Regulation of redox homeostasis and proline metabolism by tea polyphenols ameliorates salinity tolerance during wheat seed germination and early seedling growth

Abstract

Salt stress constitutes a significant abiotic constraint impairing seed germination and plant growth. In this study, we employed wheat cultivar 'Longchun 30' to examine tea polyphenol (TP)-mediated regulation of redox homeostasis and proline metabolism in germinated seeds and seedlings under NaCl stress. Relative to ascorbic acid, TP showed a strong scavenging effect on reactive oxygen species (ROS), 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and 1,1-diphenyl-2-picrylhydrazyl. Salt stress severely suppressed seed germination and seedling growth, concurrently elevating the amount of sodium (Na⁺), nicotinamide adenine dinucleotide (phosphate) (NAD(P)⁺), NADPH, ROS, malondialdehyde (MDA) and osmotic regulators while reducing potassium (K⁺), NADH content, K⁺/Na⁺ and NAD(P)H/NAD(P)⁺ ratios. Crucially, TP application mitigated salinity-induced inhibition of seed germination and seedling growth, concomitant with the increases of K⁺ content and K⁺/Na⁺ and NAD(P)H/NAD(P)⁺ ratios, as well as decreases of Na⁺, NAD(P)⁺, ROS and MDA levels. TP supplementation further enhanced proline content in seedling leaves under salinity stress, along with the further up-regulation of ornithine δ-aminotransferase, glutamate kinase, Δ¹-pyrroline-5-carboxylate synthetase, pyrroline-5-carboxylate reductase and proline dehydrogenase activities and their gene expression, particularly during the early stage of Na + TP treatment. Collectively, TP application enhances wheat salinity tolerance by reducing Na⁺ accumulation, reinforcing the redox homeostasis in germinated seeds and seedlings, while tissue-specifically boosting foliar proline accumulation via coordinated activation of anabolic enzymes and associated genes.

Introduction

Soil salinization represents a widespread agro-ecological constraint that compromises global crop productivity. Notably, salinized arable lands constitute approximately 23% of cultivated areas in the United States, 30% in Iran, 33% in Egypt, and 34% in Argentina [28, 53], incurring substantial yield and economic losses. This impairment stems from salinity capacity to disrupt seed germination and early seedling growth. Empirical studies confirm that salt stress reduces germination percentage (GP) and germination index (GI) in Zea mays [16] and Triticum aestivum [15]. Contrastingly, low concentrations of neutral salts (e.g., NaCl, Na₂SO₄) enhance germination in Cannabis sativa L. [25]. Additional responses of plants to salt stress include growth inhibition, oxidative damage and osmoregulatory dysfunction [39, 49, 56]. In crops, salinity stress is associated with an increased uptake and accumulation of sodium (Na⁺) to toxic levels [42]. Under non-stressed conditions, a relatively stable reactive oxygen species (ROS) is essential to preserve metabolic homeostasis, protein function, and cellular signaling in plants [46]. However, salinity stress-triggered excessive ROS accumulation can damage plant cell membrane structures, consequently increasing plasma membrane permeability [29, 65]. Moreover, excessive ROS alters the cellular redox status [18], which can disrupt metabolism, growth, and stress responses in plants and seeds [60]. Reduced nicotinamide adenine dinucleotide (phosphate) (NAD(P)H) serve as essential metabolites and principal redox regulators [61].

Concurrently, osmotic stress resulting from salinity environment impairs water uptake and promotes water loss in plant cells [6]. Significantly, plants and their seeds employ enhanced accumulation of osmoregulatory substances and improved antioxidant capacity as tolerance mechanisms to bolster survival and seed germination under saline conditions [16, 30]. For example, increased soluble protein and soluble sugar levels correlate positively with enhanced tolerance in plants and seeds to salinity [8, 58]. Additionally, salt-tolerant crop varieties generally exhibit higher proline concentrations compared to sensitive counterparts [47], and rhizobacteria mitigates salt stress in maize partly by augmenting proline levels [33]. However, some studies suggest that elevated proline content under salinity stress reflects tissue salt burden rather than conferring tolerance [38]. Collectively, these observations indicate that the precise role of proline in regulating plant abiotic stress response and tolerance remains inconclusive. Proline biosynthesis occurs via the ornithine and glutamate pathways, involving key enzymes such as ornithine δ-aminotransferase (OAT), glutamate kinase (GK), Δ¹-pyrroline-5-carboxylate synthase (P5CS), and Δ¹-pyrroline-5-carboxylate reductase (P5CR) [55]. Proline degradation is mediated by proline dehydrogenase (ProDH) and pyrroline-5-carboxylate dehydrogenase (P5CDH) [40]. In alfalfa subjected to saline-alkali stress, progressive proline accumulation is related to up-regulation of MsP5CSs, MsP5CRs, and MsOATs expression and P5CS activity, alongside significant down-regulation of ProDH activity and MsProDH expression [40].

Tea polyphenols (TP) from tea possess anti-corrosive and preservative properties, rendering them widely applicable in the food industry for vegetable and fruit storage [67, 70]. Recently, the alleviating effects of TP on heavy metal toxicity have garnered increasing research attention [20]. Our previous studies have demonstrated that salt concentrations exceeding 100 mM inhibit the seedling growth of wheat (Triticum aestivum L.) cv. Longchun 30 [64], and that TP application significantly mitigates salinity toxicity by modulating ion transport and antioxidant responses [71]. Nevertheless, the mechanism underlying TP-mediated attenuation of stress-induced phytotoxicity remains inadequately explored. Furthermore, information regarding TP-induced effects on seed germination is currently lacking. Approximately 50% of cultivated land in Northwest China is affected by salinization due to arid climate and suboptimal irrigation practices, severely constraining regional agricultural productivity and economic development [32, 62]. Consequently, enhancing seed germination and plant survival capacity under saline conditions holds significant practical importance for developing stress-resilient agriculture. The spring wheat cultivar 'Longchun 30' (bred by Gansu Academy of Agricultural Sciences) is widely cultivated in arid and saline regions such as the Hexi Corridor of Gansu Province [71]. To elucidate the mechanism of TP-enhanced salinity tolerance, we employed wheat cv. Longchun 30 to analyze redox status, proline metabolism, and associated gene expression during seed germination and early seedling growth under 150 mM NaCl stress with or without TP supplementation (10 and 50 mg·L^–1). This study will provide a theoretical foundation for TP application in agricultural practice to improve plant growth performance under saline environments.

Materials and methods

Seed germination, seedling culture and treatment

Seeds of wheat (Triticum aestivum L. cv. Longchun 30) were surface sterilized in 1% NaClO for 15 min, followed by thorough rinsing with autoclaved water. Fifty uniform seeds per Petri dish were germinated at 25 ± 1 °C under continuous darkness. Germination was defined as radicle emergence ≥ 1 mm beyond the seed coat. Germinated seeds was counted every day (d), and the radicle length was measured on the 6th d. Germination parameters, such as GP, germination rate (GR), GI, and vigor index (VI), were determined according to Nabaei and Amooaghaie [45]. Additionally, seedlings were cultivated in an LRH-250-A growth chamber (25 °C, 12 h-photoperiod, 300 μmol·m^–2·s^–1 photosynthetic photon flux density). The control group for seed germination and seedling growth was maintained in a quarter-strength Hoagland’s solution, while treatment groups were continuously supplied with the same basal solution amended with 150 mM NaCl (NaCl), 10 mg·L^–1 TP (designated 10-TP), 50 mg·L^–1 TP (50-TP), 150 mM NaCl + 10-TP or 150 mM NaCl + 50-TP. All solutions were renewed every 48 h (h). TP (purity ≥ 99%) was commercially acquired through Shanghai Macklin Biochemical Co., Ltd. (China). Each treatment comprised ≥ 4 independent replicates for germination parameters and growth traits, and ≥ 3 replicates for other biochemical parameters. Seeds germinated for 24 h and 72 h as well as seedlings cultivated for 6 d were used to determine various parameters, and 25 seedlings from each group were used to measure stem length and leaf area.

