Highlights
-
•
First detection of Rickettsia asembonensis identified in fleas from domestic and wild hosts in Sardinia, Italy.
-
•
The pathogen was found only in fleas (P. irritans, X. cheopis, A. erinacei) and not in any lice species.
-
•
Multilocus sequences targeting gltA, ompA, ompB, Sca4, and htrA genes showed 100% identity with global strains, indicating strong genetic stability.
-
•
Mediterranean non-tick vectors reveal zoonotic potential, underlining the importance of integrated surveillance.
Keywords: Rickettsia, flea-borne pathogens, Molecular detection, Vector surveillance, Mediterranean wildlife
Abstract
This study provides the first molecular evidence and surveillance data of Rickettsia asembonensis in Sardinia, Italy, detected in fleas (Pulex irritans, Xenopsylla cheopis, and Archaeopsylla erinacei) collected from domestic (goat, dog, cat, and pig) and wild (wild boar, fox, kestrel, crow, pigeon, peacock, buzzard, hen, barn owl, martin, hedgehog, owl, and flamingo) hosts in Sardinia between 2021 and 2024. Multilocus molecular analyses of gltA, ompA, ompB, Sca4, and htrA genes revealed sequences with 100% identity to R. asembonensis strains previously reported from Brazil, Peru, Argentina, Thailand, and Malaysia, while all lice examined tested negative. These findings broaden current understanding of Rickettsia diversity in the Mediterranean region and highlight the importance of integrated surveillance involving diverse ectoparasite species. Sustained molecular monitoring of fleas and their hosts will be vital to clarify the ecology, distribution, and potential zoonotic relevance of R. asembonensis and other emerging Rickettsia species in southern Europe.
Introduction
Arthropod vectors play a pivotal role in the transmission of zoonotic pathogens, and several Rickettsia species are of particular concern due to their global distribution and pathogenic potential (de la Fuente et al., 2017; Gong et al., 2025).
Rickettsia species are obligate intracellular bacteria, primarily transmitted by ectoparasites such as ticks, fleas, lice, and mites (Merhej, Angelakis, Socolovschi and Raoult, 2014). Phylogenetically, the genus is subdivided into four major groups: the spotted fever group (SFG), the typhus group, the transitional group, and the ancestral group (Blanton, 2019). While SFG Rickettsiae are well-recognized agents of human rickettsioses in the Mediterranean region, increasing attention is being directed toward emerging species with poorly defined pathogenicity. In Italy, about 400 cases of Mediterranean Spotted Fever (MSF) infections are reported every year, most of which occur in people residing in Sicily, Sardinia and Southern Italy, with a lethality of less than 3% (Ciceroni et al., 2006). Based on hospitalization records from 2001 to 2015, the age- and sex-standardized annual hospitalization rate was approximately 1.36 per 100,000 person-years (95% CI: 1.34–1.39). The disease shows a clear geographic pattern, with high-risk areas concentrated along the southern Tyrrhenian coast and on the islands of Sicily and Sardinia. Notably, several municipalities in southern Calabria reported particularly elevated standardized hospitalization ratios (Gomez-Barroso, 2019).
Several studies conducted in Sardinia have highlighted the significant presence and diversity of Rickettsia species in ticks collected from both domestic and wild animals, confirming the central role of these arthropods in pathogen transmission (Chisu et al., 2014; 2016; 2018; 2025). However, despite this focus, other blood-feeding vectors, also known to carry Rickettsia and other pathogens, remain largely understudied.
This study aims to fill this gap by specifically investigating the presence of Rickettsia species in other ectoparasites such as fleas and lice collected from domestic and wild mammals and birds, thereby contributing valuable insights into the local epidemiology of Rickettsia spp., and to a better understanding of their potential impact on animal and public health in the region.
Material and Methods
Study area and sample collection
Between 2021 and 2024, a total of 456 ectoparasites were randomly collected from domestic and wild mammals and birds in the Province of Ogliastra, located in south-eastern Sardinia. Additional samples from the municipalities of Mamoiada, Nuoro, Orgosolo, and Ottana, (province of Nuoro), and Arbus (province of Medio Campidano) were also included (Fig. 1).
Fig. 1.
Sampling Sites in Central-Eastern Sardinia. Map showing the 21 municipalities sampled in this study in central-eastern Sardinia. Each municipality is indicated by a distinct colour as shown in the legend. The inset highlights the study area within the Island.
The study area, located in central-eastern Sardinia, features diverse environments, including rocky coastlines, coastal plains, watercourses, and Steep slopes. The northern part of Ogliastra is dominated by the Gennargentu mountain range, whose highest summit, Punta La Marmora (1,834 m), rises within a landscape of forests and Mediterranean maquis vegetation, as described for the National Park of the Gulf of Orosei and Gennargentu (National Parks Association, n.d.). This ecological heterogeneity supports a wide variety of wild and domestic hosts, influencing the distribution of ectoparasites and associated pathogens.
Sampling was conducted at the Tortolì Territorial Center of the Istituto Zooprofilattico Sperimentale (IZS) during routine post-mortem examinations of animals submitted for the determination of the cause of death. The collection date, host species, and municipality of origin were recorded. Samples were then sent to the IZS laboratories in Sassari for species identification and Rickettsia detection. Samples were stored at -20°C until analysis.
