, cucumber, banana, and pitaya) after Ndufa7 knockout.
First, the Ndufa7 gene was expressed in BAT‐WT and NA7‐KO flies reared on 2 native cucurbit hosts (summer squash and cucumber). However, there were decreases in NA7‐KO when reared on summer squash and cucumber compared to that in BAT‐WT (P < 0.01, Fig. 5B), suggesting that Ndufa7 was involved in the adaptation of B. tau to 2 native hosts, expanding from the native pumpkin host. Second, Ndufa7 was highly expressed in BAT‐WT flies reared on novel banana and guava hosts. However, there were significant differences in Ndufa7 expression levels between NA7‐KO and BAT‐WT flies reared on banana (P < 0.001; Fig. 5B). These results suggested that the Ndufa7 gene affected the adaptation of B. tau to novel hosts, expanding from the native pumpkin host. Lastly, Ndufa7 can be expressed in both BAT‐WT and NA7‐KO flies reared on a potential host, pitaya, when transferred from native pumpkin fruits. However, there were sharp decreases in relative Ndufa7 expression levels in NA7‐KO flies compared with that in BAT‐WT flies (P < 0.001, Fig. 5B), indicating that the Ndufa7 gene is involved in the host expansion of B. tau to this potential host. In summary, different Ndufa7 expression levels in B. tau pre‐ and post‐gene knockouts indicated that Ndufa7 is involved in the survival of B. tau on native hosts and in the expansion of B. tau to novel and potential hosts.
Discussion
We revealed the respective roles of Ndufa7, Ndufs1, and Ndufs3 in host expansion of the invasive pest B. tau for the first time. Ndufa7 knockout interfered with B. tau survival on native hosts and disrupted B. tau expansion to novel and potential hosts. However, knockout of Ndufs1 and Ndufs3 caused homogenous lethality in B. tau.
Role of 3 CI genes in host expansion of B. tau
In this study, stable homogenous NA7‐KO (Btndufa7 −/−) B. tau was established after Ndufa7 knockout. However, compared with that of BAT‐WT, the size of the larvae and pupae of NA7‐KO shrank, suggesting that Ndufa7 had a small effect on the development of B. tau. Furthermore, in contrast to BAT‐WT, NA7‐KO did not survive on the novel host guava. NA7‐KO also performed poorly on the novel host banana and potential host pitaya, as shown by sharp decrease in fitness and Ndufa7 gene expression levels. The ability of NA7‐KO to adapt to 2 native hosts, summer squash and cucumber, was slightly reduced in terms of fitness and relative Ndufa7 expression levels. Therefore, Ndufa7 is involved in the early development and survival on native hosts and later expansion to novel hosts and potential hosts in B. tau.
Silencing Ndufa7 caused variations in the levels of both host fitness and Ndufa7 expression in B. tau expanding to native, novel and potential hosts. Based on this evidence, we speculated that the effects of different levels on the host expansion of B. tau caused by Ndufa7 were associated with the host chemical environment. When B. tau was expanded to 2 cucurbit hosts, similar host environments stimulated slight responses of Ndufa7, which resulted in a gentle variation in fitness and gene expression patterns after Ndufa7 knockout. In contrast, B. tau encounters very different chemical environments when it expands to novel and potential hosts belonging to different plant families and genera. Guava is a plant of the pomegranate genus, banana is a plant of the Musa genus (Shi et al., 2022b), and pitaya is a plant of the Selenicereus genus (Shan et al., 2023). B. tau must spend more energy to detoxify and digest various secondary metabolites and stimulate a strong Ndufa7 response to adapt to new chemical challenges, resulting in large variations in fitness and Ndufa7 expression levels. Therefore, the chemical environment of the host is a key factor driving Ndufa7, which plays a role in the host expansion of B. tau. The influence of the host chemical environment in B. tau before gene knockout has been shown with a potential host, that is, apples. B. tau could lay a few eggs on apples, but they could not become adults. However, B. tau could successfully expand on another potential host, pitaya, although it has a similar odor attraction with that of apples (Fig. S1). B. tau cannot adapt to the chemical environment of apples (Rosa genus) (Zhang & Chen, 2018), whereas flies can adapt to the chemical environment of pitaya.