In vitro analysis of antioxidant activities of TP

The in vitro scavenging capacities of TP and ascorbic acid (AsA) against H₂O₂, hydroxyl radicals (·OH), and superoxide anions (O₂^·–) were quantified according to Tu et al. [57] and Ma et al. [36]. For H₂O₂ assessment, equal volumes of TP/AsA solutions (20–100 mg·L^–1) and H₂O₂ were mixed, with scavenging activity determined from absorbance kinetics at 248 nm monitored over 1 min. ·OH scavenging analysis involved sequential mixing of TP/AsA with concentrations of 9 mM FeSO₄, 9 mM salicylic acid, and 9 mM H₂O₂, with immediate absorbance (510 nm) recording (A₁). Controls included distilled H₂O substitution for H₂O₂ (A₂) and extraction solvent replacement of filtrate (A₃), and the scavenging rate = (A₁ – A₂)/A₃ × 100. Superoxide anion scavenging activity was assayed by combining TP/AsA solution (400 µL) with 50 mM Tris–HCl buffer (pH 8.2, 4.5 mL), incubating at 25 °C for 15 min, and subsequently adding 45 mM pyrogallol (400 µL). After 10 min, the reaction was terminated with 10 M HCl, and the absorbance was measured at 325 nm (A₁). The mixture of Tris–HCl and pyrogallol was used to measure the absorbances (A₂), and TP or AsA + Tris–HCl was used to measure the absorbances (A₃). O₂^·– scavenging rate = (A₁ – A₂)/A₃ × 100.

In addition, the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) and 1,1-diphenyl-2-picrylhydrazyl radical (DPPH) radical scavenging activities were assessed following the method described by Li et al. [31]. TP or AsA solutions (2 mL) were reacted with 2 mL of ABTS⁺ solution for 6 min, and the absorbance (A₁) was determined at 734 nm. The solution without TP or AsA was recorded as A₂. The ABTS scavenging rate was calculated as (A₂ – A₁)/A₂ × 100. Additionally, 100 μM of TP or AsA were combined with DPPH methanolic solution (4 mL) and inculcated in the dark for 1 h. The absorbance (517 nm) of the solution was recorded as A₁ and the absorbance of the solutions without TP/AsA was served as A_2. The DPPH scavenging activity (%) was calculated as (A₂ – A₁)/A₂ × 100.

Determination of K⁺ and Na⁺ levels

According to the method of Chen et al. [11], dry plant sample (10 mg) was ground with 10 mL of 100 mM acetic acid and incubated at 90 ℃ for 2 h. After that, this solution was filtered through a 0.22 μm filter membrane and was adjusted to a final volume of 10 mL with 100 mM acetic acid. Elemental quantification was performed using ICP-OES (PerkinElmer Co. Ltd., USA), and the results were expressed as mg·g⁻¹ DW.

Quantification of NAD(P)H and NAD(P)⁺ levels with derived redox ratios

A slightly modified method described by Lu et al. [35] was used to determine the NAD(H) content. Wheat tissue sample (0.5 g) was homogenized with extraction buffer (3 mL). After incubating at 95 °C for 5 min, centrifugation was performed for 10 min (10,000 × g, 4 °C). Subsequently, 100 μL of the supernatant was combined with 900 μL of reaction solution (pH 8.0, containing 0.1 M Tricine-NaOH buffer with 4.5 mM methylthiazolyldiphenyl-tetrazolium bromide, 40 mM ethylene diamine tetra acetic acid (EDTA), 2 mM phenazine methosulfate, and 100 mM ethanol). The reaction was initiated by adding 30 μL of 0.1 U·L^–1 alcohol dehydrogenase and incubated at 37 °C for 20 min. Following termination with 500 μL of 6 M NaCl, the mixture was centrifuged for 10 min (12,000 × g, 4 °C) and the supernatant was discarded. The resulting pellet was completely dissolved in 1 mL of 96% (v/v) ethanol, and the absorbance was measured at 570 nm.

NADP(H) content was quantified using a commercial NADP(H) ELISA Kit (COIBO BIO, Shanghai, China). Fresh wheat tissue (0.5 g) was homogenized with 3 mL of ice-cold phosphate-buffered saline (PBS, 50 mM pH 7.4), and the supernatant was obtained from centrifugating for 10 min (8000 × g). For the ELISA, 40 μL of sample diluent was mixed with 10 μL of the supernatant, and 100 μL of enzyme conjugate, followed by incubating for 60 min (37 °C). The precipitates absorbed on the plate were rinsed for three times with the washing buffer (200 μL), allowing 30 s contact time per wash before removal. Color development was initiated by successively adding 50 μL each of chromogen A and chromogen B, followed by incubation at 37 °C in the dark for 15 min, after which absorbance was recorded at 450 nm within 15 min after adding 50 μL of stop solution.

Quantitative-localization integration of ROS

The contents of H₂O₂, ·OH, and O₂^·– in wheat leaves and seeds were quantified following the methodologies of Yin et al. [68] and Ma et al. [36]. Wheat tissue (0.5 g) was homogenized in 5 mL of 0.1% (m/v) trichloroacetic acid (TCA) and centrifuged at 12,000 × g (30 min). Subsequently, equal volumes (0.7 mL) of supernatant, 10 mM PBS, and 1 M KI were mixed. The absorbance (390 nm) of the resulting mixture was recorded to quantify the H₂O₂ content.

Fresh plant tissue (0.3 g) was homogenized in ice-cold 10 mM PBS (pH 7.4) supplemented with 2-deoxy-D-ribose (15 mM). 200 μL of the cleared extract from centrifugation for 15 min (12,000 × g) was combined with 0.5% (w/v) thiobarbituric acid (TBA) and glacial acetic acid, and then boiled for 30 min. ·OH levels were determined by measuring the absorbance at 532 nm.

Plant material (0.5 g) was ground in 50 mM Tris–HCl buffer (pH 7.8), and the homogenate was centrifuged at 12,000 × g for 20 min (4 °C). Then, 0.1 mL of the supernatant was reacted with 1 mL of 17 mM sulfanilic acid and 1 mL of 7 mM α-naphthylamine at room temperature. The absorbance at 530 nm was recorded to determine the O₂^·– content.

Staining of wheat leaves with Evans Blue was conducted following established protocols [66]. Leaf staining was carried out in 0.25% (w/v) Evans Blue solution for 8 h, then thoroughly rinsed with deionized water to remove surface dye residues. Stained leaves were photographed or soaked and kept in a solution of ethanol: glycerol (9: 1, v/v).

Assessment of malondialdehyde (MDA) as lipid peroxidation biomarker

According to Chatterjee et al. [10], the MDA content was quantified based on the chromogenic reaction between MDA and thiobarbituric acid (TBA) under acidic conditions. Fresh plant leaves (0.5 g) were ground in extraction solution containing 10% (w/v) TCA and 0.25% (w/v) TBA, and then incubated in boiling water for 30 min. After centrifugation (10,000 × g, 10 min), the absorbance of the supernatant was recorded at 450, 530, and 600 nm using a spectrophotometer.

Assessment of osmotic regulator content

Soluble carbohydrates were determined according to Bozaba and Kure [8]. Plant material (0.5 g) was homogenized in 80% (v/v) ethanol and subsequently incubated for 10 min (75 °C). Following centrifugation for 10 min (5000 × g), the resulting supernatant was reacted sequentially with 80% (w/v) aqueous phenol and concentrated sulfuric acid. The absorbance was recorded at 485 nm.

Proline content was determined according to Yan et al. [65]. Wheat seed or leaf tissue (0.5 g) was homogenized in 3% (w/v) sulfosalicylic acid and boiled for 10 min. An aliquot of the supernatant from centrifugation (15,000 × g) for 15 min was combined with a reaction mixture containing 2.5% (w/v) ninhydrin, 3% (w/v) sulfosalicylic acid, and glacial acetic acid. After incubating for 60 min (95 °C), the absorbance of the toluene phase was recorded at 520 nm.