Morphological identification of ectoparasites, molecular screening, and multi locus characterization of Rickettsia asembonensis
Morphological characterization of ectoparasites was performed by following dichotomous keys described by previous authors (Berlinguer, 1964; Price and Graham, 1997; Séguy, 1944). The ectoparasites were individually processed with a mechanically pretreatment using a TissueLyser II (Qiagen, Hilden, Germany) in 200 µL of PBS. Genomic DNA was then extracted from the 456 samples using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocol.
All DNA extracts were initially screened for the presence of Rickettsia spp. by PCR targeting the citrate synthase gene (gltA). Samples testing positive for gltA were subjected to further molecular characterization through the amplification of additional gene targets, including outer membrane protein A (ompA), outer membrane protein B (ompB), cell surface antigen 4 (sca4), and the 17-kDa outer membrane antigen (htrA).
PCR reactions were performed in a final volume of 25uL containing 12.5 uL of QuantiTect Master Mix (Qiagen, Hilden, Germany), 9.5 uL of RNase-free Milli-Q water,1 μL of each primer (forward and reverse, final concentration 1 pM), and 1 μL of template DNA (∼10–50 ng). Amplification was performed using the following thermocycling conditions: an initial denaturation step at 95°C for 15 min, followed by 40 cycles of denaturation at 95°C for 30 s, gene-specific annealing temperatures for 30 s (gltA: 60 °C; ompA: 58 °C; ompB: 57 °C; sca4: 59 °C; htrA: 60 °C), and 72°C for 30 s, with a final extension step at 72°C for 5 min. Positive controls (K+) consisted of DNA extracted directly from Rickettsia rickettsii IgG IFA substrate slides (Fuller Laboratories, Fullerton, CA, USA), while negative controls consisted of ultrapure water. PCR products were separated by electrophoresis on a 1.5% (w/v) agarose gel in TAE buffer and stained with SYBR Safe DNA Gel Stain (Invitrogen, Carlsbad, CA, USA). DNA bands were visualized under ultraviolet light using a UV transilluminator.
Information on the target genes, primers, protocols, amplicon sizes, and relevant references is provided in Table 1
Table 1.
Primer sequences used in this study for the detection of Ricketsia spp species from ectoparasites analysed.
| Pathogens | Gene Target | Primer Name | Primer sequence (5ʹ to 3ʹ) | size (bp) | PCR type | Ref |
|---|---|---|---|---|---|---|
| Rickettsia spp. | gltA | gltA CS409/RpCS409d | CCTATGGCTATTATGCTTGC | 750 | single | Roux et al., 1997 |
| RpCS1258n | ATTGCAAAAAGTACAGTGAACA | |||||
| ompA* | 190-70 | ATGGCGAATATTTCTCCAAAA | 440 | Hemi-nested | Fournier, 1998 | |
| Rasemb_ompA_R1 | CGCTTGCAGCAACAARTATT | This study | ||||
| Rasemb_ompA_R2 | AAGGTAATAGCTCCTAAACC | |||||
| ompB | ompB 120-M59 | CCGCAGGGTTGGTAACTGC | 774 | single | Roux, Raoult, 2000 | |
| ompB 120-807 | CCTTTTAGATTACCGCCTAA | |||||
| Sca4 | RasemboSca4F | TGATCAGAATACTCCAGACC | 827 | single | This study | |
| RasemboSca4R | CTTCCGGTATAGCAGTACTC | |||||
| htrA | 17k_5 | GCTTTACAAAATTCTAAAAACCATATA | 536 | single | Schotta et al., 2020 | |
| 17k_3 | TGTCTATCAATTCACAACTTGCC |
*For ompA, a hemi-nested PCR was performed: primer 190-70 was combined with Rasemb_ompA_R1 in the first round, followed by 190-70 with Rasemb_ompA_R2 in the second round.
For each gene target, primer name, sequence (5′–3′), amplicon size (bp), PCR type, and reference are provided. Primers designed in this study are labeled “This study.”
Purification and Sequencing
PCR amplification products were purified using the QIAquick Purification Kit (Qiagen, Hilden, Germany), following the protocol provided by the manufacturer. The purified amplicons were then sequenced bidirectionally via Sanger sequencing (BMR Genomics, Padova, Italy). Forward and reverse reads were assembled and edited using ChromasPro software (version 1.7.7; Technelysium Pty. Ltd., Tewantin, Australia). Pairwise and multiple sequence alignments, as well as similarity analyses, were conducted using the ClustalW algorithm and the identity matrix function within the BioEdit software suite (Hall, 1999).
Unique sequence types (STs) were named according to gene target, host species, and sampling locality.
For comparative purposes, all sequences were queried against the NCBI GenBank using the BLASTn tool (version 2.16.0; https://blast.ncbi.nlm.nih.gov; accessed on 1 September 2022). All newly generated sequences have been submitted to GenBank database.
Statistical analysis
Prevalence and 95% confidence intervals (CI) were calculated using the Wilson score method.