Only limited information on the role of Ndufa7 is available (Xiao et al., 2022). Several studies have shown that Ndufa7 is associated with cardiac hypertrophy (Shi et al., 2020) and rheumatoid arthritis (Mitsunaga et al., 2015). Ndufa7 plays a fundamental role in the pathogenesis of these diseases by regulating oxidative stress, which is characterized by the accumulation of ROS (Shi et al., 2020). Overaccumulation of ROS affects the production of adenosine triphosphate (ATP) and the energy supply (Lin et al., 2021), which causes disease. For example, the depletion of Ndufa7 promotes increasing ROS production and calcineurin signaling activation, contributing to cardiac hypertrophy (Shi et al., 2020). Similarly, excessive ROS levels drive rheumatoid arthritis (Mitsunaga et al., 2015) associated with Ndufa7. Thus, we speculated that Ndufa7, which affected native host adaptation and novel and potential host expansion in this study, is probably associated with an oxidase‐stressing mechanism. Due to chemical differences between native, novel and potential hosts (chemical stressors), Ndufa7 may regulate ROS production and ATP formation. Thus, the dysfunction of Ndufa7 probably causes variations of ROS and ATP, leading to different “behavioral symptoms” of B. tau in response to 5 hosts. Therefore, future studies should explore the ROS metabolism of host expansion in B. tau.
Previous studies have shown that Ndufs1 and Ndufs3 genes are associated with several diseases such as cancer (Kurelac et al., 2019; Ren et al., 2023), Leigh syndrome (Peralta et al., 2020), mitochondrial disease (Granat et al., 2024), and Alzheimer's disease (Lin et al., 2021). The dysfunction of these 2 genes causes apoptosis, respiratory chain defects, early mortality, and a decline in ATP production (Elkholi et al., 2019; Kurelac et al., 2019; Peralta et al., 2020; Lin et al., 2021; Ren et al., 2023; Granat et al., 2024).
Stable homogenous strains were not established after silencing Ndufs1 and Ndufs3 in the present study. However, heterozygous strains (Btndufs1 +/− and Btndufs3 +/−) of B. tau were obtained after gene knockout, exhibiting homozygous lethality for the 2 gene strains. Homozygous lethality mainly occurred during the embryogenesis stage, which is the first report of tephritid pests of the Ndufs1 and Ndufs3 genes in this study. Therefore, Ndufs1 and Ndufs3 play a role in the embryonic development of B. tau. Our results provide new evidence supporting the role of these 2 core genes in development.
Ndufs1 and Ndufs3 are core structure units of CI, and they represent the N and Q functional modules of CI, respectively (N module functions in oxidizing nicotinamide adenine dinucleotide hydrogen and Q module functions in reducing ubiquinone). They play important roles in the assembly and structural stability of the CI (Stroud et al., 2016; Su et al., 2016). Thus, the knockout of Ndufs1 or Ndufs3 resulted in B. tau homogenous lethality in our study. However, Ndufa7 is an accessory unit of the CI (Hirst et al., 2003; Xiao et al., 2022). Previous studies have shown that Ndufa7 knockout did not affect the assembly and structure of CI, but had a mild effect on CI activity (Stroud et al., 2016). Ndufa7 knockout also did not alter cell viability (Xiao et al., 2022). This suggests that Ndufa7 may have a regulatory role in CI activities, such as ATP production and ROS variation. Indeed, our results suggest that Ndufa7 can regulate early development and survival on hosts and the later expansion to novel and potential hosts of B. tau.
Potential of 3 CI genes in future RNAi control
For tephritid flies, environmentally friendly management methods such as RNAi‐based (Shelly et al., 2014) control methods have been widely suggested (Zhu & Palli, 2020). Some genes related to sex determination (Astra‐2, tra‐2 gene) (Li & Handler, 2019), pupal color (wp gene) (Ward et al., 2021), and temperature sensitivity (shibire gene) (Choo et al., 2020) have been exploited and applied in RNAi‐based control methods for Ceratitis capitate (Widedmann), B. dorsalis, (Sim et al., 2019) and B. tryoni (Choo et al., 2020). However, only a few genes involved in host expansion have been targeted using RNAi‐based control. We identified the functions of these 3 CI genes in B. tau host expansion in the present study. Given the regulatory role of Ndufa7 in native host selection and novel and potential host expansion, it should be considered a potential target gene for RNAi control in tephritids. The other two genes were not suitable targets for RNAi‐based controls because of their lethality upon homozygous knockout. In fact, mitochondrial CI genes have wide potential for pest control, and several studies have reported lepidopteran pest control. For example, the use of transgenic cotton tissues expressing Ndufv2 double‐stranded RNA (dsRNA) to treat the cotton bollworm (Helicoverpa armigera) larvae led to targeted gene silencing, resulting in high pest mortality (Wu et al., 2016).
