EFFECTS OF QUERCETIN ON ROOSTER REPRODUCTION Quercetin upregulates steroid hormone biosynthesis to enhance reproductive performance in roosters

Abstract

Quercetin (Que) possesses diverse biological activities and has been extensively investigated in various fields, but its impact on rooster reproductive performance and the underlying mechanisms remains poorly understood. The present study investigated the effect of quercetin on reproductive performance of roosters and preliminarily explored its underlying regulatory mechanism. Forty-eight 100-day-old roosters were randomly divided into control group and three quercetin groups (Que_5mg/d, Que_10mg/d, and Que_20mg/d). Daily gavage was conducted continuously for 60 days. Semen quality was evaluated using a sperm analyzer. Then, metabolomics, proteomics, network pharmacology, molecular dynamics simulation, hormone detection, qRT-PCR, and their combination analysis was employed for mechanism validation. The result of semen quality evaluation and testicular tissue morphology observation showed that quercetin can significantly increase the semen collection volume, semen motility (P < 0.05), sperm density was significantly higher in the Que_5mg/d and Que_10mg/d groups than in the control group (P < 0.05), and the diameter of the seminiferous tubules, the height of the seminiferous epithelium of the testes (P < 0.05). Consistently, both testicular metabolomics and hormone detection results indicated that quercetin significantly increased testosterone levels (P < 0.05). Metabolite KEGG enrichment analysis revealed a significant upregulation of the steroid hormone biosynthesis. Proteomics and qRT-PCR assays confirmed that quercetin upregulated the expression of genes such as CYP11A1, CYP17A1, and molecular docking and molecular dynamics simulations further indicate that quercetin has a favorable binding with steroid hormone biosynthesis related protein CYP11A1. These results demonstrates that supplementation with quercetin at a dosage of 10 mg/d can enhances reproductive performance in roosters by targeting steroid hormone biosynthesis-related proteins to promote hormone synthesis.

Graphical abstract

INTRODUCTION

The reproductive performance of breeder roosters plays a pivotal role in the stable transmission of superior genetic traits and the improvement of reproductive capacity in meat breeder flocks, which directly determines the core benefits of breeding production (Barbarestani et al., 2024a; Daryatmo et al., 2024). Semen quality is a crucial prerequisite for ensuring the fertilization rate and hatching rate of hatching eggs (Sabzian-Melei et al., 2022); however, in practical poultry production, the reproductive performance of breeding roosters is susceptible to multiple factors such as frequent semen collection, disease infestation, unbalanced feed nutrition, aging, and environmental stress, leading to decreased semen quality and thereby significantly restricting the improvement of farm economic benefits (Hayanti et al., 2022; Shaheen et al., 2022). Therefore, exploring safe, efficient, and mechanism-clear schemes for improving reproductive performance holds important practical significance in production.

Supplementing feed additives is a common strategy to improve the reproductive performance of breeding roosters (Ansari et al., 2018; Long et al., 2025). Existing studies have confirmed that amino acid supplementation can enhance the reproductive performance of aged breeding roosters (Samiei et al., 2025), antioxidant addition can effectively improve semen quality (Barbarestani et al., 2025), and probiotics, vitamins, and herbal medicines have also been reported to promote sperm quality and fertilization capacity in roosters (Khan et al., 2013; Zhao et al., 2025a). However, most current regulatory methods suffer from problems such as high cost, insufficient effect stability, or complex and difficult-to-parse mechanisms, which limit their wide application in large-scale breeding (Li et al., 2025).

Quercetin is a flavonoid compound widely distributed in plants (Liu et al., 2025b), exhibitsdiverse biological activities, including anti-inflammatory and antioxidant (Zhao et al., 2025b), immunomodulatory, antibacterial (Yang et al., 2025a), as well as metabolic regulatory functions (Zhang et al., 2024). It has been recognized as a GRAS substance (Generally Recognized As Safe) by the FDA in the United States, and is classified as a food additive in Japan and Korea (Huang et al., 2024). In poultry production, quercetin has been extensively studied as a potential alternative to antibiotics, owing to its high safety and non-pollution properties, for enhancing animal health and performance (Nguyen and Bhattacharya, 2022). In laying hens, Quercetin was found to improve egg production performance (El-Saadany et al., 2022; Wei et al., 2024). Liu et al. showed that quercetin and soy flavonoids improved egg quality by increasing the antioxidant capacity of egg yolk and regulating lipid metabolism in laying hens (Liu et al., 2023). In broiler chickens, quercetin has been shown to improve growth performance and enhance the intestinal microbial environment (Abdel-Latif et al., 2021), as well as regulate the meat quality by regulating the PI3K/PKB/AMPK signaling pathway (Wang et al., 2022). However, the efficacy of quercetin on rooster reproductive performance and the underlying mechanism governing spermatogenesis remains unclear, necessitating further exploration.

The present study aims to investigate the influence of quercetin on rooster reproductive performance. Initially, we delineate its effects on reproductive performance by evaluating key phenotypic endpoints, including semen quality, testicular histoarchitecture. Subsequently, we integrate metabolomic, steroid hormone secretion, proteomic profiles, and network pharmacology, molecular dynamics simulations to elucidate the underlying molecular mechanisms governing its regulatory actions. It is expected to provide new theoretical basis and practical references for the application of quercetin in poultry production.