Results
Morphological identification of the 456 collected ectoparasites allowed classification into 96 fleas and 360 lice. The number of animal species sampled, sampling localities, ectoparasites found on each animal, number of hosts examined, and identified ectoparasite species are detailed in Table 2.
Table 2.
Number of animals sampled, collection localities, host ectoparasites, number of hosts examined, and identified ectoparasite species in Ogliastra, Sardinia (2021–2024).
| Animal host (N.) | Locality | Ectoparasites | N. hosts | Ectoparasite species |
|---|---|---|---|---|
| Capra hircus (24) | Ilbono, Villagrande Strisaili, Talana, Cardedu, Ulassai, Arzana, Baunei, Perdasdefogu, Loceri, Tortolì | Lice | 109 | Linognathus stenopsis |
| 101 | Damalina caprae | |||
| Fleas | 4 | Pulex irritans | ||
| Sus scrofa (5) | Seui, Triei, Villagrande Strisaili, Urzulei, Perdasdefogu | lice | 18 | Haematopinus suis |
|
Vulpes vulpes (19) |
Orgosolo, Mamoiada, Talana, Triei, Loceri, Urzulei, Tortolì, Ilbono, Fonni, Villagrande Strisaili | Fleas | 36 | Pulex irritans |
| 6 | Ctenocephalides canis | |||
| Canis lupus familiaris (5) | Baunei, Lanusei, Perdasdefogu | Fleas | 21 | Ctenocephalides canis |
| 1 | Pulex irritans | |||
| Falco tinnunculus (9) | Lotzorai, Girasole, Arzana, Tortolì, Bari Sardo, Cardedu | lice | 62 | Degeeriella rufa |
| Felis catus (8) | Bari Sardo, Tortolì, Arbus, Villagrande Strisaili | Fleas | 17 | Ctenocephalides felis |
| lice | 25 | Felicola subrostrata | ||
| Sus scrofa domesticus (1) | Girasole | lice | 9 | Haematopinus suis |
| Corvus cornix (2) | Girasole, Tortolì | lice | 6 | Colpocephalum fregili |
| Columba livia (3) | Nuoro, Tortolì | lice | 11 | Columbicola columbae |
| Pavo cristatus (1) | Girasole | lice | 5 | Menopon phaeostomum |
| Buteo buteo (3) | Loceri, Cardedu, Seui | lice | 5 | Laemobothrion maximum |
| Gallus gallus domesticus (1) | Elini | lice | 5 | Dermanyssus gallinae |
| Tyto alba (1) | Tortolì | lice | 1 | Strigiphilus cursitans |
| Martes martes (1) | Villagrande Strisaili | Fleas | 1 | Spilopsyllus cuniculi |
| Erinaceus europaeus (2) | Ottana | Fleas | 3 | Xenopsylla cheopis |
| Tortolì | 7 | Archaeopsylla erinacei | ||
| Strix aluco (1) | Cardedu | lice | 2 | Strigiphilus cursitans |
| Phoenicopterus roseus (1) | Girasole | lice | 1 | Anaticola crassicornis |
| Tot. 87 | Tot. 456 |
Of the 96 fleas examined, six were positive for the gltA gene (6/96; 6.25%; 95% CI: 2.9–12.9%). Positives included one of 41 Pulex irritans from a domestic dog in Lanusei (1/41; 2.4%; 95% CI: 0.4–12.6%; Id 37G/23), two of three Xenopsylla cheopis from a wild hedgehog in Ottana (2/3; 66.7%; 95% CI: 20.8–93.9%; Ids 45A/23, 45C/23), and three of seven Archaeopsylla erinacei from a wild hedgehog in Tortolì (3/7; 42.9%; 95% CI: 15.8–75.0%; Ids 10A/22, 10C/22, 10F/22). Among the positive fleas, Ottana showed the highest proportion of gltA-positive specimens (66.7%), followed by Tortolì (42.9%) and Lanusei (2.4%). None of the 360 lice tested positive after gltA screening.
Sequencing and alignment of the six gltA amplicons revealed a single sequence type named gltA_flea1_Sardinia, which showed 100% similarity and complete query coverage to R. asembonensis strains previously isolated in Brazil, Peru, Argentina, Thailand, and Malaysia (Accession number of Best BLAST Match: MK923723 100% identity; Query coverage (QC) 100%; E value 0.0). The gltA sequences were deposited in the GenBank with Accession Numbers (ANs) PX512312- PX512317. Given that gltA is highly conserved among Rickettsia species, species-level identification was based primarily on sequencing of ompA, ompB, sca4, and htrA.
The six samples that tested positive in the gltA screening were subsequently subjected to PCR assays targeting additional genes (ompA, ompB, sca4, and htrA). All samples yielded positive amplification products. However, sequencing failed for one sca4 amplicon (sample 45C/23) and one htrA amplicon (sample 37G/23). Based on the remaining successfully sequenced products one sequence type was identified for each gene. The ompA sequence type (designated ompA_flea1_Sardinia) showed 100% identity and 100% QC with R. asembonensis strains (best BLAST match with AN: MK923732; E value 0.0). Similarly, the ompB sequence type (ompB_flea1_Sardinia) matched R. asembonensis with 100% identity and 100% QC (AN: JN315972; E value 0.0). The sca4 sequence type (Sca4_flea1_Sardinia) also exhibited complete identity and QC with R. asembonensis strains (AN: CP116496; E value 0.0), as did the htrA sequence type (htrA_flea1_Sardinia), which showed 100% identity and full QC (AN: KY445729; E value 0.0).
