Skip to main content
Poultry Science logoLink to Poultry Science
. 2026 Feb 3;105(4):106589. doi: 10.1016/j.psj.2026.106589

Frizzled-4 promotes bone formation in chickens via activation of the canonical Wnt signaling pathway

Xinxin Liu a,, Yaping Guo b,, Enyou Zhou a, Zhiyuan An a, Wei Li a, Peng Cui a, Weiwei Jin a, Yujie Guo a, Yanhua Zhang a, Guoxi Li a, Weihua Tian a, Zhuanjian Li a, Xiangtao Kang a, Ruili Han a,
PMCID: PMC12907233  PMID: 41655376

Abstract

Frizzled 4 (FZD4), a member of the frizzled family, is involved in various cancers and neurological disorders because of its abnormal expression. However, its regulatory role in skeletal development and bone formation, especially in livestock and poultry, remains poorly characterized. RNA sequencing (RNA-seq) analysis of bone tissue samples collected during physiological bone remodeling in chickens identified FZD4 as a differentially expressed gene. To investigate the function of FZD4 in the osteogenic differentiation of chicken bone marrow mesenchymal stem cells (BMSCs), we assessed the expression of osteogenic marker genes and canonical Wnt signaling pathway factors at the mRNA and protein levels. Additionally, we evaluated differentiation and mineralization potential via alkaline phosphatase (ALP) and alizarin red S (ARS) staining. The results demonstrated that FZD4 expression was significantly upregulated during early differentiation. Furthermore, FZD4 overexpression increased the expression of early osteogenic markers, whereas FZD4 knockdown suppressed this expression. Although FZD4 acts as a receptor for the canonical Wnt pathway, its role in promoting osteogenesis in chickens through this pathway remains unclear. Importantly, FZD4 overexpression upregulated key canonical Wnt signaling factors at both the mRNA and protein levels, whereas FZD4 knockdown had the opposite effect. These findings indicate that FZD4 participates in chicken bone formation by regulating osteogenic marker expression, likely through activation of the canonical Wnt signaling pathway. This study elucidates the specific regulatory role of FZD4 in avian skeletal development, providing novel insights and theoretical support for understanding bone development and skeletal health in poultry and livestock.

Keywords: Chicken, FZD4, BMSCs, Canonical Wnt pathway, Bone formation

Graphical abstract

Image, graphical abstract

Introduction

Chickens (Gallus gallus) serve not only as important agricultural livestock but also as classic models for studying skeletal biology and development. In intensive poultry production, skeletal health issues—such as osteoporosis, tibial chondrodysplasia, and fractures—have become key limiting factors affecting animal welfare and production efficiency (Kölln, et al., 2025; Zhang, et al., 2024b). Skeletal homeostasis and strength are highly dependent on the dynamic equilibrium between ongoing bone formation and resorption (Dong, et al., 2023). Under physiological conditions, this equilibrium ensures proper bone metabolism and tissue homeostasis (Krasnova and Neganova, 2023). However, disruption of this balance can lead to developmental abnormalities, impairing growth performance and productive traits(Alfonso-Carrillo, et al., 2021; Huang, et al., 2021; Zhang, et al., 2024a). In this equilibrium process, BMSCs (bone marrow mesenchymal stem cells), as adult stem cells, are widely utilized in various studies because of their self-renewal ability and multipotent differentiation potential. The osteogenic differentiation model of BMSCs holds significant potential for elucidating the mechanisms underlying skeletal health and bone development (Wang, et al., 2022; Wang, et al., 2025).

Among the molecular networks regulating osteogenic-resorption balance and BMSC osteogenic differentiation, FZD family receptors serve as pivotal mediators, with FZD4 playing a particularly prominent role - function in mammalian skeletal homeostasis has been confirmed by multiple studies(Fowler, et al., 2021; Gu, et al., 2018; Zhang, et al., 2021). As a major member of the FZD family, FZD4 has been extensively documented as a critical regulator of skeletal biology. Genetic studies indicate that FZD4 is essential for maintaining normal bone mass acquisition and that its function cannot be fully compensated for by other FZD receptors (e.g., FZD8) (Kushwaha, et al., 2020). FZD4 mediates the osteogenic response of BMSCs to mechanical stimuli (Gu, et al., 2018) and serves as a key target regulating stem cell senescence and osteogenic differentiation potential within the mesenchymal tissue system (Fan, et al., 2018; Gao, et al., 2022; Wang, et al., 2021). Additionally, other FZD family members (e.g., FZD9 and FZD3/6) have been reported to play roles in skeletal development. Wang et al. reported that FZD9 regulates bone mass changes in response to mouse fractures (Wang, et al., 2016), whereas Rolfe et al. first detected FZD3/6 expression at joints, suggesting its involvement in Wnt-mediated joint development (Rolfe, et al., 2018). The role of FZD4 in mammalian bone homeostasis and Wnt signaling has been well established. However, its specific function in avian bone formation, particularly in chickens, and its involvement in regulating osteogenic differentiation and mineralization of chicken BMSCs via the canonical Wnt pathway remain unclear. Based on prior RNA-seq findings—which showed that FZD4 is differentially expressed during chicken bone remodeling and is enriched in the canonical Wnt pathway—this study aims to address this gap.

As a key member of the Frizzled receptor subfamily within the G protein-coupled receptor superfamily, the FZD4 protein primarily resides on the cell membrane. It participates in the network regulation of multiple signaling pathways by binding to Wnt receptors (Arthofer, et al., 2016; Bhanot, et al., 1996; Qian, et al., 2024; Yang, et al., 2018). It primarily regulates both the canonical pathway and the noncanonical pathway (Arthofer, et al., 2016; Bian, et al., 2024; Du, et al., 2020). As a highly conserved signaling pathway, the canonical Wnt signaling pathway, also known as the Wnt/β-catenin pathway, plays a crucial role in osteogenic differentiation (Abuna, et al., 2019; Long, et al., 2017). Research by Ji et al. suggested that FZD4 function depends on posttranslational modifications (such as N-glycosylation), which can influence cellular functions by regulating its interaction with the Wnt/β-catenin pathway (Ji, et al., 2025)—although focused on non-small cell lung cancer, this study also suggested cell type specificity in FZD4-Wnt pathway interactions, further highlighting the need to clarify the specific regulatory mechanisms of FZD4 in the Wnt pathway in avian osteoblasts. Research indicates that FZD4 mediates Wnt signaling to regulate the differentiation and function of osteoblasts and osteoclasts (Day and Yang, 2008; Gao, et al., 2023). Extensive evidence indicates that FZD4, a key receptor in the Wnt pathway, can be directly targeted and regulated by various miRNAs, circRNAs, and lncRNAs, thereby influencing osteogenic differentiation through the Wnt/β-catenin pathway(Gao, et al., 2022; Wang, et al., 2021; Zhang, et al., 2021).