MATERIALS AND METHODS

Experimental animals

All animal experiments in this study were performed in accordance with the recommendations of Council for International Organizations of Medical Sciences for animal use, and were approved by the Animal Care and Use Committee on the Ethics of Animal Experiments of Guangxi University (NO. GXU2020-011).

Forty-eight healthy 100-day-old male Guangxi Ma chickens weighing (2,175 ± 24 g) were selected as experimental animals. They were housed individually in cages (45 cm × 33 cm × 50 cm; length × width × height) at the Breeding Farm of Guangxi Fufeng Agriculture and Animal Husbandry Group, in accordance with standard rearing practices for roosters. The lighting cycle was set at 60 lx with a 12 h photoperiod, with an indoor temperature of (24°C ± 2°C) and humidity of 55%. They had free access to feed and water. Maintenance feed was purchased from Guangxi Dafuhua Agriculture and Animal Husbandry Feed Co., Ltd (Table 1).

Table 1.

Composition and nutrient levels of basic rations for roosters.

Ingredients	Proportion (%)	Nutrient Calculation1
Corn	59.8	Metabolizable energy (MJ/kg): 12.35
Soybean meal	21.4	Crude protein (%): 19.5
Wheat bran	3	Lysine (%): 1.08
Fish meal	6.6	Methionine (%): 0.4
wheat middlings	2.5	Calcium (%): 0.94
Barley	1.6	Effective Phosphorus (%): 0.55
Lime powder	1.6	Sodium Chloride (%): 0.5
Calcium phosphate	1.5	Crude Fiber (%): 2.4
Premixes1*	2	Crude ash (%): 4.7
Total	100

^⁎Provided per kilogram of diet: vitamin A, 12, 000 IU; vitamin D3, 5000 IU; vitamin E, 30 IU; vitamin K3, 3.605 mg; vitamin B1 (thiamine), 3.0 mg; vitamin B2 (riboflavin), 8.0 mg; vitamin B6, 4.950 mg; vitamin B12, 17.0 mg; niacin. 60.0 mg; D-Biotin 200.0 mg; d-Calcium pantothenate, 18.333 mg; folic acid, 2.083 mg; manganese, 100.0 mg; iron, 80.0 mg; zinc, 80.0 mg; copper, 8.0 mg; iodine, 2.0 mg; cobalt, 500.0 mg; selenium, 150 mg.

¹Nutrient Calculation according to NRC (1994).

Main reagents

Quercetin was purchased from Shanghai McLean Biochemical Technology Co., Ltd (Shanghai, China). (Product Model: Q817162 Quercetin-250 g, Molecular Formula: C₁₅H₁₀O₇, Specification: 97%, CAS No.: 117-39-5, MDL No.: MFCD00006828).

Experimental groups

Roosters were divided into four groups (n=12): Control, Low-dose group (Que_5mg/d), Medium-dose group (Que_10mg/d), and High-dose group (Que_20mg/d). Prior to the experiment, roosters were acclimated for 3 days after grouping. Following the initiation of the experiment, daily administration was conducted at 10:00 AM. Each group received a precisely measured dose of quercetin that was fully dissolved in water (Que_5mg/d, Que_10mg/d, Que_20mg/d, respectively), administered gavage was performed using a 1 mL syringe. The Control group received 1 mL of water via syringe gavage daily. Treatment continued for 60 consecutive days (Zhao et al., 2025a).

Measurement indicators and methods

Semen collection volume and semen quality

Following 30 days of quercetin administration, semen samples were collected from roosters by abdominal massage for volume measurement (13 collections in total) (Burrows and Quinn, 1937; Barbarestani et al., 2024b), with semen quality (sperm motility, Sperm density, abnormal morphology rate, and kinematic parameters) on days 56, 58, and 60 being further evaluated by Computer-Assisted Sperm Analysis (Gill and Amann, 2002), The specific procedures were as follows: Fresh semen was diluted 100-fold with 37°C physiological saline, and 3 μL of diluted semen was injected onto a 20-micron 4-chamber slide (Leja, Netherlands). Computer-assisted sperm analysis (CASA) was performed on each sample using an HTM-IVOS II (Hamilton Thorne Biosciences, Beverly, MA, USA), capturing 8 random fields of view to measure sperm concentration, motility, and morphology. Semen quality data were presented as the average of three measurements. The analysis parameters were set as follows: the head and tail were labeled with two distinct colors, with the tail marked red at a minimum brightness of 121 and the head marked blue at a brightness of 113. For motion parameters: slow VAP (μm/s): 40, slow VSL: 6, progressive STR: 80, static VSL: 0. The settings were performed according to Hong et al. (2022).

Fertilization rate and hatching rate

Semen from each group of roosters was collected, pooled, and diluted 1:1 with the same diluent. Subsequently, 30 μL of semen was introduced into 120 Guangxi Ma hens per group via artificial insemination., and fertilized egg were collected on the second day post-insemination and was performed three times. 224 breeder eggs were collected from each group per collection. After 30 minutes of disinfection, the fertilized eggs were incubated. On day 10 of incubation, the fertilization rate of the hatching eggs was determined by candling. After examination, the eggs continued to be incubated until day 21 (Hong et al., 2022; Barbarestani et al., 2024a). Three artificial inseminations (AI) were performed, and the data obtained from these three trials were subjected to significance analysis using one-way ANOVA to compare the fertility rate and hatchability rate among groups (Weaver and Ramachandran, 2023). Fertility rate = (Number of fertilized eggs / Total number of incubated eggs) × 100%. Hatchability = (Number of hatched chicks / Total number of incubated eggs) × 100%.