All sequences were deposited in GenBank under the ANs: PX512318- PX512339.
Discussion
This study provides the first molecular evidence of R. asembonensis in three flea species – P. irritans, X. cheopis, and A. erinacei - collected from a domestic dog and two wild hedgehogs in Sardinia, Italy. Although the prevalence observed is low, the detection in multiple flea species with broad host ranges is noteworthy. P. irritans and X. cheopis are known to parasitize both domestic and wild hosts and have been implicated in the maintenance and transmission of other zoonotic pathogens (Bitam et al., 2010). Their ecological plasticity could facilitate occasional cross-species transmission of R. asembonensis, although the low positivity in our study suggests limited circulation within the sampled populations.
Comparisons with previous studies indicate that R. asembonensis has been widely reported in fleas globally, including Ctenocephalides felis in Kenya and Argentina (Jiang al., 2013; Urdapilleta et al., 2022) and A. erinacei in Germany (Gilles et al., 2009), and in Hungary (Hornok et al., 2010).
R. asembonensis and closely related Rickettsiae has been also identified in ectoparasites from different geographic regions, including countries in South America (Dall’Agnol et al., 2017; Martinez et al., 2023; Silva et al., 2017; Souza et al., 2021; Troyo, 2016), Asia (Low et al., 2017; Prasetyo et al., 2024), Africa (Kolo et al., 2016), USA (Kruegeret et al., 2016), and Europe (Barradas et al., 2021). Several studies from Argentina have reported Rickettsia spp. in fleas, ticks, and other ectoparasites of both domestic and wild mammals, providing molecular prevalence data, and multilocus typing, like those applied in the present study (López Berrizbeitia et al., 2024; Ruiz et al., 2025). Consistent with these findings, detection of R. asembonensis in fleas collected from one dog and two hedgehogs in Sardinia supports the involvement of multiple flea species parasitizing hosts across wildlife-domestic interfaces.
In this study R. asembonensis was detected exclusively in fleas, with no positive lice, consistent with previous evidence indicating that fleas, rather than lice, are the primary vectors of this pathogen (Maina et al., 2019). The flea species in which R. asembonensis was found exhibit low host specificity, parasitizing both domestic and wild animals, and frequently come into contact with humans, potentially facilitating zoonotic transmission (Guernier et al., 2014). Similarly, studies from South America have reported flea-associated Rickettsia circulation across diverse environments, with prevalence patterns strongly influenced by host assemblages and ecological context (Acosta et al., 2019; Ruiz et al., 2021). In contrast, lice are more host-specific and less mobile between species, which may explain their lower epidemiological relevance in the transmission of Rickettsia spp. in Sardinia (Bush & Clayton, 2006).
Several methodological limitations should be considered. The low prevalence observed restricts the strength of conclusions regarding pathogen distribution and host associations, and sequencing failures at certain loci (one sca4 and one htrA amplicon) may have led to an underestimation of genetic diversity. Additionally, the opportunistic nature of sampling could have introduced biases toward particular hosts or habitats, as also reported in large-scale South American surveys where uneven sampling and low detection rates necessitated cautious interpretation of host–vector networks (Dall’Agnol et al., 2017; Low et al., 2017; Martinez et al., 2023; Prasetyo et al., 2024; Silva et al., 2017; Souza et al., 2021; Troyo, 2016). Limited sequencing depth may have further obscured rare variants, highlighting the need for more extensive phylogenetic analyses in future studies.
The multilocus molecular approach has proven effective for reliable species-level identification despite gltA’s limited discriminatory power. This strategy is consistent with recent large-scale molecular surveys integrating multilocus and phylogenetic analyses to resolve Rickettsia diversity across complex ecological systems (López Berrizbeitia et al, 2024). All successfully sequenced loci showed 100% identity with global R. asembonensis strains, supporting previous observations of limited genetic variability at these loci (Maina et al., 2019).
This study also highlights the ecological diversity of Sardinia’s ectoparasite fauna and reinforces the need for surveillance that integrate domestic animals, wildlife, and their associated ectoparasites. Focused surveillance of both prevalent and rare ectoparasites is crucial for revealing potential hidden reservoirs of zoonotic pathogens and for advancing our understanding of the complex host–vector–pathogen dynamics within Mediterranean ecosystems.
Detection of R. asembonensis in human blood samples underscores its potential as a zoonotic agent. Although its pathogenicity has not been definitively established, its identification in febrile patients who tested negative for other known pathogens (Loyola et al., 2024; Moonga et al., 2021; Palacios-Salvatierra et al., 2018), along with its demonstrated ability to replicate in mammalian cell lines (Palacios-Salvatierra et al., 2018), suggests a possible role in human disease.