On the basis of these studies and our preliminary findings, this study further investigated its specific regulatory role in chicken BMSC osteogenesis and whether it participates in avian bone formation through the canonical Wnt signaling pathway. These findings provide new insights into poultry bone health and overall skeletal development.

Materials and methods

Ethics statement

All procedures involving chicken embryos were approved by the Institutional Animal Care and Use Committee (IACUC) and strictly adhered to the guidelines for the care and use of laboratory animals established by the College of Animal Science and Technology, Henan Agricultural University. Fertilized chicken embryos were obtained from a chicken farm in Henan Province. On the 18th day of embryonic period (E18), the embryos were euthanized with 0.2% pentobarbital (40mg/kg) via the humane method, and tissue samples were collected. All procedures were performed with minimal discomfort to the animals.

Isolation, culture and induced differentiation of BMSCs

BMSCs were isolated from the femurs and tibias of 18-day-old chicken embryos. In brief, the femoral and tibial bones of the legs were isolated in a sterile environment, and the surrounding tissues were removed. Then, the bone marrow was rinsed thoroughly with a 1-ml syringe until the bone was white. Then, the bone marrow was collected through 100- and 200-mesh screens and centrifuged at 1000 rpm for 5 min. Cells were cultured in MEM-ALPHA supplemented with 10% fetal bovine serum (FBS), 1% penicillin–streptomycin, and maintained at 37°C in a humidified atmosphere containing 5% CO₂. After 24 hours, the medium was exchanged to remove nonadherent cells, and further single fluid exchange was performed 2 days later. Upon reaching 80% confluence, the cells were incubated with osteogenic medium (Add 10 mM β-glycerophosphate sodium, 50 μg/mL ascorbic acid and 100 nM dexamethasone to the above cell culture medium to prepare the osteogenic induction solution).

Immunofluorescence staining

The cells were fixed with 4% paraformaldehyde for 20 minutes, permeabilized with 0.1% Triton X-100 for 15 minutes, and blocked with 5% BSA for 1 hour at RT. Then, CD29 (1:200, BD Bioscience, America) and CD45 (1:200, Proteintech, China) antibodies were incubated with the samples overnight at 4°C. Next, the membranes were incubated with secondary antibody (1:200, Absin, China; 1:200, Proteintech, China) in the dark for 1 h at RT. After the cells were incubated with DAPI (10 μg/ml, Solarbio, Beijing), they were incubated in the dark for 5 minutes. Finally, images were captured via an inverted fluorescence microscope (Nikon TS, Tokyo, Japan).

Alkaline phosphatase (ALP) staining

P3 generation cells were cultured until they reached 70% confluence to prepare for transfection. After 6 hours of transfection, the medium was replaced with osteogenic differentiation medium. The samples were subsequently incubated according to the instructions of the NBT/BCIP staining kit (Beyotime, Shanghai, China). Finally, the sections were observed under an ordinary light microscope (Olympus, Hamburg, Germany) and photographed.

Alizarin red S (ARS) staining

Nodule mineralization was carried out at the 14-day mark of the culture period. Briefly, the cells were fixed with 4% paraformaldehyde for 15 minutes and then stained with 0.1% Alizarin red (Beyotime, Shanghai, China) at RT for 30 minutes. The samples were thoroughly rinsed with distilled water and photographed to record and analyze the observed phenomena.

Cell transfection

The siRNA oligonucleotides used for FZD4 knockdown (si-FZD4), negative control (si-NC), FZD4-overexpressing and control groups were synthesized by Beijing Tsingke Biotech Co., Ltd. (Beijing, China). A non-targeting siRNA (si-NC) was used as a negative control in all knockdown experiments. The corresponding gene sequences are shown in Table 1. Passage 3 (P3) generation cells were seeded into 6-well plates. The overexpression group and the knockdown group were transfected with Lip3000 transfection reagent (Invitrogen, Carlsbad, CA, USA). The cells were collected at 24 hours, 3 days, and 7 days after transfection for qPCR to evaluate the expression levels of target genes and genes related to osteogenic differentiation.

Table 1.

si-FZD4 sequence.

si-FZD4 (5′-3′)
sense GCUUUAAAGUGCCACAAUATT
antisense UAUUGUGGCACUUUAAAGCTT

RNA extraction and quantitative reverse transcription PCR (qRT-PCR)

Total RNA was extracted from cells via TRIzol reagent (Vazyme, Nanjing, China), and the total RNA was reverse-transcribed into cDNA via HiScript II Q RT SuperMix for qRT-PCR (Vazyme, Nanjing, China). qRT-PCR was performed on a LightCycler® 96 qRT-PCR system (Roche, Basel, Switzerland) with ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). The expression of genes was detected via 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) with cDNA as the substrate. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the reference gene, and analysis was performed via the 2 −ΔΔCt method (Bubner and Baldwin, 2004). The primers used are listed in Table 2. The experiments were conducted with at least three technical replicates, and all the data are expressed as the means ± standard errors.

Table 2.

Gene primers used for real-time quantitative PCR.

genes Primer sequence (5’-3’) Tm (°C) bp Gene accession number
FZD4 F: CAGCTCTTATTTCCACATCGCAG 59.0 275 NM_204099.2
R: CCATCAGCCTCTCCAGTTTATCA
Col1A1 F: TACTGCAACATGGAGACGGG 60.0 153 NM_001396622.1
R: ACCGCCGTACTCAAACTGG
ALP F: GCAAGGCTTCTACTGCCAAC 58.0 100 NM_001001764.2
R: ATTCTTTCCTGCGCGTCATTG
Runx2 F: AACCCAAACTTGCCCAACCA 56.0 115 NM_204128.2
R: AGTACGGCCTCCAAACGGA
OCN F: CAGTGGAGCTGCACCATGAAG 60.0 111 NM_205387.4
R: GGCTTTAGCACTGCGAGCAT
C-myc F: TACCTGCACGACCTGGGAG 60.0 179 NM_001030952.2
R: TCTTCTTCTTGTTCTTCTTCCGAGT
CyclinD1 F: CTTGGATGCTGGAGGTCTGC 60.0 180 XM_046941491.1
R: CTGCGGTCAGAGGAATCGTT
β-catenin F: CTTGGAACGAGACAGCGGA 60.0 132 XM_046910391.1
R: GGTCCATACCCAAGGCATCC
GSK-3β F: AAACCTCTTGCTGGACCCTG 59.0 177 XM_040660411.2
R: CCCGCTGACCACACATCTAT