Morphological structure observation of rooster testicular tissue

Select roosters with comparable body weight prior to the experiment. Weigh subjects using an electronic scale after a 12-hour fast on days 0, and 60. After 60 days of continuous quercetin treatment, the roosters were euthanized, and samples including testicular tissue and blood were collected, and calculate the testicular coefficient. Calculation formula: Testicular coefficient = Total testicular weight (g) / Body weight (g) × 100%. A portion of the testicular tissue was collected for histological sectioning. (1) A portion of testicular tissues were fixed with 4% paraformaldehyde for 24 h; (2) Ten testicular tissues per treatment were dehydrated and fixed with paraffin in a 2T-12M tissue processor (XiaoganYaguang Medical Electronic Technology Co., Ltd., Xiaogan, P. R. China); (3) Embedded in paraffin blocks using an embedding system (Leica, Germany); (4) Sections were sliced into 5 μm diameter using a rotary microtome (Leica, Germany); (5) Hematoxylin-eosin staining (Solarbio, Beijing, China); (6) Using an EVOS™ M5000 Imaging System (Thermo Fisher Scientific, America), the values for the seminiferous tubule diameter (STD) and seminiferous tubule epithelial height (SHE) were measured 6 times from different seminiferous tubules of a testis from per breeder rooster. According to the evaluation criteria of Hong et al (Hong et al., 2022).

Reproductive hormone test

The serum and testicular tissue samples were collected to detect the following indicators: testosterone (T, Item No: YPJV1160), follicle stimulating hormone (FSH, Item No: YPJ1870), anti-Müllerian hormone (AMH, Item No: SYP-C0150), luteinizing hormone (LH, Item No: CEA441Ga) and Chicken Insulin-like growth factor 1 (IGF1, Item No: YPJ1926) levels were detected by using an enzyme-linked immunosorbent assay (ELISA) method (Reagents were purchased from UpingBio Co., Ltd., Hangzhou, China). The test operations were performed according to the instructions of the assay kit, respectively.

Serum biochemical index testing

Collected serum was removed from -20 °C refrigerator and thawed, and 400 μL of serum was aspirated for each sample for testing. Serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), uric acid (UA), albumin (ALB), direct bilirubin (DBIL), total bilirubin (TBIL), urea, cholesterol (CHOL), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), Serum ionic levels, including Calcium (Ca), Phosphorus (P), Iron (Fe) and Magnesium (Mg), levels were measured spectrophotometrically by commercial kits (URIT Medical Electronic Co., Ltd., Guilin, P. R. China). All assays were performed by a URIT-8021AVet Auto-Blood Biochemical Analyzer (URIT Medical Electronic Co., Ltd., Guilin, China) according to the manufacturer’s instructions.

Metabolomics analysis

Testicular tissue was shipped on dry ice to Novogene Co. Ltd for metabolomics analysis. (1) Data Preprocessing and Metabolite Identification: Raw data files were converted to mzXML format using ProteoWizard. Peak extraction and quantification were performed with XCMS, followed by peak alignment across samples based on retention time, mass-to-charge ratio, and other parameters. Metabolite identification was conducted by matching against high-quality secondary mass spectrum databases, utilizing a 10 ppm mass tolerance and sum ion information. (2) Statistical Data Analysis: Annotate identified metabolites using KEGG, HMDB, and LIPIDMaps databases. For multivariate analysis, perform partial least squares discriminant analysis (PLS-DA) using the metabolomics data processing software metaX to obtain the VIP values for each metabolite. For univariate analysis, t-tests were performed to calculate the statistical significance (P-value) of metabolites between groups. The default criteria for identifying differentially expressed metabolites were VIP > 1, P - value < 0.05, and fold change (FC) ≥ 2 or FC ≤ 0.5. All graphical representations were generated using R software. The KEGG database was employed to investigate metabolite functions and metabolic pathways. A metabolic pathway was considered significantly enriched when its P < 0.05.

Proteomics analysis

Testicular tissue was shipped on dry ice to Novogene Co. Ltd for proteomics analysis. The procedure comprised: total protein extraction, protein purification, proteolytic digestion, DIA mode liquid chromatography-mass spectrometry (LC-MS) analysis, data analysis, protein identification, and quantification. For Blood-Plus (all platforms), raw data de-peaking and species library searching were performed using DIA-NN software (Direct DIA). Statistical analysis of protein quantification results was performed using T-tests. Proteins showing significant quantitative differences between experimental and control groups (P < 0.05, |log2FC| > 1.2) were defined as differentially expressed proteins (DEP). Functional analysis of proteins and DEPs: Functional annotation of identified proteins was performed using interproscan software for GO and IPR annotation (including Pfam, PRINTS, ProDom, SMART, ProSite, and PANTHER databases), along with COG and KEGG analysis for functional protein families and pathways. Volcano plot analysis, clustering heatmap analysis, and GO, IPR, and KEGG pathway enrichment analysis were performed for DEPs. Potential protein-protein interactions were predicted using the STRING DB software (http: //STRING.embl.de/).