Furthermore, R. asembonensis has recently been identified in small ruminants (Low et al., 2022), indicating a possible role for these animals in its ecology and maintenance within enzootic cycles. In regions such as Sardinia, where sheep farming plays a vital role in the local economy, targeted surveillance is crucial to evaluate the potential zoonotic risk and to clarify the involvement of livestock in the circulation of emerging rickettsial pathogens.
In conclusion, this study provides the first confirmation of R. asembonensis in Sardinia and contributes to a broader understanding of flea-borne Rickettsia in the Mediterranean. Future research should focus on expanding host and vector sampling, increasing molecular detection sensitivity, and investigating potential human exposure. Longitudinal studies incorporating larger sample sizes and additional ectoparasite species will be crucial to clarify the ecology, distribution, and epidemiological relevance of R. asembonensis in southern Europe.
Funding
This study was supported by funds from the Research Project RC IZS SA 01/22 of the Istituto Zooprofilattico Sperimentale della Sardegna.
Ethical statement
No ethical approval was required for this study, as ectoparasites were collected during routine post-mortem examinations of domestic and wild animals submitted to the Istituto Zooprofilattico Sperimentale della Sardegna (IZS) for diagnostic purposes, in accordance with national regulations on animal health surveillance (Legislative Decree No. 26/2014, implementing Directive 2010/63/EU).
CRediT authorship contribution statement
Valentina Chisu: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Laura Giua: Writing – review & editing, Methodology, Formal analysis, Conceptualization. Rosanna Zobba: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Resources, Project administration, Methodology, Investigation, Funding acquisition, Formal analysis, Data curation, Conceptualization. Giovanna Chessa: Writing – review & editing, Visualization, Conceptualization. Giovanna Masala: Writing – review & editing, Formal analysis, Conceptualization. Pierangela Cabras: Writing – review & editing, Writing – original draft, Conceptualization. Cipriano Foxi: Writing – review & editing, Visualization, Validation. Carla Cacciotto: Writing – review & editing, Writing – original draft, Visualization, Formal analysis, Data curation, Conceptualization. Emanuela Bazzoni: Writing – review & editing, Formal analysis, Conceptualization. Alberto Alberti: Writing – review & editing, Writing – original draft, Visualization, Validation, Supervision, Methodology, Formal analysis, Conceptualization.
Declaration of competing interest
No conflict of interest declared.
Contributor Information
Valentina Chisu, Email: valentina.chisu@izs-sardegna.it.
Laura Giua, Email: laura.giua@izs-sardegna.it.
Rosanna Zobba, Email: zobba@uniss.it.
Giovanna Chessa, Email: giovanna.chessa@izs-sardegna.it.
Giovanna Masala, Email: giovanna.masala@izs-sardegna.it.
Pierangela Cabras, Email: pierangela.cabras@izs-sardegna.it.
Cipriano Foxi, Email: cipriano.foxi@izs-sardegna.it.
Carla Cacciotto, Email: ccacciotto@uniss.it.
Emanuela Bazzoni, Email: e.bazzoni2@phd.uniss.it.
Alberto Alberti, Email: alberti@uniss.it.
References
- Acosta D.B., Ruiz M., Sanchez J.P. First molecular detection of Mycoplasma suis in the pig louse Haematopinus suis (Phthiraptera: Anoplura) from Argentina. Acta Tropica. 2019;194:165–168. doi: 10.1016/j.actatropica.2019.04.007. [DOI] [PubMed] [Google Scholar]
- Barradas P.F., Mesquita J.R., Mateus T.L., Ferreira P., Amorim I., Gärtner F., de Sousa R. Molecular detection of Rickettsia spp. in ticks and fleas collected from rescued hedgehogs (Erinaceus europaeus) in Portugal. Experimental and Applied Acarology. 2021;83:449–460. doi: 10.1007/s10493-021-00600-y. [DOI] [PubMed] [Google Scholar]
- Berlinguer G. Il Pensiero Scientifico Editore; 1964. Aphaniptera d’Italia: Studio monografico. [Google Scholar]
- Bitam I., Dittmar K., Parola P., Whiting M.F., Raoult D. Fleas and flea-borne diseases. International Journal of Infectious Diseases. 2010;14(8):667–676. doi: 10.1016/j.ijid.2009.11.011. [DOI] [PubMed] [Google Scholar]