In summary, our study provides a new case for verifying the regulatory function of the Ndufa7 gene for survival and reports a new role of the Ndufa7 gene in novel and potential host expansion in tephritids for the first time. In contrast, Ndufs1 and Ndufs3 played key roles in the early development of B. tau. Therefore, only Ndufa7 is a target gene for RNAi‐based control techniques.
Disclosure
The authors declare no conflict of interest.
Supporting information
Fig. S1 Odor attraction tests of Bactrocera tau toward various host fruits via a Y‐tube olfactometer.
Fig. S2 Bactrocera tau amino acid sequences variations in the coding sequence (CDS) region of 3 complex I (CI) genes.
Fig. S3 Chromatograms for individual Bactrocera tau strains randomly selected from the F0 to F3 generations for each complex I (CI) gene strain after knockout.
Acknowledgments
This work was supported by grants from the National Science Foundation of China (32060314, 32271563 and 32471568) and the Science and Technology Program of Yunnan Province (202401AS070151). The funders had no role in the study design, data collection and analysis, decision to publish, or manuscript preparation.
Contributor Information
Wei Shi, Email: shiwei@ynu.edu.cn.
Jun Cao, Email: Juncao@vip.163.com.
References
- Ali, M.Z. and Dholaniya, P.S. (2022) Oxidative phosphorylation mediated pathogenesis of Parkinson's disease and its implication via Akt signaling. Neurochemistry International, 157, 105344. [DOI] [PubMed] [Google Scholar]
- Charlery de la Masselière, M. , Ravigné, V. , Facon, B. , Lefeuvre, P. , Massol, F. , Quilici, S. et al. (2017) Changes in phytophagous insect host ranges following the invasion of their community: Long‐term data for fruit flies. Ecology and Evolution, 7, 5181–5190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Choo, A. , Fung, E. , Chen, I.Y. , Saint, R. , Crisp, P. and Baxter, S.W. (2020) Precise single base substitution in the shibire gene by CRISPR/Cas9‐mediated homology directed repair in Bactrocera tryoni . BMC Genetics, 21, 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Christenson, L.D. and Foote, R.H. (1960) Biology of fruit flies. Annual Review of Entomology, 5, 171–192. [Google Scholar]
- Elkholi, R. , Abraham‐Enachescu, I. , Trotta, A.P. , Rubio‐Patiño, C. , Mohammed, J.N. , Luna‐Vargas, M.P.A. et al. (2019) MDM2 integrates cellular respiration and apoptotic signaling through NDUFS1 and the mitochondrial network. Molecular Cell, 74, 452–465. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Garcia, F.R.M. , Ovruski, S.M. , Suárez, L. , Cancino, J. and Liburd, O.E. (2020) Biological control of tephritid fruit flies in the Americas and Hawaii: A review of the use of parasitoids and predators. Insects, 11, 662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Granat, L. , Knorr, D.Y. , Ranson, D.C. , Chakrabarty, R.P. , Chandel, N.S. and Bateman, J.M. (2024) A Drosophila model of mitochondrial disease phenotypic heterogeneity. Biology Open, 13, bio060278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hafsi, A. , Facon, B. , Ravigné, V. , Chiroleu, F. , Quilici, S. , Chermiti, B. et al. (2016) Host plant range of a fruit fly community (Diptera: Tephritidae): Does fruit composition influence larval performance? BMC Ecology, 16, 40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hasyim, A. , Muryati, M. and De Kogel, W.J.D. (2008) Population fluctuation of adult males of the fruit fly, Bactrocera tau Walker (Diptera: Tephritidae) in passion fruit orchards in relation to abiotic factors and sanitation. Indonesian Journal of Agricultural Science, 9, 29–33. [Google Scholar]
- Hirst, J. , Carroll, J. , Fearnley, I.M. , Shannon, R.J. and Walker, J.E. (2003) The nuclear encoded subunits of complex I from bovine heart mitochondria. Biochimica et Biophysica Acta (BBA)‐Bioenergetics, 1604, 135–150. [DOI] [PubMed] [Google Scholar]