Western blot

BMSCs were seeded into 6-well cell culture plates, and the overexpression group and the knockdown group were transfected, followed by culture for 48 hours. The primary antibodies used were FZD4 rabbit polyclonal antibody (1:2000, bs-13217R, Bioss), Glycogen synthase kinase 3 beta (GSK-3β) rabbit polyclonal antibody (1:2000, 51065-1-AP, Proteintech), β-catenin rabbit polyclonal antibody (1:5000, 51067-2-AP, Proteintech) and GAPDH mouse monoclonal antibody (1:10000, 60004-1-Ig, Proteintech). HRP-goat anti-rabbit (1:50,000, 5220–0336, Searcare) and HRP-goat anti-mouse (1:50,000, 5220–0341, Searcare) secondary antibodies were used. In brief, total protein extracts were separated by 10% SDS-PAGE and then transferred to a PVDF membrane. After being blocked with 5% BSA, the membrane was incubated with the above antibodies at 4°C overnight. Chemiluminescence detection was performed via an enhanced chemiluminescence (ECL) kit (Thermo Fisher Scientific, Shanghai, China).

Inhibition of the canonical Wnt signaling pathway

During the entire cell culture process, including the osteogenic differentiation induction stage, the Wnt signaling pathway inhibitor XAV939 (Yeasen Biotechnology, Shanghai, China) was added at a concentration of 1 μmol/L at each medium change, while an equal volume of DMSO was added to the control group.

Statistical analysis

All the data were statistically analyzed via the t-test (two groups) and one-way ANOVA (multiple groups) in SPSS 26. The analysis results were analyzed via GraphPad Prism 8.0 (GraphPad Software, Inc., USA). P < 0.05 (*), P < 0.01 (**) was considered statistically significant.

Results

Characterization of chicken BMSCs and expression of FZD4 in the early stage of in vitro osteogenic differentiation

To confirm the identity of in vitro-isolated primary cells as chicken BMSCs and assess their osteogenic differentiation potential, we conducted morphological observations, immunofluorescence-based characterization (targeting CD29/CD45), and osteogenic induction assays (ALP staining and ARS staining). Concurrently, we detected the expression level of FZD4 during the early stage of osteogenic induction. The primary cultures of passage 0 (P0) cells contained heterogeneous cell populations, including fibroblasts, during the initial culture period. After sequential medium changes and purification by passaging, P3 cells exhibited homogeneous adherent growth with a predominantly long spindle-shaped morphology and were arranged in a characteristic vortex-like pattern (Fig. 1A). Immunofluorescence staining revealed strong positivity for the mesenchymal stem cell (MSC) surface marker CD29 and negativity for the hematopoietic cell marker CD45, which is consistent with the phenotypic characteristics of BMSCs (Fig. 1B).

Fig. 1.

Fig 1 dummy alt text

Isolation, Culture, and In Vitro Osteogenic Differentiation of Chicken BMSCs. (A) Morphological characteristics of BMSCs, (1) - (5) represent features at 0, 1, 5, 7, and 9 days post-culture, respectively. (Scale bar = 50 μm) (B) Immunofluorescence; CD29: Also known as beta-1 integrin, a positive surface marker for mesenchymal stem cells. CD45: Also known as Leukocyte Common Antigen (LCA), a hematopoietic cell marker. (C) ALP staining and ARS staining images after induced differentiation (Scale bar = 100 μm). (D-E) Relative expression of osteogenic differentiation marker gene ALP and target gene FZD4 at 0 and 3 days post-induced differentiation. n = 3. (F) Western blot analysis of FZD4 protein levels at 36 hours post-induced differentiation. (G) Gray-scale analysis of FZD4 protein bands. ImageJ software was used for band analysis. * P < 0.05, ** P < 0.01. n = 3.

For osteogenic differentiation induction (0–21 days), compared with the noninduced control group, the induced group displayed pale purple staining for ALP at 3 days post-induction and red staining for ARS at 7 days post-induction. Notably, the intensity of both ALP and ARS staining gradually increased with prolonged induction time, confirming that the isolated cells possess robust osteogenic differentiation potential (Fig. 1C). Furthermore, during the early induction phase (0 and 3 days), the expression trend of FZD4 was consistent with that of ALP (Fig. 1D-G).

FZD4 promotes the osteogenic differentiation and mineralization of chicken BMSCs

The FZD4 overexpression vector was transfected into BMSCs, followed by induction of differentiation. The mRNA levels of FZD4, Collagen Type I Alpha 1 Chain (Col1A1), Runt-related transcription factor-2 (Runx2), ALP, and Osteocalcin (OCN) were detected at 0 days and 7 days of differentiation. ALP staining and ARS staining were performed at 7 days and 14 days of induced differentiation, respectively. At 0 days and 7 days of differentiation, FZD4 expression in the pcDNA3.1-FZD4 group was extremely significantly higher than that in the control group (P < 0.01) (Fig. 2A). On day 0 (D0), the expression levels of Col1A1 and OCN in the pcDNA3.1-FZD4 group were significantly higher than those in the control group (P < 0.05) (Fig. 2B). On day 7 (D7), the expression of Col1A1 and OCN in the pcDNA3.1-FZD4 group was extremely significantly higher than that in the control group (P < 0.01), and the expression of Runx2 in the pcDNA3.1-FZD4 group was significantly higher than that in the control group (P < 0.05) (Fig. 2C). The results of ALP staining at 7 days of induced differentiation revealed that the osteogenic differentiation ability of the pcDNA3.1-FZD4 group was extremely significantly higher than that of the control group (P < 0.01) (Fig. 2D-E). The results of ARS staining after 14 days of induced differentiation revealed that the osteogenic mineralization ability of the pcDNA3.1-FZD4 group was significantly higher than that of the control group (P < 0.05) (Fig. 2F-G). Therefore, FZD4 overexpression can promote the osteogenic differentiation and mineralization of chicken BMSCs.

Fig. 2.