- Blanton L.S. The Rickettsioses: A practical update. Infectious Disease Clinics of North America. 2019;33(1):213–229. doi: 10.1016/j.idc.2018.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bush S.E., Clayton D.H. The role of body size in host specificity: Reciprocal transfer experiments with feather lice. Evolution. 2006;60(10):2158–2167. doi: 10.1111/j.0014-3820.2006.tb01890.x. [DOI] [PubMed] [Google Scholar]
- Chisu V., Masala G., Foxi C., Socolovschi C., Raoult D., Parola P. Rickettsia conorii israelensis in Rhipicephalus sanguineus ticks. Ticks and Tick-borne Diseases. 2014;5(4):446–448. doi: 10.1016/j.ttbdis.2014.02.003. [DOI] [PubMed] [Google Scholar]
- Chisu V., Zobba R., Foxi C., Pisu D., Masala G., Alberti A. Molecular detection and groEL typing of Rickettsia aeschlimannii in Sardinian ticks. Parasitology Research. 2016;115(9):3323–3328. doi: 10.1007/s00436-016-5091-5. [DOI] [PubMed] [Google Scholar]
- Chisu V., Foxi C., Masala G. First molecular detection of the human pathogen Rickettsia raoultii and other spotted fever group rickettsiae in Ixodid ticks from wild and domestic mammals. Parasitology Research. 2018;117(11):3421–3429. doi: 10.1007/s00436-018-6036-y. [DOI] [PubMed] [Google Scholar]
- Chisu V., Giua L., Bianco P., Chessa G., Foxi C., Muroni G., Masala G., Piredda I. Seasonal dynamics and pathogen diversity of tick species parasitizing migratory birds in Sardinia, Italy: Implications for the spread of Rickettsia, Babesia, and Theileria species. Veterinary Sciences. 2025;12(8):753. doi: 10.3390/vetsci12080753. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ciceroni L., Pinto A., Ciarrocchi S., Ciervo A. Current knowledge of rickettsial diseases in Italy. Annals of the New York Academy of Sciences. 2006;1078:143–149. doi: 10.1196/annals.1374.024. [DOI] [PubMed] [Google Scholar]
- Dall’Agnol B., Souza U., Webster A., Weck B., Stenzel B., Labruna M., Klafke G., Martins J.R., Ferreira C.A.S., Reck J. Candidatus Rickettsia asemboensis” in Rhipicephalus sanguineus ticks, Brazil. Acta Tropica. 2017;167:18–20. doi: 10.1016/j.actatropica.2016.12.008. [DOI] [PubMed] [Google Scholar]
- De la Fuente J., Antunes S., Bonnet S., Cabezas-Cruz A., Domingos A.G., Estrada-Peña A., Johnson N., Kocan K.M., Mansfield K.L., Nijhof A.M., Papa A., Rudenko N., Villar M., Alberdi P., Torina A., Ayllón N., Vancová M., Golovchenko M., Grubhoffer L., Caracappa S., Fooks A.R., Gortazar C., Rego R.O.M. Tick-pathogen interactions and vector competence: Identification of molecular drivers for tick-borne diseases. Frontiers in Cellular and Infection Microbiology. 2017;7:114. doi: 10.3389/fcimb.2017.00114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fournier P.E., Roux V., Raoult D. Phylogenetic analysis of spotted fever group rickettsiae by study of the outer surface protein rOmpA. International Journal of Systematic Bacteriology. 1998;48(Pt 3):839–849. doi: 10.1099/00207713-48-3-839. [DOI] [PubMed] [Google Scholar]
- Gilles J., Silaghi C., Just F.T., Pradel I., Pfister K. Polymerase chain reaction detection of Rickettsia felis-like organism in Archaeopsylla erinacei (Siphonaptera: Pulicidae) from Bavaria, Germany. Journal of Medical Entomology. 2009;46(3):703–707. doi: 10.1603/033.046.0338. [DOI] [PubMed] [Google Scholar]
- Gomez-Barroso D., Vescio M.F., Bella A., Ciervo A., Busani L., Rizzo C., Rezza G., Pezzotti P. Mediterranean spotted fever rickettsiosis in Italy, 2001–2015: Spatio-temporal distribution based on hospitalization records. Ticks and Tick-borne Diseases. 2019;10(1):43–50. doi: 10.1016/j.ttbdis.2018.09.001. [DOI] [PubMed] [Google Scholar]
- Gong L., Diao L., Lv T., Liu Y., Liu J., Zhang W., Xie X., Cao Y. A comprehensive review of tick-borne disease epidemiology, clinical manifestations, pathogenesis, and prevention. Animal and Zoonoses. 2025;1(3):254–265. doi: 10.1016/j.azn.2025.05.004. [DOI] [Google Scholar]
- Guernier V., Lagadec E., LeMinter G., Licciardi S., Balleydier E., Pagès F., Laudisoit A., Dellagi K., Tortosa P. Fleas of small mammals on Reunion Island: Diversity, distribution and epidemiological consequences. PLoS Neglected Tropical Diseases. 2014;8(9):e3129. doi: 10.1371/journal.pntd.0003129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hall T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series (Oxford) 1999;41:95–98. doi: 10.1093/nass/41.95. [DOI] [Google Scholar]
- Hornok S., Meli M.L., Perreten A., Farkas R., Willi B., Beugnet F., Lutz H., Hofmann-Lehmann R. Molecular investigation of hard ticks (Acari: Ixodidae) and fleas (Siphonaptera: Pulicidae) as potential vectors of rickettsial and mycoplasmal agents. Veterinary Microbiology. 2010;140(1-2):98–104. doi: 10.1016/j.vetmic.2009.07.013. [DOI] [PubMed] [Google Scholar]
- Jiang J., Maina A.N., Knobel D.L., Cleaveland S., Laudisoit A., Wamburu K., Ogola E., Parola P., Breiman R.F., Njenga M.K., Richards A.L. Molecular detection of Rickettsia felis and Candidatus Rickettsia asemboensis in fleas from human habitats, Asembo, Kenya. Vector-Borne and Zoonotic Diseases. 2013;13(8):550–558. doi: 10.1089/vbz.2012.1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kolo A.O., Sibeko-Matjila K.P., Maina A.N., Richards A.L., Knobel D.L., Matjila P.T. Molecular detection of zoonotic rickettsiae and Anaplasma spp. in domestic dogs and their ectoparasites in Bushbuckridge, South Africa. Vector-Borne and Zoonotic Diseases. 2016;16:245–252. doi: 10.1089/vbz.2015.1849. [DOI] [PubMed] [Google Scholar]
- Krueger L., Bai Y., Bennett S., Fogarty C., Sun S., Kosoy M., Maina A., Nelson K., Platzer E., Osikowicz L., Richards A.L., Shariar F., Trinidad A., Cummings R. Identification of zoonotic and vector-borne infectious agents associated with opossums (Didelphis virginiana) in residential neighbourhoods of Orange County, California. In: Timm R.M., Baldwin R.A., editors. Proceedings of the 27th Vertebrate Pest Conference; Davis, USA; University of California; 2016. pp. 268–279. 7–10 March 2016. [DOI] [Google Scholar]
- López Berrizbeitia M.F., Acosta D.B., Sanchez J.P. Wild rodent fleas carrying Bartonella and Rickettsia in an area endemic for vector-borne diseases from Argentina. Scientific Reports. 2024;14(1) doi: 10.1038/s41598-024-74786-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Low V.L., Prakash B.K., Tan T.K., Sofian-Azirun M., Anwar F.H.K., Vinnie-Siow W.Y., AbuBakar S. Pathogens in ectoparasites from free-ranging animals: Infection with Rickettsia asembonensis in ticks, and a potentially new species of Dipylidium in fleas and lice. Veterinary Parasitology. 2017;245:102–105. doi: 10.1016/j.vetpar.2017.08.015. [DOI] [PubMed] [Google Scholar]
- Low V.L., Azhar S.S., Tan T.K., Bathmanaban P., AbuBakar S., Chandrawathani P., Nizamuddin H.N.Q., Hanim M.S.F., Akma N.H., Norlizan M.N., Lim Y.A.L. First report of Rickettsia asembonensis in small ruminants. Veterinary Research Communications. 2022;46:979–983. doi: 10.1007/s11259-022-09912-9. [DOI] [PubMed] [Google Scholar]
- Loyola S., Palacios-Salvatierra R., Cáceres-Rey O., Richards A.L. Rickettsia asembonensis isolated from four human cases with acute undifferentiated febrile illness in Peru. Pathogens. 2024;13(6):489. doi: 10.3390/pathogens13060489. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maina A.N., Jiang J., Luce-Fedrow A., St John H.K., Farris C.M., Richards A.L. Worldwide presence and features of flea-borne Rickettsia asembonensis. Frontiers in Veterinary Science. 2019;5:334. doi: 10.3389/fvets.2018.00334. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Martínez Díaz H.C., Gil-Mora J., Betancourt-Ruiz P., Silva-Ramos C.R., Matiz-González J.M., Villalba-Perez M.A., Ospina-Pinto M.C., Ramirez-Hernández A., Olaya-M L.A., Bolaños E., Cuervo C., Benavides E., Hidalgo M. Molecular detection of tick-borne rickettsial pathogens in ticks collected from domestic animals from Cauca, Colombia. Acta Tropica. 2023;238 doi: 10.1016/j.actatropica.2022.106773. [DOI] [PubMed] [Google Scholar]
- Merhej V., Angelakis E., Socolovschi C., Raoult D. Genotyping, evolution and epidemiological findings of Rickettsia species. Infection, Genetics and Evolution. 2014;25:122–137. doi: 10.1016/j.meegid.2014.03.014. [DOI] [PubMed] [Google Scholar]
- Moonga L.C., Hayashida K., Mulunda N.R., Nakamura Y., Chipeta J., Moonga H.B., Namangala B., Sugimoto C., Mtonga Z., Mutengo M., Yamagishi J. Molecular detection and characterization of Rickettsia asembonensis in human blood, Zambia. Emerging Infectious Diseases. 2021;27:2237–2239. doi: 10.3201/eid2708.203467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- National Parks Association. (n.d.). Gennargentu National Park. Retrieved from https://nationalparksassociation.org/italy-national-parks/gennargentu-national-park/. Accessed January 9, 2026.
- Palacios-Salvatierra R., Cáceres-Rey O., Vasquez-Dominguez A., Mosquera-Visaloth P., Anaya-Ramirez E. Rickettsia species in human cases with non-specific acute febrile syndrome in Peru. Revista Peruana de Medicina Experimental y Salud Publica. 2018;35:630–635. doi: 10.17843/rpmesp.2018.354.3646. [DOI] [PubMed] [Google Scholar]
- Prasetyo D.B., Fiorenzano J.M., Nop D., Noch N., Huot B., Mom S., Prum S., Chhe V., Dul S., Heang V., Prom S., Jiang J., Richards A.L., Farris C.M., Hertz J.C. Molecular detection of Rickettsia species in ectoparasites collected from two southern provinces of Cambodia. PLoS Neglected Tropical Diseases. 2024;18(9) doi: 10.1371/journal.pntd.0012544. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Price M.A., Graham O.H. 1st ed. United States Department of Agriculture, Agricultural Research Service; 1997. Chewing and sucking lice as parasites of mammals and birds. (Technical Bulletin 1849. [Google Scholar]
- Roux V., Rydkina E., Eremeeva M., Raoult D. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. International Journal of Systematic Bacteriology. 1997;47(2):252–261. doi: 10.1099/00207713-47-2-252. [DOI] [PubMed] [Google Scholar]
- Roux V., Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the gene encoding the outer-membrane protein rOmpB (ompB) International Journal of Systematic and Evolutionary Microbiology. 2000;50(Pt 4):1449–1455. doi: 10.1099/00207713-50-4-1449. [DOI] [PubMed] [Google Scholar]
- Ruiz M., Acosta D.B., Baricalla A., Sánchez J.P. Molecular detection of Rickettsia in ectoparasites (Siphonaptera and Phthiraptera) of domestic and feral pigs from Argentina. Parasitology Research. 2021;120(10):3611–3618. doi: 10.1007/s00436-021-07291-9. [DOI] [PubMed] [Google Scholar]
- Ruiz M., Alonso R.J., Rospide M., Acosta D.B., Cavia R., Sanchez J.P. Diversity and eco-epidemiology of ectoparasites and Rickettsia spp. associated with the opossums Didelphis albiventris Lund in livestock farms from the Argentinian Pampas region. Medical and Veterinary Entomology. 2025;39(3):431–444. doi: 10.1111/mve.12796. Erratum in: Med Vet Entomol, 39(4), 900. ht tps:/ /doi. org/10.1111 /mve.70023. [DOI] [PubMed] [Google Scholar]
- Schötta A.M., Wijnveld M., Höss D., Stanek G., Stockinger H., Markowicz M. Identification and characterization of "Candidatus Rickettsia Thierseensis", a novel spotted fever group rickettsia species detected in Austria. Microorganisms. 2020;8(11):1670. doi: 10.3390/microorganisms8111670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Séguy E. Paul Lechevalier et Fils; 1944. Insectes Ectoparasites (Mallophages, Anoploures, Siphonaptéres) Faune de France (43) [Google Scholar]
- Silva A.B., Vizzoni V.F., Costa A.P., Costa F.B., Moraes-Filho J., Labruna M.B., Gazêta G.S., de Maria Seabra Nogueira R. First report of a rickettsia asembonensis related infecting fleas in Brazil. Acta Tropica. 2017;172:44–49. doi: 10.1016/j.actatropica.2017.04.004. [DOI] [PubMed] [Google Scholar]
- Souza U.A., Webster A., Dall’Agnol B., Peters F.B., Favarini M.O., Schott D., Zitelli L.C., Mazim F.D., Kasper C.B., Ott R., Trigo T.C., Reck J., Soares J.F. Ticks, mites, fleas, and vector-borne pathogens in free-ranging neotropical wild felids from southern Brazil. Ticks and Tick-borne Diseases. 2021;12(6) doi: 10.1016/j.ttbdis.2021.101707. [DOI] [PubMed] [Google Scholar]
- Troyo A., Moreira-Soto R.D., Calderon-Arguedas Ó., Mata-Somarribas C., Ortiz-Tello J., Barbieri A.R., Avendaño A., Vargas-Castro L.E., Labruna M.B., Hun L., Taylor L. Detection of rickettsiae in fleas and ticks from areas of costa rica with history of spotted fever group rickettsioses. Ticks Tick Borne Disease. 2016;7(6):1128–1134. doi: 10.1016/j.ttbdis.2016.08.009. [DOI] [PubMed] [Google Scholar]
- Urdapilleta M., Pech-May A., Lamattina D., Burgos E.F., Balcazar D.E., Ferrari W.A.O., Lareschi M., Salomón O.D. Ecology of fleas and their hosts in the trifinio of north-east Argentina: First detection of rickettsia asembonensis in ctenocephalides felis felis in argentina. Medical and Veterinary Entomology. 2022;36(1):20–29. doi: 10.1111/mve.12546. [DOI] [PubMed] [Google Scholar]
References
- Acosta D.B., Zanocco F.A., Ruiz M., Sanchez J.P. Domestic dogs as hosts of ectoparasites carrying Rickettsia, Bartonella, and Mycoplasma in urban, peri-urban and rural areas from central Argentina. Mastozoología Neotropical. 2024;31(1) doi: 10.31687/saremMN.24.31.01.05.e0991. [DOI] [Google Scholar]
- Socolovschi C., Mediannikov O., Raoult D., Parola P. Arthropod-borne infections in humans: Rickettsioses and Bartonelloses. Current Opinion in Infectious Diseases. 2012;25(5):500–506. doi: 10.1097/QCO.0b013e3283584ac8. [DOI] [PubMed] [Google Scholar]