Network pharmacology and molecular docking

Quercetin-corresponding targets were retrieved from the TCMSP (https://www.tcmsp-e.com/), HERB (https://herb.ac.cn/), ETCM (https://www.tcmip.cn/), SwissTargetPrediction (http://swisstargetprediction.ch/), STITCH (https://stitch.embl.de/), and SEA (https://sea.bkslab.org/) databases, with targets scoring > 0.1 (first four databases) or > 0.4 (STITCH/SEA) retained; duplicate targets were removed after merging. Spermatogenesis-related disease targets were obtained by searching GeneCards (https://www.genecards.org/) with "Spermatogenesis" and "Male Infertility" as keywords, followed by merging and deduplication. Intersection targets of quercetin and spermatogenesis-related genes were identified and visualized as a Venn diagram. KEGG enrichment analysis was performed using the DAVID database (https://david.ncifcrf.gov/) via the MicroBioinformatics platform, with the top 20 entries retained. Molecular docking was conducted using PDB (https://www.rcsb.org/), PyMOL 2.1, and AutoDock Vina 1.1.2, and visualization was achieved with PyMOL 2.1. For molecular dynamics (MD) simulation, the Amber 24 package was used: wild-type and mutant protein PDB structures were loaded via LEaP, parameterized with the ff14SB (protein) and GAFF (ligand) force fields, immersed in a TIP3P water box (10.0 Å boundary distance) with Na⁺/Cl^- for charge neutralization, and subjected to 100 ns NPT simulation (300.0 K, 1 bar) without constraints. Trajectory analysis (RMSD, Rg, SASA, RMSF, hydrogen bonds) was performed using CPPTRAJ, and binding free energy was calculated via MM/GBSA (100 frames from the last 1 ns, energy units: kJ/mol).

qRT-PCR validation of relevant genes

RNA was extracted using the RNAeasy™ Animal RNA Extraction Kit (R0027, Centrifuge Column Format, Biyun Tian Biotechnology), and cDNA was synthesized with the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Beijing Quanshijin Biotechnology Co., Ltd.) in a 20 μL reverse transcription system containing 1 μL Anchored Oligo(dT)¹⁸ Primer (0.5 μg/μl), 10 μL 2x TS Reaction Mix, 1 μL TransScript® RT/RI Enzyme Mix, 1 μL gDNA Remover, and variable RNase-free Water; the mixture was gently mixed, incubated at 42°C for 15 min, and denatured at 85°C for 5 sec to inactivate enzymes. For qRT-PCR, diluted cDNA samples were used to prepare 20 μL reaction mixtures (10 μL 2 × PerfectStar® Green qPCR SuperMix, 1 μL forward primer, 1 μL reverse primer, 8 μL cDNA) following the reagent manual (Beijing Quanshijin Biotechnology Co., Ltd.), and thermal cycling was performed as specified; primers are listed in (Table 2).

Table 2.

Primers used for qRT-PCR.

Gene	Sequence(5’→3’)	Product size (bp)	Accession number
β-actin	F: CAGCCATCTTTCTTGGGTAT R: CTGTGATCTCCTTCTGCATCC	169	NM_205518.1
CYP11A1	F: GGGTGGCATACCGTGACTAC R: ACAAAGTCCTGGCTCACCTG	160	NM_001001756.2
STAR	F: CCATCTCCTACCAACACCTGC R: ACTTTGTCTCCGTTGTCCGC	292	NM_204686.3
CYP17A1	F: GTGGTGGTGGTCAACAGCTA R: ACTTCCAGAGGGGACCGTAG	151	NM_001001901.3
AR	F: CTGCTGGGGTTCCTTCGATT R: TACAAGAACTGGCGGCACAT	174	NM_001040090.2
HSD17B1	F: GACGTCTTGGTGTGCAACG R: AAACACTGCTCTCATGGCCT	81	NM_204837.1
HSD17B3	F: CCTGTCCTCTGGTCTGGGTA R: CCGGGTTTTTGGTGCATTGT	180	XM_046935839.1
GNRH1	F: GAATGCCCTGGCTCTTACCA R: CCTTCGATCAGGCTTGCCAT	71	NM_001080877.1
HSD3B1	F: TGTTTAGCACTGAGGCAAGAG R: GACATTGCTCTGGTTTGCTCC	87	NM_205118.2

Statistical analysis

Statistics were performed using GraphPad Prism 9 software (La Jolla, CA, USA). Data are expressed as mean ± SEM. Differences between groups were analyzed by one-way ANOVA, and differences between two groups were tested by Student's t-test. P < 0.05 was considered statistically significant.

RESULTS

Quercetin enhances the semen quality in roosters

To investigate the effect of quercetin on the reproductive performance of roosters, we examined the semen quality of the roosters. The results showed that semen collection volume gradually increased with age, and all quercetin-treated groups showing significantly higher volumes compared to the control group (Fig. 1A-C, P < 0.05). The semen quality analysis indicated that sperm motility was significantly higher in all three quercetin-treated groups compared to the control group, sperm density was significantly higher in the Que_5mg/d and Que_10mg/d groups than in the control group (P < 0.05). whereas no significant differences were observed in sperm viability rate and normal morphology (P > 0.05, Fig. 1D-G). The sperm kinematic analysis revealed that the quercetin-treated group exhibited significantly higher values in average curvilinear velocity (VCL), average straight-line velocity (VSL), average path velocity (VAP), amplitude of lateral displacement of sperm head (ALH), and Average movement distance (DAP) compare to the control group (P < 0.05), which suggested a potential enhancing effect of quercetin on sperm motility (Fig. 1H, 1I, Supplementary 1-4). The fertilization rates of the Que_10mg/d group and Que_20mg/d group were 1.19% higher than that of the control group, the hatching rate of Que group was higher than that of control group, however, these differences were not were not statistically significant (P > 0.05, Fig. 1J). In conclusion, quercetin can improve the reproductive performance of roosters.