- Huang, K.H. , Guo, Q.X. , Yu, Y. and Huang, Z.H. (2005) Risk analysis of Bactrocera (Zeugodacus) tau (Walker). Wuyi Science Journal, 21, 77–80. [Google Scholar]
- Kumar, S. , Stecher, G. and Tamura, K. (2016) MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33, 1870–1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kurelac, I. , Iommarini, L. , Vatrinet, R. , Amato, L.B. , De Luise, M. , Leone, G. et al. (2019) Inducing cancer indolence by targeting mitochondrial Complex I is potentiated by blocking macrophage‐mediated adaptive responses. Nature Communications, 10, 903. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li, J. and Handler, A.M. (2019) CRISPR/Cas9‐mediated gene editing in an exogenous transgene and an endogenous sex determination gene in the Caribbean fruit fly, Anastrepha suspensa . Gene, 691, 160–166. [DOI] [PubMed] [Google Scholar]
- Lin, M. , Chen, S. and Liu, Y. (2005) The host plants of Bactrocera tau in Taiwan. Tainan District Agricultural Improvement Farm Research Report, 45, 39–52. [Google Scholar]
- Lin, X. , Wen, X. , Wei, Z. , Guo, K. , Shi, F. , Huang, T. et al. (2021) Vitamin K2 protects against Aβ42‐induced neurotoxicity by activating autophagy and improving mitochondrial function in Drosophila . Neuroreport, 32, 431–437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mitsunaga, S. , Hosomichi, K. , Okudaira, Y. , Nakaoka, H. , Suzuki, Y. , Kuwana, M. et al. (2015) Aggregation of rare/low‐frequency variants of the mitochondria respiratory chain‐related proteins in rheumatoid arthritis patients. Journal of Human Genetics, 60, 449–454. [DOI] [PubMed] [Google Scholar]
- Peralta, S. , Pinto, M. , Arguello, T. , Garcia, S. , Diaz, F. and Moraes, C.T. (2020) Metformin delays neurological symptom onset in a mouse model of neuronal complex I deficiency. JCI Insight, 5, e141183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Piñero, J.C. , Souder, S.K. and Vargas, R.I. (2017) Vision‐mediated exploitation of a novel host plant by a tephritid fruit fly. PLoS ONE, 12, e0174636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ren, L. , Meng, L. , Gao, J. , Lu, M. , Guo, C. , Li, Y. et al. (2023) PHB2 promotes colorectal cancer cell proliferation and tumorigenesis through NDUFS1‐mediated oxidative phosphorylation. Cell Death and Disease, 14, 44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shan, C.Y. , Li, B.H. , Li, L. , Du, X. , Ren, Y.L. , Mckirdy, S.J. et al. (2023) Comparison of fumigation efficacy of methyl bromide alone and phosphine applied either alone or simultaneously or sequentially against Bactrocera correcta in Selenicereus undatus (red pitaya) fruit. Pest Management Science, 79, 4942–4951. [DOI] [PubMed] [Google Scholar]
- Shelly, T. , Epsky, N. , Jang, E.B. , Reyes‐Flores, J. and Vargas, R. (2014) Trapping and the Detection, Control, and Regulation of Tephritid Fruit Flies: Lures, Area‐Wide Programs, and Trade Implications. Springer; Dordrecht, Berlin. [Google Scholar]
- Shi, W. , Roderick, G. and Zhang, G.S. (2020a) Mechanisms of novel host use by Bactrocera tau (Tephritid: Diptera) revealed by RNA transcriptomes. Journal of Insect Science, 20, 22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi, W. , Yang, T.Y. , Ye, H. and Cao, J. (2017c) Impact of host plants on genetic variation in the Bactrocera tau (Diptera: Tephritidae) based on molecular markers. Journal of Entomological Science, 52, 411–426. [Google Scholar]
- Shi, W. , Ye, H. , Roderick, G. , Cao, J. , Kerdelhué, C. and Han, P. (2022b) Role of genes in regulating host plants expansion in Tephritid fruit flies (Diptera) and potential for RNAi‐based control. Journal of Insect Science, 22, 10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shi, X. , Zhang, Y. , Chen, R. , Gong, Y. , Zhang, M. , Guan, R. et al. (2020) Ndufa7 plays a critical role in cardiac hypertrophy. Journal of Cellular and Molecular Medicine, 24, 13151–13162. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sim, S.B. , Kauwe, A.N. , Ruano, R.E.Y. , Rendon, P. and Geib, S.M. (2019) The ABCs of CRISPR in Tephritidae: Developing methods for inducing heritable mutations in the genera Anastrepha, Bactrocera and Ceratitis . Insect Molecular Biology, 28, 277–289. [DOI] [PubMed] [Google Scholar]
- Stroud, D.A. , Surgenor, E.E. , Formosa, L.E. , Reljic, B. , Frazier, A.E. , Dibley, M.G. et al. (2016) Accessory subunits are integral for assembly and function of human mitochondrial complex I. Nature, 538, 123–126. [DOI] [PubMed] [Google Scholar]
- Su, C.Y. , Chang, Y.C. , Yang, C.J. , Huang, M.S. and Hsiao, M. (2016) The opposite prognostic effect of NDUFS1 and NDUFS8 in lung cancer reflects the oncojanus role of mitochondrial complex I. Scientific Reports, 6, 31357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sumrandee, C. , Milne, J. and Baimai, V. (2011) Ovipositor morphology and host relations of the Bactrocera tau complex (Diptera: Tephritidae) in Thailand. Songklanakarin Journal of Science & Technology, 33, 247–254. [Google Scholar]
- Tallamy, D.W. (2000) Physiological issues in host range expansion. In X International Symposium on Biological Control of Weeds. Proceedings of Session: Host Specificity Testing of Exotic Arthropod Biological Control Agents: The Biological Basis for Improvement in Safety (eds. Van Driesch R., Heard T., McClay A. & Reardon R.), pp. 11–26. Montana State University; Bozeman, Montana. [Google Scholar]
- Vayssières, J.F. , Rey, J.Y. and Traoré, L. (2007) Distribution and host plants of Bactrocera cucurbitae in West and Central Africa. Fruits, 62, 391–396. [Google Scholar]
- Wang, J.C. , Yuan, Z.L. and Yang, J.Y. (1994) A dangerous pest, the pumpkin fruit fly, has been discovered in Gansu Province. Gansu Agricultural Science and Technology, 8, 26. [Google Scholar]
- Ward, C.M. , Aumann, R.A. , Whitehead, M.A. , Nikolouli, K. , Leveque, G. , Gouvi, G. et al. (2021) White pupae phenotype of tephritids is caused by parallel mutations of a MFS transporter. Nature Communications, 12, 491. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu, X.M. , Yang, C.Q. , Mao, Y.B. , Wang, L.J. , Shangguan, X.X. and Chen, X.Y. (2016) Targeting insect mitochondrial complex I for plant protection. Plant Biotechnology Journal, 14, 1925–1935. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xiao, M.H. , Lin, Y.F. , Xie, P.P. , Chen, H.X. , Deng, J.W. , Zhang, W. et al. (2022) Downregulation of a mitochondrial micropeptide, MPM, promotes hepatoma metastasis by enhancing mitochondrial complex I activity. Molecular Therapy, 30, 714–725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang, Y.L. , Wu, S.A. and Zheng, M.H. (1994) Preliminary report on the occurrence of pumpkin fruit fly in Shanxi Province. Plant Quarantine, 6, 330–331. [Google Scholar]
- Zhang, Y. and Chen, J.Y. (2018) Recent advances in research of Bactrocera (Zeugodacus) tau (Walker) in China. Chinese Journal of Tropical Agriculture, 38, 70–77. [Google Scholar]
- Zhu, K.Y. and Palli, S.R. (2020) Mechanisms, applications, and challenges of insect RNA interference. Annual Review of Entomology, 65, 293–311. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1 Odor attraction tests of Bactrocera tau toward various host fruits via a Y‐tube olfactometer.
Fig. S2 Bactrocera tau amino acid sequences variations in the coding sequence (CDS) region of 3 complex I (CI) genes.
Fig. S3 Chromatograms for individual Bactrocera tau strains randomly selected from the F0 to F3 generations for each complex I (CI) gene strain after knockout.