Fig 2 dummy alt text

Effects of FZD4 overexpression and knockdown on the osteogenic differentiation of chicken BMSCs. (A) FZD4 expression in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 3. (B-C) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP, and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (D-E) ALP staining and grayscale analysis at 7 days post-induction. n = 4. (F-G) ARS staining and grayscale analysis at 14 days post-induction. Grayscale analysis was performed using ImageJ software. n = 4. (H) FZD4 expression in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 3. (I-J) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP, and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (K-L) ALP staining and grayscale analysis at 7 days post-induction (Scale bar = 100 μm). n = 4. (M-N) ARS staining and grayscale analysis at 14 days post-induction (Scale bar = 100 μm). n = 4.

We then transfected the FZD4 knockdown fragment into BMSCs and induced their differentiation. The mRNA levels of FZD4, Col1A1, Runx2, ALP, and OCN were detected at 0 days and 7 days of differentiation. ALP staining and ARS staining were performed at 7 days and 14 days of induced differentiation, respectively. At 0 days and 7 days of differentiation, the expression of FZD4 in the knockdown group was significantly lower than that in the control group (P < 0.05) (Fig. 2H). On day 0 (D0), the expression levels of Col1A1, Runx2, and OCN in the knockdown group were significantly lower than those in the control group (P < 0.05) (Fig. 2I). On day 7 (D7), the expression levels of Runx2 and OCN in the knockdown group were extremely significantly lower than those in the control group (P < 0.01) (Fig. 2J). The ALP staining results at 7 days of induced differentiation revealed that the osteogenic differentiation ability of the cells in the knockdown group was significantly lower than that of the control group (P < 0.05) (Fig. 2K-L). The ARS staining results at 14 days of induced differentiation revealed that there was no significant difference in osteogenic mineralization ability between the knockdown group and the control group (P > 0.05) (Fig. 2M-N). Therefore, knocking down FZD4 expression can inhibit the osteogenic differentiation and mineralization of chicken BMSCs.

FZD4 activates the canonical Wnt signaling pathway

To further determine whether the effect of FZD4 expression on the osteogenic differentiation and mineralization of BMSCs is related to the canonical Wnt signaling pathway, we detected the expression levels of key factors in the canonical Wnt signaling pathway via qRT-PCR at 0 days and 7 days of induction of differentiation. Total cellular proteins were extracted at 36 hours of induction of differentiation, and the protein expression levels of FZD4, GSK-3β, and β-catenin were detected via Western blotting. At D0, the expression myelocytomatosis viral oncogene homolog (C-myc) in the pcDNA3.1-FZD4 group was extremely significantly higher than that in the control group (P < 0.01), and the expression of GSK-3β was extremely significantly lower than that in the control group (P < 0.01) (Fig. 3A). The expression of β-catenin in the knockdown group was significantly lower than that in the control group (P < 0.05) (Fig. 3F). At D7, the expression of C-myc and β-catenin in the pcDNA3.1-FZD4 group was extremely significantly higher than those in the control group (P < 0.01), and the expression of GSK-3β was extremely significantly lower than that in the control group (P < 0.01) (Fig. 3B). The expression of GSK-3β in the knockdown group was significantly higher than that in the control group (P < 0.05) (Fig. 3G).

Fig. 3.

Fig 3 dummy alt text

Effects of FZD4 overexpression and knockdown on the expression of key factors in the canonical Wnt signaling pathway. (A-B) Relative expression of signaling pathway key factors C-myc, CyclinD1, β-catenin, and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C) Western blot analysis of FZD4, GSK-3β, and β-catenin protein levels at 36 hours post-differentiation induction. (D-E) Band intensity analysis of FZD4, GSK-3β, and β-catenin proteins. n = 3. (F-G) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin, and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (H) Western blot analysis of FZD4, GSK-3β, and β-catenin protein levels at 36 hours post-differentiation induction. (I-J) Grayscale analysis of FZD4, GSK-3β, and β-catenin protein bands. Band intensity was analyzed using ImageJ software. * P < 0.05, ** P < 0.01. n = 3.

The Western blot results revealed that the total protein expression levels of FZD4 and β-catenin were extremely significantly increased in the pcDNA3.1-FZD4 group compared with the control group (P < 0.01), whereas the expression level of GSK-3β was extremely significantly decreased (P < 0.01) (Fig. 3C-E). In the knockdown group, the total protein expression levels of FZD4 and β-catenin were significantly lower than those in the control group (P < 0.05), and the protein expression level of GSK-3β was extremely significantly higher than that in the control group (P < 0.01) (Figs. 3H-J). These results indicate that the effect of FZD4 on the osteogenic differentiation and mineralization of chicken BMSCs is related to the canonical Wnt signaling pathway and that FZD4 overexpression may activate the canonical Wnt signaling pathway during differentiation.

FZD4 promotes the osteogenic differentiation and mineralization of BMSCs by activating the canonical Wnt signaling pathway

To further verify that FZD4 functions through the canonical Wnt signaling pathway, we overexpressed the FZD4 gene in cells treated with the canonical Wnt signaling pathway inhibitor XAV939, with the control group exposed to DMSO. The expression levels of osteogenic marker genes and key pathway factors were detected via qRT-PCR at 0 days and 7 days of differentiation. Western blotting was used to detect the protein expression levels of β-catenin and GSK-3β at 36 hours of differentiation, and ALP staining and ARS staining were performed at 7 days and 14 days of differentiation. At D0, the expression levels of Col1A1, Runx2, ALP, OCN, C-myc, CyclinD1, and β-catenin in the pcDNA3.1-FZD4 + XAV939 group were lower than those in the pcDNA3.1-FZD4 + DMSO group (P > 0.05), and the expression of GSK-3β in the pcDNA3.1-FZD4 + XAV939 group was significantly higher than that in the pcDNA3.1-FZD4 + DMSO group (P < 0.05) (Fig. 4A, 4C). At D7, the expression levels of Runx2, C-myc, and CyclinD1 in the pcDNA3.1-FZD4 + XAV939 group were extremely significantly lower than those in the pcDNA3.1-FZD4 + DMSO group (P < 0.01), the expression levels of ALP and β-catenin in the pcDNA3.1-FZD4 + XAV939 group were significantly lower than those in the pcDNA3.1-FZD4 + DMSO group (P < 0.05), and the expression level of GSK-3β in the pcDNA3.1-FZD4 + XAV939 group was extremely significantly higher than that in the pcDNA3.1-FZD4 + DMSO group (P < 0.01) (Fig. 4B, 4D). The Western blot results were consistent with the qRT-PCR results (Fig. 4E-G). ALP staining revealed that the osteogenic differentiation ability of the pcDNA3.1-FZD4 + XAV939 group was significantly lower than that of the control group (P < 0.05) (Fig. 4H-I). ARS staining revealed that the osteogenic mineralization ability of the pcDNA3.1-FZD4 + XAV939 group was lower than that of the control group, but the difference was not significant (P > 0.05) (Fig. 4J-K).