Fig. 1.

The effect of quercetin on the reproductive performance of roosters. (A) Comparison of semen collection volume per rooster across groups. (B) Comparison of semen collection volume across groups. (C) Trend chart of semen collection volume increase with collection times across groups, the horizontal axis represents the times of sperm collection attempts, and the vertical axis represents the average sperm collection volume. Sperm density (D). viability (E). motility (F). normal morphology rate (G) across different groups. (H) Sperm motility parameters, the significant differences between the experimental and control groups are marked with ༊ (P < 0.05). (I) Visually presents the trajectory diagram of sperm density and motility (blue marks motility trajectories, green marks viability trajectories, red marks dead sperm). (J) Weight and artificial insemination data, Values are given as means ± SEM, n=12, Mean values within the same abscissa with different letters differ at P < 0.05.

Quercetin promotes testicular development

To investigate the effects of quercetin on the health and testicular development of roosters, serum biochemical parameters and testicular morphology were measured. The results showed that the testicular index Que_5mg/d was significantly higher than that of the control group (P < 0.05), but there was no significant difference in testicular size (Fig. 2A-C). Observation of testicular histomorphology reaveled that both seminiferous tubule diameter and spermatogenic cell height were significantly higher in all quercetin-treated groups compared to the control group (P < 0.05, Fig. 2E-G). The serum biochemical indicators showed that except for the high-density lipoprotein cholesterol (HDL_C) level (P < 0.05), there were no significant differences in other serum biochemical indicators (Fig. 2D). In conclusion, these results indicate that quercetin can promote testicular development without inducing adverse effects on their overall health.

Fig. 2.

Effects of quercetin on serum biochemistry and testicular histomorphology in roosters. (A) Testicle diagram. (B) Testicular index. (C) Testicular weight. (D) Serum biochemical parameters, ALT: alanine aminotransferase; AST: aspartate aminotransferase; ALB: Albumin; GLU: Glucose; DBIL: direct bilirubin; TBIL: total bilirubin; UA: Uric Acid; TG: Triglyceride; CHOL: Cholesterol; HDL-C: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; Ca: Calcium; Fe: Iron; Mg: Magnesium; P: Phosphorus. Significant differences between the experimental and control groups are marked with ༊ (P < 0.05). (E) Diameter of seminiferous tubule. (F) Seminiferous tubule epithelial height. (G) Histological morphology of the testis, n=10, Mean values within the same abscissa with different letters differ at P < 0.05.

Quercetin increases the reproductive hormone levels in roosters

Testicular metabolomics were employed to further elucidate the effects of quercetin on rooster dynamic changes in metabolites. The PLS-DA result revealed a significant separation between these two groups, enabling further in-depth analysis (Fig. 3A). In the positive ion mode, 58 metabolites showed significant upregulation (Fig. 3B). Matchstick plots displays the top 20 most differential metabolites, there were 3 metabolites up-regulated in quercetin group were steroid hormones related: Testosterone, 5 beta-androstane-3,17-dione, Androstenedione (Fig. 3C). The KEGG enrichment analysis shows that only the Steroid hormone biosynthesis pathway was significantly upregulated in the quercetin group (Fig. 3E). The GSEA enrichment analysis for this pathway (ES > 0.7) further confirmed that quercetin can up-regulated this pathway (Fig. 3D).

Fig. 3.

Effects of quercetin on testicular metabolome and hormone levels. (A) Partial Least Squares Discrimination Analysis (PLS-DA), red: control group, blue: Que_10mg/d group. (B) Volcano plot of differentially expressed metabolites, significantly upregulated metabolites are red dots, significantly downregulated are blue dots. (C) Matchstick diagram, blue indicates downregulation, red indicates upregulation; bar length represents log2(Fold Change). (D) GSEA analysis diagram, the larger the ES value is, the higher the proportion of functional set metabolites in the upregulated metabolites will be. The red bars represent the upregulated situation. (E) KEGG enrichment analysis, the redder the dot, the smaller the P-value. larger dots indicate more metabolites in that pathway, n=6. (F) Testosterone content in testicular tissue. (G) Anti-Müllerian Hormone (AMH) content in testicular tissue. (H) Serum luteinizing hormone. (I) Serum AMH. (J) Serum follicle-stimulating hormone. (K) Semen insulin-like growth factor content. n=8, Mean values within the same abscissa with different letters differ at P < 0.05.

To functionally validate the predictions from our metabolomics analysis, we quantified the levels of associated hormones. The results showed that the testosterone level in the testicular tissue were significantly higher in the quercetin group compared to the control group (P < 0.05, Fig. 3F). The level of AMH in testicular tissue and LH in serum were significantly higher in the Que_10mg/d and Que_20mg/d groups compared to the control group (P < 0.05, Fig. 3G, H). The serum AMH level in the Que_10mg/d group was significantly higher than that of the control group and the Que_5mg/d group (P < 0.05, Fig. 3I). There was no significant difference in serum FSH (Fig. 3J). The insulin-like growth factor (IGF) in the semen of the Que_10mg/d group was significantly higher than the control group (P < 0.05, Fig. 3K). In conclusion, quercetin can promote the production of hormones.