Enzymatic activity assay for proline metabolism

Ornithine aminotransferase activity was assayed according to Zhu et al. [73]. Wheat leaf tissue (0.5 g) was homogenized in 100 mM PBS (pH 7.9) supplemented with glycerol, EDTA, and 2-mercaptoethanol. Following centrifugation at 13,000 × g for 15 min, an aliquot of the supernatant was incubated with the reaction buffer comprising 50 mM Tris–HCl (pH 8.0) amended with α-ketoglutarate, ornithine, and pyridoxal phosphate for 20 min. The reaction was terminated by adding 2% (w/v) ninhydrin and heating in boiling water. The precipitate, collected by centrifugation for 30 min (11,000 × g), was dissolved in absolute ethanol, and the absorbance was recorded at 510 nm.

Glutamate kinase activity was determined based on Zhang et al. [69]. Fresh wheat leaves (0.5 g) were homogenized with 4 mL of ice-cold extraction buffer comprising 50 mM Tris–HCl (pH 7.5) supplemented with 1 mM dithiothreitol and 10% (v/v) glycerol, followed by centrifugation for 20 min (13,000 × g). The supernatant was subjected to ammonium sulphate precipitation. The resulting pellet, obtained by centrifugation at 13,000 × g for 20 min, was resuspended in 50 mM Tris–HCl (pH 7.5) containing 1 mM dithiothreitol and 10% (v/v) glycerol, and dialyzed for 24 h to yield the enzyme extract. An aliquot of the enzyme extract was added to the assay buffer (500 mM Tris–HCl, pH 7.0) amended with an equimolar concentration of glutamic acid, 100 mM adenosine triphosphate (ATP), 100 mM HCl, and 200 mM MgCl₂. Then the terminating solution (5.5% FeCl₃, 2% HClO₄ and 2 mM HCl) was added and boiled for 30 min, and the absorbance was measured at 535 nm.

Pyrroline-5-carboxylic acid synthase activity was measured following Mushtaq et al. [44]. Fresh wheat leaves (0.5 g) were ground using 5 mL of 100 mM Tris–HCl buffer (pH 7.2) supplemented with 100 mM β-mercaptoethanol, 10 mM MgCl₂, and 1 mM phenylmethanesulfonylfluoride. After centrifugation at 10,000 × g for 15 min, 100 μL of supernatant was combined with 800 μL of 100 mM Tris–HCl (pH 7.2) containing 25 mM MgCl₂, 75 mM sodium glutamate, and 5 mM ATP. The reaction was initiated by adding 400 μM NADPH, and the decrease in absorbance at 340 nm was monitored for 4 min.

Fresh wheat leaves (0.2 g) were homogenized in 3 mL of PBS buffer (pH 7.4), and then centrifuged at 12,000 × g for 10 min. The resulting supernatant was used for determining the P5CR activity using the PLANT P5CR Kit (COIBO BIO, Shanghai, China). For the assay, 50 µL of the supernatant was added to 950 µL of working solution (test tube) and to 950 µL of control solution (control tube). Both reaction mixtures were subsequently incubated at 37 °C (30 min) in the dark. The absorbance was recorded at 450 nm, yielding values A₁ (test solution) and A₂ (control solution). Enzyme activity was expressed as the amount catalyzing the production of 1 nM NADH per minute per gram of fresh tissue.

Proline dehydrogenase activity was assayed using the method of Zhu et al. [73]. Wheat tissue was ground with 2 mL of 100 mM PBS (pH 8.0) containing 1 mM cysteine and 100 μM EDTA. After centrifugation (12,000 × g, 10 min), the cleared extract (150 μL) was transferred to the reaction buffer (pH 10.3, 3 mL) containing 100 mM Na₂CO₃-NaHCO₃ and 20 mM proline. After maintaining for 5 min (32 °C), the reaction was initiated by adding NAD⁺. Changes of absorbance at 340 nm were determined at 1 min intervals for 4 min.

Real-time quantitative PCR (RT-qPCR)

Total RNA extraction from wheat leaves and subsequent cDNA synthesis were conducted following our previously described procedure [71]. Gene-specific primers (Table 1) were designed using the Primer Premier 5.0 software (PREMIER Biosoft, USA) and synthesized by Shanghai Shenggong Biological Engineering Co., Ltd. (China). Reverse-transcribed cDNA was used as templates for qPCR using the QuantStudio 1 Plus (Thermo Fisher Scientific, China). PCR reactions were carried out using the SYBR Premix Ex Taq™ Kit (TaKaRa, Japan). The total reaction volume of 20 μL included 10 μL of TB green Ex Taq™, 0.8 μL of (10 μM) forward primer, 0.8 μL of (10 μM) reverse primer, 0.4 μL of ROX reference Pye, 1.5 μL of cDNA and 6.5 μL of nuclease free water. The PCR reactions were conducted using the following program: 1 min of pre-denaturation at 95 ℃, 40 cycles with 15 s of denaturation at 95 ℃, 45 s for annealing at 60 ℃, and final stay at 25 ℃. The relative expression of genes was normalized using TaGAPDH as an internal reference. For each biological sample, three technical replicates were analyzed. Relative expression levels were calculated using the 2^−ΔΔCt method.

Table 1.

Primers used for RT-qPCR

Primer	GenBank accession number	Sequence (5’−3’)
TaGAPDH	NC_057811.1	F: TTAGACTTGCGAAGCCAGCA R: AAATGCCCTTGAGGTTTCCC
TaOAT	NC_057807.1	F: GCGTATTGCTTGCTCTGTCG R: TGCAACACAGAGGCTGGAAG
TaP5CR	NC_057801.1	F: GGTCTTGCAGCTCAGACAGT R: TGCGCAAAGGAACTATACACA
TaP5CS	NC_057796.1	F: GCCAGTAGACCTGCCAAACT R: ATGCAGCCTAAGGCGAATCC
TaProDH	NC_057794.1	F: TATGCTGTGTTTGTGCGTGC R: TAGCCATGAACGCAAGGCAT

Statistical analysis of experimental data

Experimental data were statistically analyzed using SPSS 21.0 (IBM Corp.). One-way ANOVA with Duncan’s test was used for statistical analysis. Different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with at least 3 replicates. Figures were generated using Origin 2021 (OriginLab Corp., USA), and final figure assembly was completed in Adobe Illustrator 2021 (Adobe Inc., USA) to ensure precise data visualization.

Results

In vitro antioxidant activities of ascorbic acid and tea polyphenols

Ascorbic acid is an important antioxidant that has been confirmed and widely utilized [3]. To assess the in vitro antioxidant capacity of TP, scavenging activities against ROS, ABTS and DPPH radicals were analyzed compared between TP and AsA. Both compounds (20–100 mg·L^–1) exhibited dose-dependent enhancement in eliminating H₂O₂,·OH and O₂^·–, of which the clearance of H₂O₂ was more significant at low concentrations of TP and AsA application, and the clearance of O₂^·– was the weakest at different concentrations of TP or AsA (Table 2). Furthermore, these effects were more outstanding with TP than with AsA at low concentrations, whereas no difference was observed between TP and AsA at high concentrations. Similar concentration-dependent patterns were observed for ABTS⁺ and DPPH radical scavenging (Table 2). Therefore, compared with AsA at the same concentration, TP exhibited a stronger ability to eliminate free radicals in vitro.

Table 2.