Fig. 4.

Fig 4 dummy alt text

Effects of overexpressing FZD4 while inhibiting the canonical Wnt signaling pathway on the osteogenic differentiation of chicken BMSCs. (A-B) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP, and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C-D) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin, and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (E-G) Western blot analysis of β-catenin and GSK-3β protein levels at 36 h post-differentiation induction. Protein band grayscale analysis was performed using ImageJ software. n = 3. (H-I) ALP staining images (Scale bar = 100 μm) and grayscale analysis at 7 days post-induction. n = 4. (J-K) ARS staining (Scale bar = 100 μm) and grayscale analysis at 14 days post-induction. * P < 0.05, ** P < 0.01. n = 4.

Similarly, we treated cells with the pathway inhibitor XAV939 while the FZD4 gene was knocked down, detected the expression of osteogenic marker genes and key pathway factors, and performed ALP staining and ARS staining. The results revealed that at D0, the expression of β-catenin in the si-FZD4 + XAV939 group was extremely significantly lower than that in the si-FZD4 + DMSO group (P < 0.01), and the expression of Runx2, ALP, C-myc, and CyclinD1 in the si-FZD4 + XAV939 group was lower than that in the si-FZD4 + DMSO group (P > 0.05) (Fig. 5A, 5C). At D7, the expression levels of Runx2, ALP, CyclinD1, and β-catenin in the si-FZD4 + XAV939 group were lower than those in the si-FZD4 + DMSO group (P > 0.05) (Fig. 5B, 5D). The Western blot results were consistent with the qRT-PCR results and reached an extremely significant level (P < 0.01) (Fig. 5E-G). ALP staining revealed that the osteogenic differentiation ability of the si-FZD4 + XAV939 group was extremely significantly lower than that of the control group (P < 0.01) (Fig. 5H-I). ARS staining revealed that the osteogenic mineralization ability of the si-FZD4 + XAV939 group was significantly lower than that of the control group (P < 0.05) (Fig. 5J-K). In conclusion, the above results indicate that FZD4 promotes the osteogenic differentiation and mineralization of chicken BMSCs by activating the canonical Wnt signaling pathway.

Fig. 5.

Fig 5 dummy alt text

Effects of knockdown FZD4 while inhibiting the canonical Wnt signaling pathway on the osteogenic differentiation of chicken BMSCs. (A-B) Relative expression of osteogenic marker genes Col1A1, Runx2, ALP, and OCN in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (C-D) Relative expression of key signaling pathway factors C-myc, CyclinD1, β-catenin, and GSK-3β in chicken BMSCs at 0 and 7 days post-osteogenic differentiation. n = 6. (E-G) Western blot analysis of β-catenin and GSK-3β protein levels at 36 h post-differentiation induction. Protein band grayscale analysis was performed using ImageJ software. n = 3. (H-I) ALP staining images (Scale bar = 100 μm) and grayscale analysis at 7 days post-induction. n = 4. (J-K) ARS staining (Scale bar = 100 μm) and grayscale analysis at 14 days post-induction. * P < 0.05, ** P < 0.01. n = 4.

Discussion

With increasing awareness of animal welfare, bone health has become a key factor in reducing pain in chickens. In the poultry industry, the occurrence of bone diseases, especially leg bone diseases, poses a direct threat to the economic benefits of the industry and affects poultry welfare. Deng et al. revealed the complex crosstalk between bones and various organs while emphasizing the potential importance of bones in the pathogenesis and treatment of diseases (Deng, et al., 2024), highlighting the importance of research related to bone development. Currently, there is a relative gap in the specific regulatory mechanism of the FZD4 gene in chicken bone development. Therefore, this study explored the function of FZD4 in the osteogenic differentiation of chicken BMSCs and its specific regulatory mechanism through in vitro experiments. We found that FZD4 expression is upregulated in the early stage of osteogenesis and that its overexpression promotes the expression of osteogenic markers and the formation of mineralized nodules, while its knockdown inhibits this process. Further experiments revealed that FZD4 regulates osteogenic differentiation by activating the canonical Wnt/β-catenin signaling pathway and that the pathway inhibitor XAV939 can reverse the osteogenic differentiation-promoting effect of FZD4.

The osteogenic differentiation of mesenchymal stem cells (MSCs) is a complex, multistage, regulated process. Alkaline phosphatase and Alizarin red staining are commonly used to evaluate the in vitro osteogenic potential of these materials. The staining results indicate that as the in vitro induction time increases, the staining color gradually intensifies, reflecting the strong in vitro osteogenic capacity of the BMSCs. BMSCs were induced to differentiate toward the osteogenic lineage, with the early stage characterized by high expression of early osteogenic markers such as ALP. The results revealed significant upregulation of the ALP gene during the early phase of in vitro osteogenic induction, with the FZD4 gene exhibiting a similar trend. This finding has been similarly reported in other studies (Gu, et al., 2018; Liu, et al., 2018). These findings suggest that FZD4 may participate in early osteogenic differentiation. Further validation revealed that in the FZD4 overexpression group, Col1A1 gene expression was significantly higher than in the control group on day 0 of in vitro induction. Runx2 gene expression was significantly higher than that of the control group on day 7, and alkaline phosphatase staining showed consistent results. Conversely, the knockdown group presented the opposite results. These findings align with our prior hypothesis. Although ALP staining was used as a qualitative indicator in this study, quantitative assessment of ALP enzymatic activity would further strengthen the evaluation of early osteogenic differentiation. As induction progresses, cells enter the matrix mineralization stage, characterized by peak expression of genes associated with hydroxyapatite deposition in the extracellular matrix, such as osteocalcin. Previous studies have suggested that OCN serves as a late marker of osteogenic differentiation (Zhang et al., 2025a; Zhou, et al., 2020). At 7 days of in vitro induction, the FZD4-overexpressing group presented significantly higher OCN expression levels than did the control group, and ARS staining also revealed significantly higher levels in the FZD4-overexpressing group. The opposite results were observed in the knockdown group. These findings indicate that FZD4 overexpression promotes matrix maturation and mineralization during this stage, suggesting that FZD4 enhances osteogenic mineralization in chicken BMSCs. The temporal expression pattern of OCN in this study may be inconsistent with that reported by others (Gao, et al., 2022; Guo, et al., 2022). However, whether OCN participates in regulating early differentiation stages and the molecular regulatory mechanisms underlying species differences require further validation through alternative approaches.