Quercetin upregulates testicular protein expression in hormone synthesis

In order to investigate the underlying regulating mechanism of quercetin, we conducted testicular proteome sequencing. The results of overall distribution of CV values revealed consistently low variability, indicating excellent sample repeatability and highly reliable data (Fig. 4A). The differential expression protein analysis revealed 203 proteins that were significantly up-regulated in quercetin group, including CYP11A1, CYP17A1, LSS, etc (Fig. 4B, C). GO enrichment analysis indicated that there were 10 terms were in quercetin group, including: serine-type peptidase activity, oxidation-reduction process, and lipid metabolic process, etc (Fig. 4D). KEGG enrichment analysis revealed the Steroid hormone biosynthesis, Steroid biosynthesis, Arginine biosynthesis, PPAR signaling pathway, MAPK signaling pathway, Wnt signaling pathway, and Alanine, aspartate and glutamate metabolism were significantly up-regulated in quercetin group (Fig. 4E). Among them, Steroid hormone biosynthesis and MAPK signaling pathway can directly participate in the regulation of sperm production.

Fig. 4.

Effects of quercetin on the expression of testicular proteins and related gene expressions. (A) Coefficient of Variance (CV). (B) Differential protein volcano plot, red denotes upregulated proteins, and blue represents downregulated proteins. (C) Protein clustering heatmap. (D) GO enriched chord plot, the right side shows GO terms, a protein connected to more terms suggests its alteration affects more pathways, making it more important. (E) KEGG enrichment bubble plot: the darker the color of the point, the smaller the corresponding p-value, larger points indicate that there are more differentially expressed proteins within that pathway. (F-M) Relative expression levels of hormone-producing genes, n=6, Mean values within the same abscissa with different letters differ at P < 0.05.

Steroid hormone biosynthesis is consistent with the KEGG enrichment results of metabolomics; therefore, we focus on investigating the expression of relevant genes in this pathway. The quantitative real-time PCR (qPCR) results for steroid hormone synthesis-related genes showed that the expression of STAR, CYP11A1, AR, CYP17A1, HSD17B3 in the testes of roosters in the quercetin group was significantly up-regulated in the 10 mg quercetin group (P < 0.05), furthermore, the expression of STAR gene was also significantly higher in the Que_5mg/d and Que_20mg/d groups, the expression of AR was also significantly higher in Que_20mg/d groups. Simultaneously the expression of HSD17B1 genes was significantly higher in the Que_20mg/d group (P < 0.05). There were no difference were observed in the expression of GNRH1, HSD3B1 between all quercetin group and control group (Fig. 4F-M). In conclusion, quercetin could up-regulate the expression of testosterone biosynthesis related proteins and spermatogenic pathways.

Quercetin can target Steroid hormone biosynthesis genes

Network pharmacology analysis was conducted to further revealed the regulatory mechanism of quercetin. The combined analysis of the target gene of quercetin and male reproductive diseases target gene showed that there were 225 intersecting genes and some of which were involved in sperm production (Fig. 5A). The KEGG analysis of network pharmacology further revealed significant enrichment in the Steroid hormone biosynthesis pathway (Fig. 5B). It is mainly involved in the protein-protein interactions of genes related to steroid hormone biosynthesis (Fig. 5C). Integrated analysis of metabolomics, proteomics, and network pharmacology KEGG enrichment result showed that the Steroid hormone biosynthesis pathway was the only up-regulated pathway that was co-enriched (Fig. 5D, E).

Fig. 5.

Effects of quercetin on reproductive pathways and related genes. (A) Venn diagram: Intersection of the target points of quercetin and the target points related to "Spermatogenesis" and "Male Infertility". (B) KEGG enrichment bubble plot: The darker the color of the point, the smaller the corresponding p-value. Larger points indicate that there are more differentially expressed proteins within that pathway. (C) PPI network interaction diagram of the genes enriched in Steroid hormone biosynthesis pathway. (D) Venn diagram of enriched pathways in network pharmacology, proteomics, and metabolomics networks. (E) Visualization diagram of common pathways in metabolomics, proteomics and network pharmacology, V-shaped symbols represent pathways, triangles denote analysis methods, and circles indicate corresponding genes, proteins, or metabolites. (F) Molecular docking binding affinity table, where lower values indicate stronger binding affinity. (G) Molecular docking map.

The interaction between quercetin and six key genes involved in hormone biosynthesis was evaluated via molecular docking, and the docking scores were as follows: CYP11A1, −7.9 kcal/mol; STAR, −6.6 kcal/mol; CYP17A1, −7.9 kcal/mol; HSD17B1, −8.6 kcal/mol; HSD17B3, −9.8 kcal/mol; and AR, −8.9 kcal/mol, which suggested that quercetin binds tightly to all six genes (Fig. 5F–G). Dynamically studying the relationship between molecular movement and function at the atomic level, We also performed molecular dynamics simulations (MDS), and the results showed relatively minor fluctuations in the RMSD plot for the 100 ns simulation, implying stable RMSD values for all the hub genes (Fig. 6A). The CYP11A1-quercetin complex RMSF values provided insight into flexible movements and structural changes in specific residues (Fig. 6B). The stable fluctuation of SASA in the CYP11A1-quercetin complex indicates that its conformation and surface solvent exposure properties are stable (Fig. 6C). The radius of gyration (Rg) of the protein-compound complex remained stable throughout the simulation with small fluctuations (Fig. 6D). Furthermore, analysis of backbone hydrogen bonds revealed stable hydrogen bonding in the quercetin complex (Fig. 6E). In terms of energy calculations, the binding free energy was determined to be -58.98 ± 8 kJ/mol (ΔG_binding, Fig. 6F). Meanwhile, we generated two-dimensional and three-dimensional free energy landscapes, which demonstrated the significant stability of the complex during the entire simulation (Fig. 6G, H).

Fig. 6.

Results of molecular dynamics simulations (MDS) involving quercetin and target proteins. (A) The RMSD values for each target protein-quercetin complex. (B) Variations in protein flexibility throughout the quercetin simulation. (C) Solvent Accessible Surface Area (SASA) refers to the area of a protein surface exposed to the solvent. (D) Rg rate curve of the protein-quercetin complex. (E) Dynamics of hydrogen bonding as observed in the molecular dynamics simulations. (F) Binding energy profiles of quercetin with target proteins during the MDS calculations. (G-H) Two-dimensional (G) and three-dimensional (H) mappings of the free energy landscape (Low free energy regions are represented in dark blue, and high free energy regions in red). RMSD: root-mean-square deviation; RMSF: root-mean-square fluctuation; Rg: radius of gyration.

In conclusion, the pathway intersection analysis of proteomics, metabolomics, and network pharmacology further confirms that quercetin can upregulate Steroid hormone biosynthesis. Through molecular docking and molecular dynamics simulation, it is verified that quercetin can target the key genes involved in testosterone production, thereby promoting the level of reproductive hormones and ultimately facilitating spermatogenesis.

DISCUSSION

In the field of poultry breeding, improving the reproductive performance of roosters is of great significance for enhancing the efficiency and economic benefits of the poultry industry. Quercetin has a variety of biological activities and has been studied in other fields, but its effects on the reproductive performance of roosters and the underlying mechanisms are still unclear. The present study demonstrates that quercetin promotes reproductive performance in roosters and primary explored its underly mechanism of action.

Semen quality (sperm motility, concentration, abnormal rate, etc.) serves as a crucial indicator for evaluating rooster reproductive performance, directly determining the fertilization rate of artificially inseminated eggs (Mussa et al., 2023). Improving rooster semen quality is crucial for enhancing the economic efficiency of breeding farms (Chen et al., 2025). In the present study, semen quality assessment results suggested that quercetin significantly enhances both semen volume and sperm motility in roosters.

Sperm are produced by the proliferation and differentiation of spermatogonia within the seminiferous tubules of the testis. As the core structure for spermatogenesis in the testis, the seminiferous tubules can promote spermatogenic function when well-developed (Li et al., 2024b; Sun et al., 2025). The analysis of histological structure of the testis showed that in the quercetin treatment group, the diameter of the seminiferous tubules and the height of the spermatogenic epithelium were significantly greater than those in the control group. Studies have shown that a significant increase in the stratum productivum of the seminiferous epithelium is positively correlated with an increase in the number of supporting cells and spermatogonia, as well as an improvement in sperm production (Demyashkin et al., 2025). Moreover, an increase in the diameter of the seminiferous tubules can promote sperm production in the testis (Ma et al., 2025). Therefore, quercetin may promote the development of the testicles, thereby increasing the production of sperm. Mustafa and Oyewopo et al. also reported that quercetin enhance rat seminiferous tubule diameter, seminiferous epithelium height, and the number of spermatogenic cells at all developmental stages (Oyewopo et al., 2021; Mustafa, 2023). The serum biochemical index test showed that HDL-C was the only parameter that significantly increased, consistent with findings of Liu et al., who reported that supplementing quercetin in the diets of laying hens significantly elevated serum HDL-C levels (Liu et al., 2023). HDL-C is often referred to as "good cholesterol", and a moderate increase in its level is beneficial to the body in many ways (Chen et al., 2024). Studies have shown that HDL-C participates in cholesterol transport to regulate the synthesis of male reproductive hormones, thereby influencing reproductive performance and improving semen quality (Quinn et al., 1981; Hu et al., 2010; Louei Monfared, 2013). Thus, quercetin supplementation has no adverse effects on the health of roosters but exerts a positive effect on their reproductive performance.

The testis, as the core organ of the male reproductive system, serves as a key site for spermatogenesis, androgen secretion, and reproduction-related physiological metabolism (Liu et al., 2025a). Its spermatogenic process is a highly complex cell differentiation process regulated by the synergistic effect of protein expression and metabolic networks (Tao et al., 2023; Ma et al., 2024; Lin et al., 2025). Thus, regulating testicular spermatogenic function at the levels of protein expression and metabolism directly affects the reproductive performance of roosters. To further elucidate the mechanism by which quercetin regulates the reproductive performance of roosters, we performed metabolomic sequencing on testicular tissues from quercetin-treated roosters. The results revealed a significant upregulation of metabolites associated with steroid hormone synthesis including testosterone and androstenedione, androstenedione has been shown to be a direct precursor of testosterone and its increased levels lead to further increases in testosterone levels (Ding et al., 2021; Wang et al., 2025). The promote influence of quercetin on steroid hormone biosynthesis was further assessed by ELISA, revealing a significant upregulation in Testosterone, AMH and LH levels. The comprehensive analysis of network pharmacology, proteomics and metabolomics also comfirmed its important regulating role in regulating steroid hormone biosynthesis. Ri et al. demonstrating the critical role of steroid hormone biosynthesis pathways in maintaining testicular spermatogenic function (Ri et al., 2022). Studies have shown that the up-regulation of this pathway increases testosterone secretion and promotes spermatogenesis (Chen et al., 2023). Testosterone has been proved to promotes spermatogenesis and improves semen quality in rooster testes (Long et al., 2025). It is reported that AMH levels were positively correlated with sperm concentration (Fujisawa et al., 2002). The upregulation of the level of LH was also had been reported to upregulate the testicular steroid synthases through regulating the cAMP/PKA-CREB-StAR axis, and then promoting sperm generation in animals (Lei et al., 2025). At the same time, hormones are also the key signaling molecules that regulate the development of the testicles. Among them, testosterone and luteinizing hormone work together to jointly promote the dilation of the seminiferous tubules and the thickening of the spermatogenic epithelium, thereby facilitating the maturation of the testicle morphology and the function of spermatogenesis (Oduwole et al., 2021; Bhattacharya et al., 2023).