Comparison of in vitro antioxidant activities (%) of AsA and TP at different concentrations

	Concentrations (mg·L−1)	20	40	60	80	100
H2O2	AsA	45.41 ± 0.90e	54.28 ± 0.17d	65.96 ± 1.01c	82.61 ± 1.41b	90.43 ± 0.96a
	TP	60.50 ± 1.05e	67.72 ± 0.96d	75.59 ± 0.94c	85.51 ± 0.43b	93.63 ± 0.79a
·OH	AsA	19.60 ± 0.68e	33.39 ± 0.28d	57.80 ± 0.36c	84.06 ± 0.56b	91.99 ± 0.49a
	TP	25.87 ± 0.86e	40.92 ± 0.61d	72.37 ± 0.81c	90.41 ± 0.72b	97.93 ± 0.36a
O2·–	AsA	14.46 ± 0.38e	19.49 ± 0.75d	36.16 ± 1.39c	42.68 ± 1.68b	52.56 ± 1.72a
	TP	17.02 ± 0.32e	29.28 ± 0.47d	45.06 ± 0.49c	54.94 ± 1.13b	60.14 ± 1.02a
ABTS	AsA	7.66 ± 0.27e	42.39 ± 0.37d	54.04 ± 0.65c	71.51 ± 0.85b	98.44 ± 0.37a
	TP	20.35 ± 0.21d	63.51 ± 0.62c	94.43 ± 0.58b	98.47 ± 0.36a	99.48 ± 0.31a
DPPH	AsA	26.18 ± 0.58d	54.45 ± 0.96c	85.72 ± 1.01b	94.91 ± 0.32a	95.51 ± 0.37a
	TP	64.22 ± 0.34d	78.73 ± 0.55c	90.97 ± 0.37b	96.68 ± 0.36a	97.53 ± 0.66a

Means ± SE (n = 3). Treatment differences (P < 0.05, one-way ANOVA) are assigned with different letters

Seed germination and seedling establishment under different treatments

TP treatments (10 or 50 mg·L^–1) alone did not significantly alter germination parameters (GP, GR, GI, and VI) relative to the control (α = 0.05). In contrast, 150 mM NaCl exposure alone reduced these parameters by 45.28%, 30.92%, 46.50%, and 71.86%, respectively, demonstrating severe suppression on seed germination (Fig. 1a-e). Compared to NaCl treatment alone, 10-TP application significantly elevated GI by 17.19% but did not affect GP, GR, or VI, while 50-TP addition significantly enhanced GP (47.13%), GR (14.40%), GI (39.14%), and VI (58.45%) in NaCl-treated seeds.

Fig. 1.

Germination status (a), germination percentage (b), germination rate (c), germination index (d) and viability index (e) in wheat seeds under different treatments. Seedling growth (f), stem length (g) and leaf area (h) under different treatments. One-way ANOVA with Duncan’s test was used for statistical analysis, and different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 4

Figure 1f showed wheat seedling growth under various treatments. Relative to the control, 10-TP treatment did not affect the stem length but significantly increased the leaf area by 13.40%. In contrast, the stem length was notably reduced by 11.86% and 40.35% under 50-TP and 150 mM NaCl treatment. Similarly, the leaf area was decreased by 10.78% (50-TP) and 59.15% (150 mM NaCl), relative to the control. Furthermore, application of TP (10 or 50 mg·L^–1) efficiently mitigated the NaCl-induced inhibition of seedling growth (Fig. 1f). Compared to NaCl treatment alone, TP co-application resulted in a significant recovery of stem length by 30.64% (10-TP) and 24.40% (50-TP), and of leaf area by 38.40% (10-TP) and 32.00% (50-TP) (Fig. 1g, h).

K⁺ and Na⁺ levels, and K⁺/Na⁺ ratio under different treatments

With respect to the control, 10-TP treatment alone did not affect the K⁺ and Na⁺ levels, as well as the K⁺/Na⁺ ratio in wheat leaves. However, relative to the control, the K⁺ content was significantly decreased by 19.57% and 56.37%, while the Na⁺ content increased by 60.94% and 403.65% under 50-TP or NaCl treatment, respectively. The K⁺/Na⁺ ratio was decreased by 50.39% (50-TP) and 91.47% (NaCl) (Fig. 2a-c). Relative to NaCl treatment alone, co-application of TP increased the K⁺ content by about 50.14% (10-TP) and 55.28% (50 TP), but decreased the Na⁺ levels by 37.11% (10-TP) and 49.89% (50-TP), respectively. By contrast, the K⁺/Na⁺ ratio remained unaltered or increased by about 211.36% in response to NaCl + 10 TP and NaCl + 10 TP treatments, respectively, relative to the NaCl-treated alone.

Fig. 2.

K⁺ (a) and Na⁺ (b) levels, and K⁺/Na⁺ ratio (c) in wheat leaves, as well as K⁺ (d) and Na⁺ (e) levels, as well as K⁺/Na.⁺ ratio (f) in wheat roots. One-way ANOVA with Duncan’s test was used for statistical analysis, and different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 3

Insignificant alteration of these parameters was observed in 10-TP-exposed wheat roots. Compared to the control, 50-TP or NaCl treatment alone significantly reduced the K⁺ content by 11.10% and 44.23%, respectively, yet increased the Na⁺ content by 39.87% and 309.08%, respectively. 50-TP or NaCl treatment alone decreased the K⁺/Na⁺ ratio by 35.91% and 86.24%, respectively. Relative to NaCl treatment alone, 10-TP application raised the K⁺ content by 23.02%, but didn’t affect the Na⁺ content, while 50-TP application significantly increased the K⁺ content by 39.61% but decreased the Na⁺ content by 36.97% in NaCl-stressed wheat leaves. Conversely, the K⁺/Na⁺ ratio was increased by 119.51% under 50-TP + NaCl treatment but not altered under 10-TP + NaCl treatment, with respect to salt treatment alone (Fig. 2d-f).

NAD(P)H and NAD(P)⁺ levels, and NAD(P)H/NAD(P)⁺ ratios under different treatments

As demonstrated in Fig. 3a-c, NADH and NAD⁺ levels, along with the NADH/NAD⁺ ratio, exhibited no significant differences between the control and TP (10 and 50 mg·L^–1) treatments in 24 h- or 72 h-germinated seeds. Relative to the control, germinated seeds under 150 mM NaCl treatment displayed a significant decrease in the NADH content by 28.98% (24 h) and 49.38% (72 h), but an increase in NAD⁺ levels by 72.16% (24 h) and 80.27% (72 h), consequently reduced the NADH/NAD⁺ ratio by 59.82% (24 h) and 72.79% (72 h). Application of TP under salt stress significantly elevated NADH levels but reduced the NAD⁺ content (Fig. 3a-c). Compared to NaCl treatment alone, NaCl + 10-TP treatment increased the NADH level in 24 h- and 72 h-germinated seeds by 10.36% and 40.66%, respectively, while NaCl + 50-TP exposure enhanced the NADH level in 24 h-germinated seeds by 15.94% (Fig. 3a). Relative to NaCl treatment alone, the NAD⁺ content was decreased by 10.00% (24 h) and 16.73% (72 h) with NaCl + 10-TP, and by 10.97% (24 h) and 16.69% (72 h) with Na + 50-TP (Fig. 3b). Furthermore, the NADH/NAD⁺ ratio in 24 h-germinated seeds was not different between NaCl + TP and NaCl treatments. In 72 h-germinated seeds, this ratio did not alter under NaCl + 10-TP treatment but increased by 94.59% under Na + 50-TP treatment relative to NaCl treatment alone (Fig. 3c).

Fig. 3.