Research indicates that FZD4, a receptor in the FZD family, participates in Wnt signal transduction across multiple systems (Luo, et al., 2025; Wang, et al., 2012). The results demonstrated that at D0, the C-myc expression level in the FZD4-overexpressing group was significantly higher than that in the control group, whereas the level of GSK-3β was significantly lower. Additionally, β-catenin levels were significantly lower in the knockdown group than in the control group. At D7, the C-myc and β-catenin expression levels in the FZD4-overexpressing group were both significantly higher than those in control group, whereas the GSK-3β level was remained significantly lower than that in the control group. Conversely, the GSK-3β expression level in the knockdown group was significantly higher than that in the control group. Western blotting was used to detect the protein levels of FZD4, β-catenin and GSK-3β, and the results were consistent with the mRNA levels. These results lead us to hypothesize that FZD4 may promote the osteogenic differentiation and mineralization of BMSCs through the canonical Wnt pathway. To verify this hypothesis, we treated BMSCs with the Wnt pathway inhibitor XAV939 while FZD4 was overexpressed or knocked down in the cells. Compared with those in the control group, the expression levels of osteogenic marker genes and several key pathway genes in the pcDNA3.1-FZD4 + XAV939 group were lower, the expression level of GSK-3β was significantly increased, and the expression level of β-catenin in the si-FZD4 + XAV939 group was significantly lower than those in the control group. Compared with those in the control group, the expression levels of the osteogenic marker genes Runx2, ALP and key pathway genes C-myc, CyclinD1 and β-catenin were significantly lower, the level of GSK-3β was significantly increased, and the levels of each gene in the si-FZD4 + XAV939 group were not significantly different from those in the control group. These results indicate that the osteogenic differentiation effect of FZD4 can be inhibited by Wnt pathway inhibitors, which also indicates that FZD4 promotes the osteogenic differentiation and mineralization of BMSCs by activating the canonical Wnt pathway. This result has also been systematically confirmed in a chicken model for the first time, indicating that the FZD4 gene positively regulates the osteogenic differentiation of chicken BMSCs through the canonical Wnt pathway, which echoes relevant reports in mammals (Fan, et al., 2018; Gao, et al., 2022; Wang et al., 2021), suggesting that this mechanism is conserved among species. However, despite the apparent conservation of the FZD4-canonical Wnt/β-catenin signaling axis, species-specific regulatory differences may still exist between poultry and mammals. Differences in skeletal development patterns, growth rates, and bone metabolism between birds and mammals may lead to variations in ligand - receptor interactions, signaling intensity, or crosstalk with other osteogenic pathways. Therefore, whether FZD4-mediated Wnt signaling exhibits unique regulatory features in poultry warrants further investigation, particularly through in vivo models and more detailed mechanistic studies.

Notably, although the role of FZD4 in various cancers and neurological diseases has been extensively studied (Dai, et al., 2024; Pokrajac, et al., 2023), its function in poultry bone development remains unclear. This study not only fills this gap but also provides a new perspective for understanding poultry bone health issues. However, this study still has certain limitations. All the experiments were conducted in vitro, and failed to validate the specific role of FZD4 in skeletal development in vivo. Furthermore, although FZD4 was found to influence the expression of key factors in the Wnt pathway, its upstream regulatory mechanisms—such as non-coding RNA or transcription factor regulation—remain unexplored. Also, although the chicken genome encodes multiple FZD receptors, this study specifically focuses on FZD4. This is mainly based on RNA sequencing (RNA-seq) results showing that FZD4 is a differentially expressed gene during bone remodeling (Zhang et al., 2025b). However, the roles of other FZD homologs in chicken skeletal formation are worth further investigation in the future.

In summary, this study revealed that FZD4 promotes the osteogenic differentiation and mineralization of chicken BMSCs by activating the canonical Wnt/β-catenin signaling pathway, providing new molecular targets and a theoretical basis for poultry bone development research.

Ethics approval

The protocol of this experiment was approved by the Institutional Animal Care and Use Committee of Henan Agricultural University (license number: 18-0120).

Consent for publication

The authors are responsible for the statements provided in the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (No. 2024YFF1000100; No. 2023YFF1001100).

CRediT authorship contribution statement

Xinxin Liu: Writing – original draft, Validation. Yaping Guo: Writing – original draft, Validation. Enyou Zhou: Writing – original draft, Conceptualization. Zhiyuan An: Writing – review & editing, Investigation. Wei Li: Writing – review & editing, Data curation. Peng Cui: Writing – review & editing, Data curation. Weiwei Jin: Visualization, Formal analysis. Yujie Guo: Visualization, Formal analysis. Yanhua Zhang: Visualization, Formal analysis. Guoxi Li: Writing – review & editing, Methodology. Weihua Tian: Writing – review & editing, Methodology. Zhuanjian Li: Visualization, Conceptualization. Xiangtao Kang: Writing – review & editing, Conceptualization. Ruili Han: Writing – review & editing, Methodology, Funding acquisition.

Disclosures

The authors declare no conflict of interest.