Additionally, proteomics and quantitative real-time PCR (qPCR) analyses identified that quercetin affects the transcript and protein expression of genes related to steroid hormone synthesis: STAR, CYP11A1, AR, CYP17A1, HSD17B1, HSD17B3. CYP11A1 is an important prerequisite for testosterone synthesis (Liu et al., 2024), the upregulation of CYP11A1 will promote the conversion of cholesterol into testosterone (Dong et al., 2025). It is reported that CYP11A1 gene mainly regulates sperm production and androgen synthesis during the development of the testes and epididymis (Wang et al., 2023). CYP17A1 is a key enzyme that promotes the synthesis of testosterone in the testicles (Baraka et al., 2024). Upregulating its expression or translational efficiency significantly increases testosterone levels and maintains normal spermatogenesis (Yang et al., 2025b). STAR, HSD17B3 and HSD17B1 also were reported to be involved in testicular steroid synthesis to ensure spermatogenesis and male fertility (Hakkarainen et al., 2018; Yang et al., 2021; Lawrence et al., 2025). The expression level of the STAR gene determines the efficiency of testosterone synthesis. In the interstitial cells of the testis, LH induces the upregulation of the STAR gene expression, accelerating the transport of cholesterol and thereby promoting the large-scale synthesis of testosterone (Lin et al., 1998; Zhang et al., 2000). The core functions of HSD17B3 and HSD17B1 are to catalyze the key final step in testosterone synthesis, converting the androgen precursor androstenedione into testosterone (He et al., 2016; Lawrence et al., 2025). AR is the downstream receptor of testosterone, mediating the regulatory effects of the hormone on the differentiation and maturation of spermatogenic cells (Cao et al., 2021). Up-regulation of AR can enhance the development of spermatogenic cells and reduce apoptosis (Kamińska et al., 2024). This is consistent with the results obtained by Shah et al. in their experiments on mice (Shah et al., 2023).

Network pharmacology is a new discipline based on systems biology theory, biological system network analysis, and multi-target drug molecule design specific signal node selection, it provides a new methodological perspective for understanding traditional medicine from a holistic perspective (Zhang et al., 2023; Zhao et al., 2023). Using network pharmacology, we predicted the target genes of quercetin and performed an integrative analysis with predicted target genes of spermatogenesis and male infertility, there were 225 quercetin target genes that are implicated in spermatogenesis and male infertility. Subsequent functional enrichment analysis revealed that these 225 genes are primarily enriched in the steroid hormone biosynthesis pathway, including key genes such as CYP1A1 and CYP1A2. These findings suggest that quercetin may exert its effects by targeting these genes to promote steroid hormone synthesis. To further verified this hypothesis, molecular docking was employed to analyze the binding site between quercetin and steroid hormone synthesis-related proteins. Molecular docking and molecular dynamics (MD) simulation are core computational biology techniques for deciphering the interaction mechanisms between compounds and proteins (Li et al., 2024a; Lu et al., 2024). The result revealed that quercetin exhibits strong binding affinity to hormone synthesis-related proteins such as HSD17B3 and CYP11A1. Furthermore, molecular dynamics simulation validated the excellent dynamic binding stability between quercetin and CYP11A1 at the atomic level, suggested that quercetin may acts as a ligand, forming a stable complex with the CYP11A1 protein and thereby increasing the structural stability and rigidity of the protein. These findings collectively indicate that quercetin holds great potential for regulating the functions of hormone-related genes and proteins. Therefore, it can be preliminarily inferred that quercetin can regulate the spermatogenesis by upregulating the Steroid hormone biosynthesis.

The metabolomics, proteomics, network pharmacology, molecular dynamics simulation results indicated that quercetin could enhance the reproductive performance of roosters through promote the steroid synthesis, and then improving spermatogenesis and semen quality. These findings provide new insights and theoretical basis for the application of quercetin in improving the reproductive performance of roosters.

CRediT authorship contribution statement

Lang Zhang: Writing – original draft, Investigation, Formal analysis. Zhenlin Chen: Investigation, Formal analysis. Maosen Yang: Investigation. Haodong Sun: Data curation. Meiyu Lan: Supervision, Investigation. Lintian Yu: Supervision. Haichuan Tan: Resources. Huiyan Xu: Supervision. Xingting Liu: Supervision, Resources. Mingxia Ran: Writing – review & editing, Funding acquisition. Yangqing Lu: Supervision, Funding acquisition, Conceptualization.

Disclosures

The authors declare the following financial interests/personal relationships which may be considered as potential competing interests:

Yangqing Lu reports financial support was provided by Guangxi University. Yangqing Lu reports a relationship with Guangxi University that includes: employment. If there are other authors, they declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Appendix. Supplementary materials

Supplementary 1: Video of sperm in the Control group showing density and motility