NADH, NAD⁺, NADH/NAD⁺ ratio, NADPH, NADP⁺ and NADPH/NADP.⁺ ratio in germinated seeds (a, b, c, d, e, f) and seedling leaves (g, h, i, j, k, l) due to different treatment. One-way ANOVA with Duncan’s test was used for statistical analysis, and different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 3

In seeds germinated for 24 h or 72 h, neither NADPH and NADP⁺ levels nor the NADPH/NADP⁺ ratio differed significantly between the control and TP treatments (10- or 50-TP) (Fig. 3d, e, f). The NADPH content in germinated seeds subjected to 150 mM NaCl was significantly increased to 157.52% (24 h) and 156.17% (72 h) and the NADP⁺ content was increased to 275.95% (24 h) and 273.30% (72 h) of control levels (Fig. 3e). Consequently, the NADPH/NADP⁺ ratio under salinity stress was decreased significantly by 43.26% (24 h) and 43.27% (72 h) (Fig. 3f). TP co-treatment effectively mitigated the salt-induced elevation of both pyridine nucleotides. Compared to NaCl treatment alone, NaCl + 10-TP did not alter the NADPH content in 24 h-germinated seeds but reduced it by 17.98% in 72 h-germinated seeds, while decreasing the NADP⁺ level by 22.02% (24 h) and 17.46% (72 h). In contrast, NaCl + 50-TP significantly reduced the NADPH content by 21.07% (24 h) and 14.44% (72 h), and the NADP⁺ level by 34.86% (24 h) and 32.30% (72 h), relative to salt treatment alone. However, no concentration-dependent effects were observed between different TP treatments at the same germination times. Furthermore, relative to NaCl treatment alone, the NADPH/NADP⁺ ratio in germinated seeds was significantly elevated by 30.38% and 22.20% (24 h), and unaltered and by 27.48% (72 h) under NaCl + 10-TP and NaCl + 50-TP treatments, respectively. Notably, NADP⁺ levels were consistently lower, and NADPH/NADP⁺ ratios were consistently higher in 24 h-germinated seeds relative to 72 h counterparts across treatments.

Treatment with 50-TP or 150 mM NaCl alone significantly reduced the NADH content in wheat leaves by 19.16% and 61.90%, but markedly increased the NAD⁺ content by 54.02% and 114.61%, respectively, compared to the control (Fig. 2g, h). Co-application with NaCl and 50-TP increased NADH by 54.08% while significantly reducing NAD⁺ levels by 17.06%. No significant difference was observed between the effects of 10-TP and 50-TP treatments. The NADH/NAD⁺ ratio was increased by 10.89% under 10-TP treatment alone, but was significantly decreased by 47.44% and 80.77% under 50-TP or 150 mM NaCl treatment alone, respectively, relative to the control (Fig. 3i). Furthermore, exposure to both 10-TP and 50-TP significantly increased this ratio in salt-stressed wheat leaves by 43.33% and 70.00%, respectively, compared to NaCl treatment alone (Fig. 3i).

Neither NADPH and NADP⁺ levels nor the NADPH/NADP⁺ ratio in wheat seedling leaves differed significantly between the 10-TP treatment and the control (Fig. 3j-l). However, treatment with 50-TP or 150 mM NaCl alone increased the NADPH content by 10.24% and 18.71%, as well as the NADP⁺ content by 34.74% and 98.95%, respectively, relative to the control. Concurrently, treatment with 50-TP or 150 mM NaCl reduced the NADPH/NADP⁺ ratio by 21.22% and 41.14%, respectively (Fig. 3l). Compared with salt treatment alone, the NADPH content remained unchanged under NaCl and 10-TP co-treatment but was lowered by 10.80% under NaCl + 50-TP (Fig. 3k). Conversely, treatment with either 10-TP or 50-TP to NaCl-treated seedlings significantly reduced the NADP⁺ content by 17.72% and 19.31%, respectively, relative to NaCl treatment alone, with no significant difference between the two TP concentrations. Additionally, 10-TP application effectively reversed the salinity-induced reduction in the NADPH/NADP⁺ ratio (Fig. 3l).

ROS levels under different treatments

Reactive oxygen species (H₂O_2, ·OH and O₂^·–) levels remained unchanged in germinated seeds exposed to TP alone. Relative to the control, 150 mM NaCl significantly elevated the H₂O₂ content by 68.69% (24 h) and 77.37% (72 h), the ·OH content by 63.53% (24 h) and 91.35% (72 h), and the O₂^·– content by 133.98% (24 h) and 155.48% (72 h). Co-application of 10-TP with NaCl did not significantly affect H₂O₂ levels and O₂^·– generation in germinated seeds (Fig. 4a, c), but reduced the ·OH content by 11.75% (24 h) and 18.47% (72 h), compared to NaCl treatment alone (Fig. 4b). In contrast, co-application of 50-TP with NaCl markedly attenuated H₂O₂, ·OH and O₂^·– in 24 h-germinated seeds by 11.71%, 18.13%, and 11.41%, respectively, and by 10.44%, 34.46% and 31.98% in 72 h-germinated seeds, respectively, relative to salt stress alone. Notably, all ROS species accumulated to a greater extent in 72 h-germinated seeds than in 24 h counterparts across treatments.

Fig. 4.

H₂O_2, ·OH, O₂^·–, and MDA content due to different treatments in germinated seeds (a, b, c, g) and seedling leaves (d, e, f, h), and Evens Blue staining in wheat leaves (i). One-way ANOVA with Duncan’s test was used for statistical analysis; different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 3

Contrasting with wheat seeds, ROS levels in seedling leaves exhibited no significant changes under 10-TP exposure. However, 50-TP exposure significantly elevated H₂O₂, ·OH, and O₂^·– by 19.96%, 29.32%, and 46.44%, respectively, relative to the control. Salt stress (150 mM NaCl) induced substantially greater ROS accumulation than 50-TP did alone (Fig. 4d-f; [36]). Both TP treatments (10 and 50 mg·L^–1) significantly attenuated NaCl-induced ROS production in wheat leaves, with no concentration-dependent effects observed (Fig. 4).

Lipid peroxidation and cell viability under different treatments

Relative to untreated controls, seeds exposed to TP alone exhibited insignificant changes in MDA levels. Conversely, NaCl alone obviously elevated the MDA content to 155.81% (24 h) and 136.16% (72 h) of control values in germinated seeds (Fig. 4g). Compared with NaCl alone, MDA levels in salt-stressed seeds remained unchanged with NaCl and 10-TP co-treatment. However, NaCl and 50-TP co-treatment reduced the MDA content by 14.43% (24 h) and 11.52% (72 h) relative to NaCl-alone treatment. Notably, the MDA level in 24 h-germinated seeds was consistently lower than that in 72 h-germinated seeds across all treatments.

By contrast, MDA levels in wheat leaves remained unaffected by the 10-TP treatment but were increased notably by 29.10% (50-TP) and 62.23% (150 mM NaCl) relative to controls, with salt stress inducing greater elevation than TP exposure. Under salinity stress, TP addition (10 and 50 mg·L^–1) significantly reduced MDA levels by 17.99% (Na + 10-TP) and 14.59% (Na + 50-TP), respectively, compared to NaCl alone (Fig. 4h).

Evans Blue staining was employed to assess cell membrane integrity, a valid indicator of cellular viability. Staining intensity showed no significant difference between control and TP-only treatments (Fig. 4i). Conversely, NaCl treatment significantly enhanced the Evans Blue staining intensity in wheat leaves (Fig. 4i). Furthermore, TP co-application with NaCl substantially mitigated the salt-induced membrane damage, resulting in reduced staining intensity and distribution versus the exclusive NaCl treatment (Fig. 4i).

Osmotic regulators under different treatments

In germinated wheat seeds, no significant difference in proline levels was found between the control and TP exposure. However, this parameter was increased by 12.40% and 20.50% in 24 h- and 72 h-germinated seeds, respectively, under 150 mM NaCl exposure relative to the control. Furthermore, TP application did not significantly alter proline levels in NaCl-stressed seeds (Fig. 5a).

Fig. 5.

Proline content in germinated seeds (a) and seedling leaves (b), as well as SS (c) and SP (d) content due to different treatment in seedling leaves. One-way ANOVA with Duncan’s test was used for statistical analysis; different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 3

By contrast, the proline content in wheat seedling leaves following TP treatment was increased significantly by 17.70% (10-TP) and 29.94% (50-TP) at d 3, and by 11.80% (10-TP) and 23.32% (50-TP) at d 6, relative to the control. This parameter was significantly higher in 6-d-old leaves than that in 3-d-old leaves. NaCl exposure alone at d 3 and 6 significantly increased the proline content by 36.92% and 30.36%, respectively, relative to the control (Fig. 5b). However, NaCl with 10-TP or 50-TP exposure elevated the proline content by 12.29% and 12.76% at d 3, respectively, and 18.55% and 12.50% at d 6, respectively, relative to NaCl stress alone.