References

  1. Abuna R.P.F., Oliveira F.S., Lopes H.B., Freitas G.P., Fernandes R.R., Rosa A.L., Beloti M.M. The wnt/β-catenin signaling pathway is regulated by titanium with nanotopography to induce osteoblast differentiation. Colloids Surf. B Biointerfaces. 2019;184 doi: 10.1016/j.colsurfb.2019.110513. [DOI] [PubMed] [Google Scholar]
  2. Alfonso-Carrillo C., Benavides-Reyes C., de Los Mozos J., Dominguez-Gasca N., Sanchez-Rodríguez E., Garcia-Ruiz A.I., Rodriguez-Navarro A.B. Relationship between bone quality, egg production and eggshell quality in laying hens at the end of an extended production cycle (105 Weeks) Animals. 2021;11 doi: 10.3390/ani11030623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arthofer E., Hot B., Petersen J., Strakova K., Jäger S., Grundmann M., Kostenis E., Gutkind J.S., Schulte G. WNT stimulation dissociates a frizzled 4 inactive-State complex with Gα12/13. Mol. Pharmacol. 2016;90:447–459. doi: 10.1124/mol.116.104919. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bhanot P., Brink M., Samos C.H., Hsieh J.C., Wang Y., Macke J.P., Andrew D., Nathans J., Nusse R. A new member of the frizzled family from Drosophila functions as a wingless receptor. Nature. 1996;382:225–230. doi: 10.1038/382225a0. [DOI] [PubMed] [Google Scholar]
  5. Bian F., Goda C., Wang G., Lan Y.W., Deng Z., Gao W., Acharya A., Reza A.A., Gomez-Arroyo J., Merjaneh N., Ren X., Goveia J., Carmeliet P., Kalinichenko V.V., Kalin T.V. FOXF1 promotes tumor vessel normalization and prevents lung cancer progression through FZD4. EMBO Mol. Med. 2024;16:1063–1090. doi: 10.1038/s44321-024-00064-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bubner B., Baldwin I.T. Use of real-time PCR for determining copy number and zygosity in transgenic plants. Plant Cell Rep. 2004;23:263–271. doi: 10.1007/s00299-004-0859-y. [DOI] [PubMed] [Google Scholar]
  7. Dai E., Liu M., Li S., Zhang X., Wang S., Zhao R., He Y., Peng L., Lv L., Xiao H., Yang M., Yang Z., Zhao P. Identification of novel FZD4 mutations in familial exudative vitreoretinopathy and investigating the pathogenic mechanisms of FZD4 mutations. Invest. Ophthalmol. Vis. Sci. 2024;65:1. doi: 10.1167/iovs.65.4.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Day T.F., Yang Y. Wnt and hedgehog signaling pathways in bone development. J. Bone Jt. Surg. Am. 2008;90(Suppl 1):19–24. doi: 10.2106/JBJS.G.01174. [DOI] [PubMed] [Google Scholar]
  9. Deng A.F., Wang F.X., Wang S.C., Zhang Y.Z., Bai L., Su J.C. Bone-organ axes: bidirectional crosstalk. Mil. Med. Res. 2024;11:37. doi: 10.1186/s40779-024-00540-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Dong Z., Yang C., Tan J., Dou C., Chen Y. Modulation of SIRT6 activity acts as an emerging therapeutic implication for pathological disorders in the skeletal system. Genes. Dis. 2023;10:864–876. doi: 10.1016/j.gendis.2021.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Du X., Li Q., Yang L., Liu L., Cao Q., Li Q. SMAD4 activates wnt signaling pathway to inhibit granulosa cell apoptosis. Cell Death. Dis. 2020;11:373. doi: 10.1038/s41419-020-2578-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Fan J., An X., Yang Y., Xu H., Fan L., Deng L., Li T., Weng X., Zhang J., Zhao R.Chunhua. MiR-1292 targets FZD4 to regulate senescence and osteogenic differentiation of stem cells in TE/SJ/Mesenchymal tissue system via the wnt/β-catenin pathway. Aging Dis. 2018;9:1103–1121. doi: 10.14336/AD.2018.1110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Fowler T.W., Mitchell T.L., Janda C.Y., Xie L., Tu S., Chen H., Zhang H., Ye J., Ouyang B., Yuan T.Z., Lee S.J., Newman M., Tripuraneni N., Rego E.S., Mutha D., Dilip A., Vuppalapaty M., Baribault H., Yeh W.C., Li Y. Development of selective bispecific Wnt mimetics for bone loss and repair. Nat. Commun. 2021;12:3247. doi: 10.1038/s41467-021-23374-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gao H., Dong H., Zheng J., Jiang X., Gong M., Hu L., He J., Wang Y. LINC01119 negatively regulates osteogenic differentiation of mesenchymal stem cells via the wnt pathway by targeting FZD4. Stem Cell Res. Ther. 2022;13:43. doi: 10.1186/s13287-022-02726-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Gao Y., Chen N., Fu Z., Zhang Q. Progress of wnt signaling pathway in osteoporosis. Biomolecules. 2023;13 doi: 10.3390/biom13030483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gu Q., Tian H., Zhang K., Chen D., Chen D., Wang X., Zhao J. Wnt5a/FZD4 Mediates the mechanical stretch-induced osteogenic differentiation of bone mesenchymal stem cells. Cell Physiol. Biochem. 2018;48:215–226. doi: 10.1159/000491721. [DOI] [PubMed] [Google Scholar]
  17. Guo P., Zhou Y., Jin Z., Zhou Y., Tan W.-s. Fluid shear stress promotes osteogenesis of bone mesenchymal stem cells at early matrix maturity phase through lamin A/METTL3 signal axis. Biochem. Eng. J. 2022;188 [Google Scholar]
  18. Huang S.C., Cao Q.Q., Cao Y.B., Yang Y.R., Xu T.T., Yue K., Liu F., Tong Z.X., Wang X.B. Morinda officinalis polysaccharides improve meat quality by reducing oxidative damage in chickens suffering from tibial dyschondroplasia. Food Chem. 2021;344 doi: 10.1016/j.foodchem.2020.128688. [DOI] [PubMed] [Google Scholar]
  19. Ji T., Li X., Li J., Wang G. N-glycosylation modification of Fzd4 is essential for the Fzd4-wnt-β-catenin signalling axis. J. Cell Mol. Med. 2025;29 doi: 10.1111/jcmm.70539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kölln M., Frahm J., Halle I., Hüther L., Kluess J., Meyer-Sievers H., Schrader L., Weigend S., Dänicke S. Vitamin D(3) is not a limiting nutrient regarding growth performance and tibia parameters in the rearing period of laying hens bred for high laying performance compared to non-selected resource populations. J. Anim. Physiol. Anim. Nutr. (Berl.) 2025;109:893–907. doi: 10.1111/jpn.14104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Krasnova O., Neganova I. Assembling the puzzle pieces. Insights for in vitro bone remodeling. Stem Cell Rev. Rep. 2023;19:1635–1658. doi: 10.1007/s12015-023-10558-6. [DOI] [PubMed] [Google Scholar]