Soluble sugar and protein content in wheat leaves remained unaltered under 10-TP treatment. By contrast, both parameters were increased significantly following exposure to 50-TP or 150 mM NaCl, with salinity treatment exhibiting a more pronounced effect than 50-TP (Fig. 5c, d). Soluble sugars were significantly lowered by 21.77% (Na + 10-TP) and 23.00% (Na + 50-TP), relative to NaCl treatment alone (Fig. 5c). Soluble proteins were increased by 17.53% under Na + 50-TP, but with no significant changes under Na + 10-TP, compared to NaCl alone (Fig. 5d).

Proline metabolic enzyme activities and associated gene expression under different treatments

The activity of ornithine aminotransferase in leaves of untreated or 10-TP-treated seedlings increased significantly with prolonged growth duration. Following 10-TP and 50-TP treatments, leaf OAT activity increased by 32.35% and 58.33%, and the TaOAT expression levels were up-regulated by 29.80% and 55.00% in 3-d-old leaves, respectively, relative to controls, whereas no significant changes were observed in 6-d-old leaves. Under NaCl stress, the OAT activity and TaOAT expression levels increased to 1.75-fold and 1.80-fold of control levels in 3-d-old leaves, respectively, but decreased to 88.66% and 29.00% of the control in 6-d-old leaves (Fig. 6a). Compared to NaCl treatments alone, NaCl and 10-TP or 50-TP co-exposure significantly enhanced the OAT activity by 21.07% and 66.01%, respectively, and the TaOAT expression by 16.11% and 21.67%, respectively, at d 3 but had no effects at d 6. Co-application of TP (10 or 50 mg·L^–1) with NaCl significantly increased the TaOAT expression by 23.94% and 29.58% at d 6, respectively, relative to salt treatment alone.

Fig. 6.

Proline metabolism-related enzyme activities and gene expressions due to different treatment in seedling leaves. OAT activity (a), GK activity (b), P5CS activity (c), P5CR activity (d), ProDH activity (e), TaOAT expression (f), TaP5CS expression (g), TaP5CR expression (h), TaProDH expression (i). One-way ANOVA with Duncan’s test was used for statistical analysis; different lowercase letters indicate statistically significant differences (P < 0.05). The data are shown as means ± SE, with a sample size of n = 3

The glutamate kinase activity in wheat leaves increased by 1.16-fold following 10-TP treatment alone at d 3 but remained unaltered at d 6. By contrast, the GK activity under 50-TP or NaCl exposure alone increased significantly by 29.60% and 32.06%, respectively, at d 3, and by 19.55% and 51.90% at d 6, respectively, compared to the control. Application of TP (10 or 50 mg·L^–1) to NaCl-treated seedlings further enhanced the GK activity, resulting in increases of 20.47% and 17.31%, respectively, at d 3, and 32.48% and 34.22% at d 6, respectively, relative to NaCl treatment alone (Fig. 6b).

TP treatments alone obviously stimulated the P5CS activity in wheat leaves, and 50-TP showed superior effect over 10-TP (Fig. 6c). Concurrently, the TaP5CS expression increased significantly by 22.00% (10-TP) and 35.00% (50-TP) in 3-d-old leaves, and by 32.00% (10-TP) and 50.00% (50-TP) in 6-d-old leaves. Under salinity stress at d 3 and 6, the enzyme activity increased to 2.07-fold and 2.75-fold, respectively, and the gene expression was notably up-regulated to 186.00% and 202.00% of the control, respectively. Compared to NaCl treatment alone, application of TP (50 mg·L^–1) to NaCl-stressed seedlings further enhanced the P5CS activity by 16.53% (50-TP) in 3-d-old leaves, and by 88.56% (10-TP) and 95.02% (50-TP) in 6-d-old leaves. Concurrently, the TaP5CS transcript was unchanged (10-TP) or notably up-regulated by 20.97% (50-TP) in 3-d-old leaves, and by 17.82% (10-TP) and 15.35% (50-TP) in 6-d-old leaves, compared to NaCl treatment alone (Fig. 6g).

In 3-d-old wheat leaves, the P5CR activity increased significantly by 33.08%, 49.20%, and 66.64%, respectively (Fig. 6d), and the TaP5CR expression level was up-regulated by 31.00%, 57.00% and 127.00% (Fig. 6h), respectively, under 10-TP, 50-TP, or 150 mM NaCl treatments alone. In 6-d-old leaves, no statistical changes in the P5CR activity and the TaP5CR expression were detected between the control and 10-TP treatment, whereas 50-TP- or 150 mM NaCl- treatments enhanced this enzyme activity by 26.75% and 53.88%, respectively, and the TaP5CR expression by 136.00% and 163.00%, respectively (Fig. 6h). Furthermore, the P5CR activity in 3-d-old seedling leaves was higher than that in 6-d-old leaves. Additionally, application of 10-TP or 50-TP to salt-stressed seedlings increased the P5CR activity by 19.63% and 25.75%, respectively, and up-regulated the TaP5CR expression by 31.72% and 42.73% at d 3, respectively, but exhibited no effect at d 6 compared to NaCl-alone stress. In 6-d-old wheat leaves, the TaP5CR expression under combined salt and TP stress was increased by 24.54% with 10-TP, compared to NaCl treatment alone.

In 3-d-old seedling leaves, the ProDH activity significantly increased to 1.28-, 1.45-, and 1.81-fold of control levels following exposure to 10-TP, 50-TP, and 150 mM NaCl, respectively (Fig. 6e), together with 39.00%, 59.00% and 102.00% up-regulation of the TaProDH expression (Fig. 6i), respectively, relative to the control. Conversely, in 6-d-old leaves, the enzyme activity remained unchanged under 10-TP alone but decreased by 22.66% and 38.98% under 50-TP or 150 mM NaCl treatment, respectively, together with 21.00% and 40.00% down-regulation of the TaProDH expression, relative to control. Furthermore, application of 10-TP did not alter the ProDH activity in NaCl-stressed seedlings, but elevated the TaProDH expression by 15.35% in 3-d-old leaves treated with NaCl, whereas 50-TP further elevated this enzyme activity by 18.12% and 21.85%, respectively, and the TaProDH expression by 13.86% and 33.33%, respectively, in 3-d-old and 6-d-old leaves under salinity stress, with respect to NaCl exposure alone (Fig. 6e).

Correlation analyses in wheat germinated seeds and seedling leaves

As shown in Fig. 7a, seed germination parameters (GP, GR, GI, VI) exhibited significant or highly significant positive correlations with the NADH content and the NAD(P)H/NAD(P)⁺ ratios, particularly in 72 h-germinated seeds, but significant or highly significant negative correlations with ROS (H₂O₂,·OH and O₂^·–) and resultant MDA levels. Furthermore, in seeds germinated for 24 h, ROS and MDA content exhibited highly significant positive correlations with NAD(P)⁺ contents. In contrast, at 72 h, ROS and MDA showed significant or highly significant positive correlations with the NAD⁺ content, but either no correlation or a significant positive correlation with the NADP⁺ content. Additionally, the proline content exhibited no correlation with germination parameters, NAD(P)H/NAD(P)⁺ ratios, or ROS production, irrespective of germination time (24 or 72 h).

Fig. 7.

Correlation analysis between physiological variables in wheat germinated-seeds (a) and seedling leaves (b) under salt stress and TP treatment. Intense red hues denote positive correlations, while deep blue denotes negative correlations

In wheat seedlings, stem length and leaf area exhibited highly significant positive correlations with NADH content, the NAD(P)H/NAD(P)⁺ ratios, OAT and ProDH activities, TaOAT and TaProDH expression (Fig. 7b), but significant negative correlations with ROS and MDA contents. Furthermore, ROS and MDA contents showed significant or highly significant positive correlations with NAD(P)⁺ contents, but significant negative correlations with the NAD(P)H/NAD(P)⁺ ratios. Additionally, proline content exhibited a highly significant positive correlation with both the NAD(P)H/NAD(P)⁺ ratios, as well as with ROS and MDA contents, while displaying a highly significant negative correlation with OAT and ProDH activities, TaOAT and TaProDH expression. Moreover, ROS production showed significant or highly significant negative correlations with the activities and expression levels of both OAT and ProDH.

Discussion

Soil salinity represents a major constraint limiting seed germination and plant growth. Enhancing tolerance to high salinity in plants and seeds supports improved crop yield stability [29]. High salinity stress enforces the accumulation of Na⁺ ions, leading to tissue toxicity [14]. We observed that NaCl treatment increased Na⁺ levels but decreased K⁺ levels and K⁺/Na⁺ ratio in both roots and leaves (Fig. 2), which was responsible for salinity toxicity in wheat seedlings. As key intermediates in electron transport chains, NAD(H) and NADP(H) fulfill critical roles in plant and seed physiological and biochemical processes [10, 17, 21]. In this study, NaCl stress alone significantly reduced NADH content and NAD(P)H/NAD(P)⁺ ratios while elevating NADPH, NAD⁺ and NADP⁺ levels in seeds germinated for 24 h and 72 h. Seed dormancy is associated with reduced NAD⁺ levels but not increased NADP⁺ levels [27], while NAD⁺ accumulation correlates with delayed germination in Arabidopsis mutants [17]. Therefore, we speculate that salinity induced inhibition and delay of seed germination might result from the destruction of the redox status and the increases of NAD(P)⁺ levels. Wheat leaves also exhibited decreased NADH content and NAD(P)H/NAD(P)⁺ ratios with increased NADPH and NAD(P)⁺ levels in salinity-stressed seedlings. Similar changes of these parameters are found in Arabidopsis mutants [37], while salinity stress decreases NAD(P)⁺ and NAD(P)H levels in salt-sensitive mutants [61]. Furthermore, direct evidence confirms that reduced NAD content confers salt hypersensitivity in Arabidopsis mutants [61], and diminished NAD(P)H/NAD(P)⁺ ratios disrupt redox homeostasis and compromise drought resistance in rice seedlings [59]. Collectively, our findings indicate that 150 mM NaCl stress inhibits wheat seed germination and seedling growth through decreased NAD(P)H/NAD(P)⁺ ratios. This is further supported by the positive correlation between seed germination parameters and NAD(P)H/NAD(P)⁺, as well as leaf length and area and these two ratios (Fig. 7a, b).

Reactive oxygen specie accumulation and consequent oxidative damage represent common responses of plants and seeds to saline conditions. Elevated ROS levels under abiotic stress may arise from disruptions in electron transport chains [9, 13], which is also supported by the significant negative correlation between the accumulation of ROS and MDA, and the ratios of NADH/NAD⁺ and NADPH/NADP⁺ in both germinated seeds and seedling leaves (Fig. 7). Although a previous observation has demonstrated that a certain amount of H₂O₂, O₂^·– or ·OH is necessary for the germination of plant seeds [9], such ROS-mediated destruction of the redox status likely constitutes a primary factor inhibiting seed germination and seedling growth under salinity [61, 72]. High salt concentration increases H₂O₂, O₂^·– and MDA levels, ultimately decreasing GP, GR and GI of maize seeds [16], and the accumulation of ·OH caused by salinity treatment also retards seed germination [9]. Consistent with these reports, our results showed that seeds at 24 h-germination exhibited lower ROS accumulation and oxidative damage compared to those at 72 h. Salt stress significantly reduced leaf length and area (Fig. 1f), but elevated ROS and MDA levels and even cellular damage in wheat leaves (Fig. 4, [71]). In fact, seed germination parameters, or leaf length and area are significantly negatively correlated with ROS production and the resulting MDA content (Fig. 7). Collectively, these findings indicate that NaCl-induced ROS over-accumulation weakens the viability of seeds and leaf cells, ultimately restricting seed germination and leaf development in wheat cv. Longchun 30.

The antioxidant properties of TP have gradually attracted the attention of researchers in the field of stress resistance [70]. In the present study, in vitro scavenging activities of different TP concentrations against H₂O_2, ·OH and O₂^·–, ABTS⁺, and DPPH radicals were significantly greater than AsA at equivalent concentrations of AsA, demonstrating superior antioxidant capacity relative to AsA (Table 2). This provides an experimental foundation for TP application. We observed that TP alone did not affect germinated parameters of wheat seeds, with insignificant alteration of NAD(P)H, NAD(P)⁺, ROS and MDA levels including their respective ratios. These results indicate that TP exposure alone did not perturb the in vivo NAD(P)H/NAD(P)⁺ or ROS homeostasis in wheat seeds, consistent with unchanged seed germination parameters. In contrast to seed responses, exposure to 10-TP alone did not significantly alter these parameters and leaf growth, whereas 50-TP alone significantly increased Na⁺ and NAD(P)⁺ levels but markedly reduced leaf length and area, and K⁺ and NAD(P)H levels as well as K⁺/Na⁺ and NAD(P)H/NAD(P)⁺ ratios (Fig. 3), concurrently intensifying ROS accumulation and evans blue staining (Fig. 4i) in seedling leaves. These findings suggest that high TP concentration (50 mg·L^–1) induces Na⁺ and ROS accumulation, weakens cell viability, enhances oxidation damage and membrane integrity, ultimately inhibits wheat leaf development and growth. Notably, this response contrasts with previous reports where higher TP exposure (100 mg·L^–1) stimulated wheat shoot and root growth [71] while reducing MDA content [36]. This discrepancy may stem from differences in TP purity and concentrations, as the earlier study utilized self-extracted TP with potentially lower purity. Previous studies have indicated that certain exogenous phytoactive compounds can mitigate NaCl-induced constraints on germination and seedling establishment. For instance, supplementation with 6-benzylaminopurine, gibberellin, or naphthalene acetic acid alleviates salinity-induced suppression of seed germination and plant growth across diverse plant species [1, 34, 65]. Moreover, salt tolerance largely depends on the capacity of the plant to limit Na⁺ accumulation [43]. This can be supported by a study showing that enhanced salt tolerance of ONAC022 overexpression plants is accompanied by reduced levels of Na⁺ ions in roots and shoots [24]. In the present study, TP application effectively attenuated salinity-induced inhibition on seed germination and leaf growth (Fig. 1), and elevated K⁺, NADH and NADPH contents but decreased Na⁺ and NAD(P)⁺ levels, resulting in increased K⁺/Na⁺ and NAD(P)H/NAD(P)⁺ ratios, indicating the protective effect of TP application on the ion toxicity and the redox status in salt-stressed wheat seeds and seedlings. Similar changes of these parameters were caused by karrikinolide application in salinity-stressed wheat [50]. Collectively, our results confirm that TP, as natural antioxidants, exhibit distinct in vitro and in vivo activities, with their in vivo effects depending on concentration, extract purity, and the physiological state of plant tissues. The present and previous findings also demonstrate that TP application enhances salt tolerance in germinating seeds and wheat seedlings by decreasing Na⁺ accumulation, promoting cellular reduction potential, mitigating oxidative damage, and preserving cell viability.

The functions of proline are related to osmotic adjustment, the stability of antioxidant enzyme systems, and the maintenance of membrane integrity in plant organs or cells under salinity environment [44]. Additionally, proline level contributes to cellular NADH and NADPH homeostasis [41, 51]. Previous studies indicate that NAD⁺ is essential for salinity-induced proline accumulation [61], and elevated proline in tobacco mutants is associated with increased NADP(H) levels and efficient NADPH-to-NADP⁺ turnover under salt stress [48]. In this study, the changes in NAD(P)H and NAD(P)⁺ levels in combination with significant increase in proline content was caused by 150 mM NaCl treatment in both germinated seeds and seedling leaves (Fig. 3a, d, f). Collectively, we speculate that proline levels may depend on cellular NAD(P)H and NAD(P)⁺ pools and their conversion. This was further supported by a positive correlation between proline content and NADPH or NAD(P)⁺ levels, and a negative correlation between proline level and NAD(P)H/NAD(P)⁺ ratios in wheat leaves (Fig. 7b). However, no correlation was determined between proline level and these parameters in the germinated seeds (Fig. 7a). Besides, the relationship between proline accumulation and the salt tolerance in plants has been demonstrated by previous studies showing that salt-tolerant genotypes of rapeseed (Brassica napus) and durum wheat (Triticum durum Desf. L) exhibit greater proline accumulation under NaCl stress than sensitive varieties [7, 54], and that high proline accumulation in transgenic plants was accompanied with improved biomass and growth, and increased survival under salinity environment [5, 23, 65]. This is supported by our findings showing a positive correlation between proline level and leaf length and area in NaCl-treated wheat seedlings (Fig. 7).

Proline biosynthesis serves as a fundamental mechanism for enhancing the tolerance of plants to abiotic environment [2, 22]. Salt stress typically elevates proline accumulation, concomitant with increased P5CS and P5CR activities in the glutamate pathway and decreased ProDH activity in soybean leaves [65]. Moreover, the transformation of AtOAT in wheat enhanced proline biosynthesis by up-regulating TaOAT, TaP5CS1, and TaP5CR, thereby improving salinity tolerance [5]. In this study, after 3 d of salinity stress, up-regulated activities of OAT, GK, P5CS, and P5CR, along with elevated expression of TaOAT, TaP5CS, TaP5CR, and TaProDH, indicate predominant involvement of both ornithine and glutamate synthesis pathways in early proline accumulation in wheat leaves. Conversely, by 6 d of salt treatment, enhanced GK, P5CS, and P5CR activities as well as the up-regulation of TaP5CS and TaP5CR, coupled with down-regulated OAT and ProDH activities and their gene expression (Fig. 6f, i), demonstrate that sustained proline accumulation resulted primarily from amplified glutamate synthesis and attenuated proline catabolism. Similar to these later-stage findings, salinity stress (7 and 14 d) significantly increased proline content in sorghum (Sorghum bicolor) leaves, resulted from up-regulated P5CS activity and down-regulated ProDH activity, as well as consistent gene expression, but not from the unaltered OAT activity [19]. However, Ami et al. [4] reported that up-regulated proline synthesis in durum wheat was insufficient to mitigate severe salt stress damage.

Currently, there are few published reports about TP influencing plant proline metabolism. We observed that TP alone or in combination with salt do not affect the proline level in germinated seeds (Fig. 5a), suggesting an irrelevant relationship between proline and wheat seed germination. This is supported by several previous observations, suggesting that proline might not function osmotically in some salinity-stressed plants, nor participate in the alleviation of salt toxicity by exogenous jasmonic acid, melatonin, or 5-aminolevulinic acid [12, 52, 63]. However, in wheat leaves, the levels of proline, soluble proteins, and soluble sugars remained unchanged under low concentration of TP, but increased significantly under high concentration of TP (Fig. 5b-d), indicating an osmotic adjustment requirement at high concentration of TP. The combined treatment of cinnamaldehyde and NaCl notably upregulated P5CS1, P5CS2, P5CDH, and OAT expression, corresponding to a marked increase in endogenous proline [26]. Furthermore, attenuation of salt stress due to exogenous proline application can be achieved in soybean by regulating both glutamate and ornithine pathways to stimulate endogenous proline accumulation [65]. In addition, melatonin induced up-regulation of P5CS and down-regulation of ProDH in tomato (Solanum lycopersicum) leaves under salinity stress, elevating proline content and salt tolerance [1]. In this study, TP addition to the saline environment further increased proline accumulation during early seedling growth by enhancing OAT, GK, P5CS, and P5CR activities (Fig. 6b-d) and up-regulating TaOAT, TaP5CS, TaP5CR (Fig. 6f-i), indicating that TP promotes proline biosynthesis via both ornithine and glutamate pathways in NaCl-treated wheat seedlings. However, at 6 d, leaves under NaCl + TP exhibited unaltered OAT and P5CR activities alongside further up-regulation of GK, P5CS, and ProDH activities as well as TaOAT, TaP5CS, TaP5CR, and TaProDH expression, suggesting only stimulated glutamate synthesis maintained stable proline content in later growth stages. This could explain the phenomenon that the proline accumulation at the early stage of treatment is notably greater than that at the later stage (Fig. 5a). Moreover, stem length and leaf area exhibited highly significant positive correlations with OAT and ProDH activities as well as TaOAT and TaProDH expression. These responses confirmed that TP causes further elevation of proline content in salt-stressed wheat leaves resulted from modulating activities and expression of enzymes governing both proline anabolism and catabolism, and that enhanced proline levels may potentially stabilize cellular antioxidant enzymes and preserves membrane integrity [44], thereby improving wheat salt stress tolerance and seedling growth.

Conclusion

TP treatment alone did not affect the germination of wheat seeds with insignificant changes in NAD(P)H redox status and ROS levels. However, 150 mM NaCl stress significantly inhibited seed germination and seedling growth, which might result from Na⁺ and ROS accumulation, decreased K⁺ content and K⁺/Na⁺ ratios, oxidative damage and disruption of NAD(P)H reduced status in germinated seeds and seedling leaves. Distinct from the effects of TP, high salinity stress increased proline level in both germinated seeds and seedling leaves, accompanied by the stimulation of OAT, GK, P5CR, P5CS and ProDH activities, as well as corresponding gene expression levels in wheat leaves. Importantly, TP significantly alleviated the inhibition of seed germination and seedling growth induced by salinity. This ameliorative effect was associated with the capacity of TP to mitigate the salinity-induced decline in Na⁺ accumulation, redox status and concomitant elevation in ROS and MDA levels in stressed seeds and seedlings. Furthermore, TP application further enhanced proline synthesis associated with the further enhancement of activities, and corresponding gene expression in salinity-stressed seedling leaves.

Abbreviations

ABTS

2,2'-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid)

AsA

Ascorbic acid

ATP

Adenosine triphosphate

DPPH

1,1-Diphenyl-2-picrylhydrazyl radical

DW

Dry weight

EDTA

Ethylene diamine tetraacetic acid

FW

Fresh weight

GAPDH

Glyceraldehyde-3-phosphate dehydrogenase

GI

Germination index

GK

Glutamate kinase

GP

Germination percentage

GR

Germination rate

MDA

Malondialdehyde

NADH

Nicotinamide adenine dinucleotide

NADPH

Nicotinamide adenine dinucleotide phosphate

OAT

δ-Aminotransferase

P5CDH

Pyrroline-5-carboxylate dehydrogenase

P5CR

Δ¹-Pyrroline-5-carboxylate reductase

P5CS

Δ¹-Pyrroline-5-carboxylate synthase

PBS

Phosphate Buffered Saline

ProDH

Proline dehydrogenase

ROS

Reactive oxygen species

TBA

Thiobarbituric acid

TCA

Trichloroacetic acid

TP

Tea polyphenol

VI

Vigor index

Authors’ contributions

H M: Writing – original draft, Investigation, Data curation, Formal analysis, Visualization. YH T: Writing – original draft, Investigation, Validation, Visualization. LB S: Investigation, Methodology. LR H: Validation, Visualization. FH W: Formal analysis, Validation. ZL W: Investigation, Validation. YL Y: Writing – review & editing, Supervision, Resources, Methodology, Funding acquisition, Data curation, Conceptualization.

Funding

This work was financially supported by the Key Research and Development Program of Gansu Province (Grant No. 24YFNA005).

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.