  22. Kushwaha P., Kim S., Foxa G.E., Michalski M.N., Williams B.O., Tomlinson R.E., Riddle R.C. Frizzled-4 is required for normal bone acquisition despite compensation by Frizzled-8. J. Cell Physiol. 2020;235:6673–6683. doi: 10.1002/jcp.29563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Liu F., Wang Z., Liu F., Xu J., Liu Q., Yin K., Lan J. MicroRNA-29a-3p enhances dental implant osseointegration of hyperlipidemic rats via suppressing dishevelled 2 and frizzled 4. Cell Biosci. 2018;8:55. doi: 10.1186/s13578-018-0254-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Long H., Sun B., Cheng L., Zhao S., Zhu Y., Zhao R., Zhu J. miR-139-5p represses BMSC osteogenesis via targeting wnt/β-catenin signaling pathway. DNA Cell Biol. 2017;36:715–724. doi: 10.1089/dna.2017.3657. [DOI] [PubMed] [Google Scholar]
  25. Luo X., Zhong X., Zeng T., Li X., Yang T., Yue Q., Lan Y., Chen S., Wang Z., Zhang M., Zuo B., Wang Y., Shen Y., Lu J., Liu B., Guo H. Isovalerylspiramycin I reprograms the immunosuppressive and temozolomide-resistant microenvironment by inhibiting the frizzled-5/wnt/β-catenin pathway in glioblastoma. Res. (Wash D C) 2025;8:0828. doi: 10.34133/research.0828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pokrajac N.T., Tokarew N.J.A., Gurdita A., Ortin-Martinez A., Wallace V.A. Meningeal macrophages inhibit chemokine signaling in pre-tumor cells to suppress mouse medulloblastoma initiation. Dev. Cell. 2023;58:2015–2031. doi: 10.1016/j.devcel.2023.08.033. e2018. [DOI] [PubMed] [Google Scholar]
  27. Qian Y., Ma Z., Xu Z., Duan Y., Xiong Y., Xia R., Zhu X., Zhang Z., Tian X., Yin H., Liu J., Song J., Lu Y., Zhang A., Guo C., Jin L., Kim W.J., Ke J., Xu F., Huang Z., He Y. Structural basis of frizzled 4 in recognition of dishevelled 2 unveils mechanism of WNT signaling activation. Nat. Commun. 2024;15:7644. doi: 10.1038/s41467-024-52174-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Rolfe R.A., Shea C.A., Singh P.N.P., Bandyopadhyay A., Murphy P. Investigating the mechanistic basis of biomechanical input controlling skeletal development: exploring the interplay with wnt signalling at the joint. Philos. Trans. R. Soc. L. B Biol. Sci. 2018:373. doi: 10.1098/rstb.2017.0329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wang C., Stöckl S., Li S., Herrmann M., Lukas C., Reinders Y., Sickmann A., Grässel S. Effects of extracellular vesicles from osteogenic differentiated Human BMSCs on osteogenic and adipogenic differentiation capacity of naïve Human BMSCs. Cells. 2022;11 doi: 10.3390/cells11162491. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Wang J., Xia Y., Li J., Wang W. miR-129-5p in exosomes inhibits diabetes-associated osteogenesis in the jaw via targeting FZD4. Biochem. Biophys. Res. Commun. 2021;566:87–93. doi: 10.1016/j.bbrc.2021.05.072. [DOI] [PubMed] [Google Scholar]
  31. Wang R., Zhong Y., Du Q., Zhao C., Wang Y., Pan J. YK11 promotes osteogenic differentiation of BMSCs and repair of bone defects. J. Mol. Endocrinol. 2025;74 doi: 10.1530/JME-24-0073. [DOI] [PubMed] [Google Scholar]
  32. Wang Y., Chang H., Rattner A., Nathans J. Frizzled receptors in development and disease. Curr. Top. Dev. Biol. 2016;117:113–139. doi: 10.1016/bs.ctdb.2015.11.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Wang Y., Rattner A., Zhou Y., Williams J., Smallwood P.M., Nathans J. Norrin/Frizzled4 signaling in retinal vascular development and blood brain barrier plasticity. Cell. 2012;151:1332–1344. doi: 10.1016/j.cell.2012.10.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Yang S., Wu Y., Xu T.H., de Waal P.W., He Y., Pu M., Chen Y., DeBruine Z.J., Zhang B., Zaidi S.A., Popov P., Guo Y., Han G.W., Lu Y., Suino-Powell K., Dong S., Harikumar K.G., Miller L.J., Katritch V., Xu H.E., Shui W., Stevens R.C., Melcher K., Zhao S., Xu F. Crystal structure of the frizzled 4 receptor in a ligand-free state. Nature. 2018;560:666–670. doi: 10.1038/s41586-018-0447-x. [DOI] [PubMed] [Google Scholar]
  35. Zhang X., Jiang W., Wu X., Xie C., Zhang Y., Li L., Gu Y., Hu Z., Zhai X., Liang R., Zhang T., Sun W., Ye J., Wei W., Wang X., Hong Y., Zhang S., Cai Y., Zou X., Hu Y., Ouyang H. Divide-and-conquer strategy with engineered ossification center organoids for rapid bone healing through developmental cell recruitment. Nat. Commun. 2025;16:6200. doi: 10.1038/s41467-025-61619-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Zhang H., Wang Y., Wang Y., Wei B., Wang L., Nguyen M.T., Lv X., Huang Y., Chen W. Fermented calcium butyrate supplementation in post-peak laying hens improved ovarian function and tibia quality through the "gut-bone" axis. Anim. Nutr. 2024;16:350–362. doi: 10.1016/j.aninu.2023.10.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Zhang L., An Z., Li W., Liu X., Zhou E., Cui P., Zhang Y., Guo Y., Li G., Li Z., Tian Y., Huang S., Jiang R., Kang X., Han R. Effect of induced molting on bone remodeling in laying hens. BMC Genom. 2025;26(1):1128. doi: 10.1186/s12864-025-12335-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Zhang M., Du P., Wan J., Chen Y., Chen X., Zhang Y. Effects of sodium dehydroacetate on broiler chicken bones. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhang Z., Zhou H., Sun F., Han J., Han Y. Circ_FBLN1 promotes the proliferation and osteogenic differentiation of human bone marrow-derived mesenchymal stem cells by regulating let-7i-5p/FZD4 axis and wnt/β-catenin pathway. J. Bioenerg. Biomembr. 2021;53:561–572. doi: 10.1007/s10863-021-09917-0. [DOI] [PubMed] [Google Scholar]
  40. Zhou J.G., Hua Y., Liu S.W., Hu W.Q., Qian R., Xiong L. MicroRNA-1286 inhibits osteogenic differentiation of mesenchymal stem cells to promote the progression of osteoporosis via regulating FZD4 expression. Eur. Rev. Med. Pharmacol. Sci. 2020;24:1–10. doi: 10.26355/eurrev_202001_19889. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES