Skip to main content
Poultry Science logoLink to Poultry Science
. 2026 Feb 2;105(4):106578. doi: 10.1016/j.psj.2026.106578

Jejunum FABP6 expression and potential mechanism response to Salmonella Pullorum inoculation revealed by proteomic profiling and RT-PCR in Chinese Taihe black-bone silky fowls

Mengjun Ye a,b,c, Li Zhang a,b,c, Lijuan Yuan a,b,c, Jianjun Xiang a,b,c, Qiegen Liao a,b,c, Wei Long d, Yifan Dong a,b,c, Xiren Yu a,b,c, Qiushuang Ai a,b,c, Suyan Qiu a,b,c, Dawen Zhang a,b,c,⁎
PMCID: PMC12907712  PMID: 41653628

Abstract

Salmonella Pullorum (S. Pullorum) incurs high mortality in chicks and disrupts intestinal health, and poses a severe threat to poultry industry and human health. However, in Chinese Taihe Black-Bone Silky Fowls (TBSF), the jejunum biomarker and molecular mechanism responding to S. Pullorum inoculation remain elusive. This study aims to characterize the jejunum proteome changes of TBSF affected by S. Pullorum. Using a data-independent acquisition (DIA) proteomics method, jejunum samples were collected from chicks and analyzed. These samples corresponded to the following treatment groups: the blank control group (TBSF with PBS treatment), and groups challenged with Salmonella Pullorum at doses of 1.39 × 10⁸ CFU/mL (L), 2.78 × 10⁸ CFU/mL (M), and 5.56 × 10⁸ CFU/mL (H). Meanwhile, the LD group (challenged with 1.39 × 108 CFU/mL S. Pullorum and administered 0.1g/kg bw 20% florfenicol powder) was used as experimental validation. A total of 8977 proteins were identified. Compared with the blank group, the numbers of differentially abundant proteins were 976 in the L group, 536 in the LD group, 635 in the M group, 673 in the H group, respectively. KEGG analysis showed that proteins affected by S. Pullorum were mainly associated with the signal transduction and infectious disease. EggNOG annotation of proteins showed that regulated proteins were significantly involved in intracellular trafficking, secretion, and vesicular transport, as well as post-translational modification, protein turnover, and chaperones. The results indicate that the alterations in jejunal protein profiles following S. Pullorum challenge are primarily driven by the host's active defense mechanisms against infection. Notably, the protein abundance of FABP6 and ACE2 was significantly higher in the Blank control group compared to all infected groups. This differential expression was further corroborated by RT-PCR analysis, which showed a corresponding increase in FABP6 mRNA levels in the Blank group, confirming FABP6 as a host gene responsive to S. Pullorum. Collectively, this study proposes potential protein biomarkers for the diagnosis of S. Pullorum infection, identifies promising targets for therapeutic development, and provides enhanced mechanistic insight into host-pathogen interactions. that changes of jejunum proteins in response to S. Pullorum are driven by the host’s intensified efforts to counteract the infection. The protein abundance of FABP6 and ACE2 was significantly higher in the blank group than in the S. Pullorum-challenged groups. This observation was further validated at the transcriptional level, as RT-PCR analysis confirmed that FABP6 mRNA expression was also elevated in the blank group. These consistent results establish FABP6 as a host gene responsive to S. Pullorum infection. Consequently, this study not only identifies potential protein biomarkers for diagnosing S. Pullorum infection but also proposes novel targets for therapeutic development, thereby enhancing our understanding of the underlying host-pathogen interactions.

Keywords: FABP6, Salmonella Pullorum, Proteomic profiling, Chinese Taihe black-bone silky fowls

Graphical abstract

Image, graphical abstract

Introduction

Salmonella enterica infects a broad range of animals and humans. A limited number of its serovars cause typhoid-like infections, a key characteristic of which is the establishment of persistent infection in convalescent hosts (Tang et al., 2018). In contrast, Salmonella Pullorum, a biotype of S. enterica, exhibits strict host specificity for poultry and aquatic birds and is not typically pathogenic to mammalian hosts (Wilson et al., 2000). Salmonella pullorum (S. Pullorum) is one of the most common Gram-negative pathogens, and mainly infects chicks and causes pullorum disease (Wang et al., 2021). Infected fowls may show different symptoms, such as anorexia, depression and diarrhea. S. Pullorum can be transmitted through seed eggs to the progeny(Liu et al., 2022). Two to three-week-old chicks suffer from high morbidity and mortality, and lead to considerable economic losses in the poultry industry(Spalding, 2009). Except that, the global emergence of antimicrobial-resistant (AMR) Salmonella strains, including S. Pullorum, constitutes a significant public health threat. This concern is underscored by data from South Asia, where the overall prevalence of AMR in Salmonella isolates reportedly increased from 53% to 77% over a decade. Specifically, S. Pullorum demonstrated a high prevalence (13.50%; 95% CI: 5.64–29.93), with an alarming AMR rate of 90.06% (Talukder et al., 2023). Therefore, it is necessary to conduct research on the molecular mechanisms of Salmonella pullorum, with the aim of identifying new therapeutic targets and developing more targeted treatment strategies, thereby reducing antibiotic use and ensuring the quality and safety of broiler products.

Nutrient absorption in chickens is primarily localized to the duodenum, jejunum, and ileum, with the jejunum constituting a critical component of the intestinal barrier. (Rodrigues and Choct, 2018). S. pullorum infection caused damage to the jejunum mucosal structure and affected the metabolism and absorption of nutrients (Yang et al., 2022). Consequently, studying the response of proteome jejunum to S. Pullorum infection has an important significance for exploring new disease-resistant targets for chicken (Liu et al., 2015).

As a geographical indication fowl of Jiangxi province, Chinese Taihe Black-Bone Silky Fowl (TBSF) is famous for its melanin and nutritional value (Ye et al., 2025; Zhang et al., 2025). Compared to other breeds of broiler chickens, the TBSF have a significant advantage in economic value, such as the selling price of TBSF is ten times that of ordinary white-feathered broilers (Xiang et al., 2022). The morbidity and mortality associated with S. Pullorum result in substantial economic losses for the TBSF industry (Zhang et al., 2025). However, there are currently no effective vaccines for S. Pullorum available and antibacterial therapy for infected fowls often becomes the common option (Schat et al., 2021). Usually, florfenicol is the main choice for controlling S. pullorum in broilers (Pokrant et al., 2018). It is a broad-spectrum antibiotic against both Gram-negative and Gram-positive bacteria(Ismail and El-Kattan, 2009; Li et al., 2022). According to the Quality of Veterinary Medicines (the Ministry of Agriculture and Rural Affairs of China), 20% florfenicol powder concentration in drinking water of chicken is 0.1∼0.15 g/kg body weight per day for 3∼5 consecutive days, twice a day. Nonetheless, when Salmonella Pullorum infected fowls, research on florfenicol-induced proteome change and its effects on jejunum homeostasis and functions in chickens remain very limited (Yu et al., 2025).

The primary goal of this study is to detect the protein constituents of the jejunum of 21-day-old TBSF at five different groups (Blank, 1.39 × 108 CFU/mL, 2.78 × 108 CFU/mL, 5.56 × 108 CFU/mL S. Pullorum inoculation, and 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder) using proteomic analysis. Given that low-dose Salmonella pullorum infection is more consistent with the actual infection status of chicks on farms, and farmers typically administer therapeutic agents such as florfenicol for treatment, these groups were thus established. The bacteria were administered orally by gavage once, and florfenicol was given by drinking water for 3 days at the age of 14 days. The hypothesis is that concentration-dependent changes in the proteomic, gene expression and changes in proteomic biomarkers will be observed. For this objective, a bioinformatics approach was used to identify the functionalities of specific proteins. This study provides a theoretical basis for exploring new molecular targets that enable TBSF and other broiler chickens to resist invasion by Salmonella pullorum.

Materials and methods

Bacterial strains and growth conditions

The bacterial strains (S. Pullorum, CVCC1789) used in this study was obtained from the College of Animal Science, Xinjiang Agricultural University. The Salmonella Pullorum was grown at 37°C in Luria broth (LB), and adjusted to concentrations of 1.39 × 108, 2.78 × 108, 5.56 × 108 colony forming units (CFU/mL) with sterile PBS for oral administration.

Animals and sample collection

Animals. Three hundred 7-day-old Chinese Taihe black-bone silky fowls (150 females and 150 males, 0.09 ± 0.01 kg) were supplied by the Jiangxi Wang Beitu Co., Ltd, and were vaccinated against Marek's disease and confirmed without Salmonella or other pathogenic infections. After a 7-day pre-feeding period, the birds were randomly assigned into the blank (oral administered PBS) group, Low-concentration Salmonella Pullorum inoculation (1.39 × 108 CFU/mL) group (L), Medium-concentration Salmonella Pullorum (2.78 × 108 CFU/mL) inoculation group (M), or High-concentration Salmonella Pullorum (5.56 × 108 CFU/ mL) inoculation group (H), and were orally administered the corresponding substance once (Ding, et al., 2025). Meanwhile, 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder for 3 days (LD) group was used as experimental validation. Six replicates per group, with 10 individuals in each replicate, of 14-day-old, Chinese Taihe black-bone silky fowls, were raised under uniform indoor conditions (with a 9 h light and 15 h dark cycle, temperature was 25±5 °C, humidity was 50%-60%), commercial feed were provided ad libitum. During the experiment, the state of the animals was observed and their body weights were recorded.

Tissue collection. At the age of 21 days, randomly select two birds from each replication for each group (12 individuals for each group), the birds were euthanised by cervical dislocation and jejunum tissues from Taihe black-boned silky fowls was harvested following the infection. The jejunal segments at the same position from each chicken were taken and immediately put into 4% Paraformaldehyde fixing solution for more than 24 hours, stored and transported at room temperature. These were used for the preparation of paraffin sections and immunohistochemistry. The remaining jejunum tissues from each group were kept in liquid nitrogen and later, shipped to Laboratory of Institute of Quality & Safety and Standards of Agricultural Products Research, Jiangxi Academy of Agricultural Sciences (Ye et al., 2022).

Paraffin section making and HE staining experiment

The jejunum tissue sections were prepared by pathological tissue sampling and fixation, embedding and paraffin section. The paraffin sections were immersed in sequence in environmental friendly dewaxing transparent liquid I for 20 min - environmental friendly dewaxing transparent liquid II for 20 min - Anhydrous ethanol I for 5 min - Anhydrous ethanol II for 5 min - 75% Ethyl alcohol for 5 min, and then rinsed with tap water. The frozen sections were removed from the -20°C refrigerator and restored to room temperature, fixed with tissue fixating solution for 15 min, and then rinsed with running water. The sections were treated with HD constant staining pretreatment solution for 1 min. Sections were put into Hematoxylin solution for 3-5 min, and rinsed with tap water. Then sections were treated with Hematoxylin Differentiation solution, and rinsed with tap water. Next, sections were treated with Hematoxylin Bluing solution, and rinsed with tap water. Sections were placed in 95% ethanol for 1 min, Eosin dye for 15 s. After that, sections were put into absolute ethanol I for 2 min-absolute ethanol II for 2 min-absolute ethanol III for 2 min-normal butanol I for 2 min - normal butanol II for 2 min -xylene Ⅰ for 2 min-xylene Ⅱ for 2 min, sealing with neutral gum. Microscope inspection, image acquisition and analysis.

Proteome detection

A total of 20 jejunum samples (four groups were randomly selected from the six replicate groups of each treatment group, and one individual was randomly chosen from each selected group) were collected for data-independent acquisition (DIA) proteome sequencing. Scanning was carried out in data-independent acquisition mode using the Orbitrap Astral high-resolution mass spectrometer. Total protein was extracted from jejunum tissues using a protein lysis buffer. After centrifugation, the supernatants were collected and protein concentration was determined using the BCA method, and SDS-PAGE electrophoresis was carried out. Jejunal proteins were treated with Triethylammonium bicarbonate buffer and digested with trypsin overnight. Peptides were desalted and quantified using a Peptide Quantification Kit (Thermo, USA). Peptides were desalted and quantified, followed by analysis using mass spectrometry for identification. The established spectral library was imported into Spectronaut software 14.0 for protein identification, and product ion peaks were extracted from the DIA raw data. Bioinformatic analysis was performed using the Majorbio Cloud platform, with statistical tests for identifying differentially expressed proteins (DEPs). Recorded spectra were searched against the Gallus gallus proteins present in the UniProt database. The P-value and fold change (FC) of the differences between groups were calculated by two-tailed student's T test. A fold change > 1.5 or < 0.67 and a P-value < 0.05 was set for identifying DEPs. Functional annotation and pathway analysis were performed using GO, Kyoto Encyclopedia of Genes and Genomes (KEGG), GESA in the Majorbio Cloud platform (cloud.majorbio.com) (Li et al., 2024).

Real-time PCR verification

Total RNA was isolated from jejunum samples (12 samples per group, two individuals were randomly selected from the six replicate groups of each treatment group) using Trizol (Invitrogen, Thermo Fisher Scientific, CA, USA). Five hundred nanogram of total RNA,and 5 × PrimeScript RT Master Mix (Takara Bio Inc. Beijing, China) were used to synthesize cDNA according to the manufacturers' instructions. The relative mRNA levels of fatty acid-binding protein 6 (FABP6), Peroxisome Proliferator - Activated Receptor Alpha (PPARα), Angiotensin - converting enzyme 2 (ACE2) were measured by quantitative PCR using TB Green® Premix Ex Taq, the Applied Biosystems QuantStudio 3 Real-Time PCR System, and primers in Table 1. Results were expressed as the level relative to the corresponding housekeeping gene GAPDH. All primers were verified for the efficiency and linearity of amplification (Chen et al., 2015).

Table 1.

List of primers used for RT–PCR.

Genes Forward primer Reverse primer Fragment size (bp)
GAPDH CCCCCATGTTTGTGATGGGT GCACGATGCATTGCTGACAA 74
FABP6 GCAGGTGGAGGGAAAAGAGG CTGTGAGCACGCCTGGG 133
PPARα GTGTGGCTGCTGCTTAGAGA TCCAGGCTGAGACACTAGGA 107
ACE2 GGGGAAGAATGACTACAGGATCA TTTCGCAACAGGAAAGGCTG 129

Statistical analysis

The data are expressed as the mean value ± standard deviation, and statistical analysis was carried out by using the unpaired Student's t-tests or one-way analysis of variance (ANOVA) based on the GraphPad Prism software 8 (GraphPad Software Inc., La Jolla, CA, USA). Statistical significance was defined at a threshold of P < 0.05 (Hou et al., 2024). Pearson's correlation coefficient was used to examine whether differentially expressed genes are associated (Tripathi et al., 2022).

Ethics statement

These studies were approved by Experimental Animal Ethics Committee of the Jiangxi Academy of Agricultural Sciences and conformed to standards set forth by the Ministry of Agriculture of China.

Results

Growth performance and morphological changes of the jejunum

To investigate the ability of S. Pullorum in infecting TBSF, we initially determined their Body weight changes and observed the HE staining jejunum tissue sections. Before and after S. Pullorum inoculation, mearsurement of body weight showed there was no significantly difference between these groups (Fig. 1). On the other hand, investigation of morphological changes detected higher jejunum crypt depth in the blank group than in the LD, M and H group, but the level of crypt depth was not significantly different between the blank and L group (Fig. 2). The results revealed an association of S. Pullorum infection with jejunum injury of TBSF.

Fig. 1.

Fig. 1 dummy alt text

Body weight change. Columns, mean of twenty-four duplicates; bars, SEM. NS means there is no statistical significance. A, Body weight for TBSF before S. Pullorum inoculation. B, Body weight for TBSF in the 7th day after Salmonella inoculation. Blank means the blank group (oral administered PBS), L means the Low-concentration Salmonella Pullorum inoculation (1.39 × 108 CFU/mL) group, LD means the 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder for 3 days group, M means the Medium-concentration Salmonella Pullorum (2.78 × 108 CFU/mL) inoculation group, H means High-concentration Salmonella Pullorum (5.56 × 108 CFU/ mL) inoculation group.

Fig. 2.

Fig. 2 dummy alt text

Morphological changes of the jejunum. A, the Blank group; B, the L group; C, the LD group; D, the M group; E, the H group. The red box notes the jejunal crypts. F, Crypt depth of TBSF in the 7th day after S. Pullorum inoculation, Columns, mean of nine visions of the paraffin section; bars, SEM. NS means there is no statistical significance. *P < 0.05, ***P < 0.001. Blank means the blank group (oral administered PBS), L means the Low-concentration Salmonella Pullorum inoculation (1.39 × 108 CFU/mL) group, LD means the 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder for 3 days group, M means the Medium-concentration Salmonella Pullorum (2.78 × 108 CFU/mL) inoculation group, H means High-concentration Salmonella Pullorum (5.56 × 108 CFU/ mL) inoculation group.

Proteome detection

This study aims to explore jejunum proteomic changes response to Salmonella Pullorum inoculation in the TBSF. We approached this with a DIA proteomics method using three concentrations of S. Pullorum to analyze the changes occurring at the 7th day after infection, and LD group was used as experimental validation. Given that the jejunum serves as the primary site for nutrient absorption, we conducted a detailed proteomic analysis of jejunal tissues. Samples were analyzed using an Orbitrap Astral high-resolution mass spectrometer, with four biological replicates per group. This analysis identified a total of 128,851 peptides, corresponding to 8,977 distinct proteins (see Table S1). Among these, 8,699 proteins were common to all five experimental groups. The number of proteins uniquely identified in each group was as follows: one protein in the L group, one in the LD group, one in the M group, one in the H group, and two in the Blank group (Fig. 3).

Fig. 3.

Fig. 3 dummy alt text

Venn chart showing the distribution of identified proteins in the jejunum of different groups. The overlapping regions in the figure represent the number of differential proteins shared among multiple comparison groups, the non-overlapping regions indicate the number of differential proteins unique to each respective comparison group, and the numbers denote the corresponding protein counts.

To detect the diversities of jejunum proteins with S. Pullorum concentration, we collected jejunum tissues of the Blank, L, LD, M and H groups, respectively. The DIA proteomics method was used to obtain protein information. As shown in Fig. 4, the heat map and cluster analysis showed that protein expressions of the same group were similar; thus, the experiment results were stable and reliable.

Fig. 4.

Fig. 4 dummy alt text

Cluster analysis of different groups. B means the jejunum of the blank group; L means the jejunum of the L group; LD means the jejunum of the LD group; M means the jejunum of the M group; H means the jejunum of the H group.

Histogram of KEGG analyses showed 20 significantly enriched pathways, including and not limited to signal transduction (>900 proteins), infectious disease:viral (>700 proteins), infectious disease:bacterial (>600 proteins), neurodegenerative disease (>500 proteins), cardiovascular disease (>400 proteins), immune system (700 proteins), endocrine system (>500 proteins), nervous system (>250 proteins), digestive system (>250 proteins), transport and catabolism (>650 proteins), and lipid metabolism (>250 proteins) (Fig. 5).

Fig. 5.

Fig. 5 dummy alt text

Diverse proteins for KEGG functional pathway.

Compared with the jejunum of blank group, it can be seen from the volcano plots that there were 390, 258, 220 and 331 up-expressed proteins in the jejunum of L, LD, M and H group, respectively; while 586, 278, 415 and 342 down-expressed proteins in the jejunum of L, LD, M and H group, respectively. (Fig. 6). With the Salmonella Pullorum inoculation, the DEPs of jejunum also changed. The results showed, there were only 86 DEPs exist in all groups (Fig. 7, Table S1).

Fig. 6.

Fig. 6 dummy alt text

Proteins identified with differential expression in the jejunum of TBSF. A, proteins in the jejunum of the L group vs proteins in the jejunum of the Blank group; B, proteins in the jejunum of the LD group vs proteins in the jejunum of the Blank group; C, proteins in the jejunum of the M group vs proteins in the jejunum of the Blank group; D, proteins in the jejunum of the H group vs proteins in the jejunum of the Blank group. Red dots indicate significantly up-regulated proteins, and blue dots indicate significantly down-regulated proteins.

Fig. 7.

Fig. 7 dummy alt text

Venn diagram showing the distribution of identified jejunum proteins in the of different groups. L-VS-Blank refers to the number of proteins in the differential protein set between group L and the blank group; LD-VS-Blank refers to that between group LD and the blank group; M-VS-Blank refers to that between group M and the blank group; and H-VS-Blank refers to that between group H and the blank group. The overlapping regions in the figure represent the number of differential proteins shared among multiple comparison groups, the non-overlapping regions indicate the number of differential proteins unique to each respective comparison group, and the numbers denote the corresponding number of proteins.

Based on the mean expression analysis of 86 proteins, higher levels of Fatty acid binding protein 6 (FABP6) and Angiotensin-converting enzyme 2 (ACE2) were determined in the Blank group than in the other groups (P<0.05) (Fig. 8).

Fig. 8.

Fig. 8 dummy alt text

FABP6 and ACE2 diversities of the jejunum between the different groups of TBSF. A, mean expression of FABP6; B, mean expression of ACE2. **P < 0.01, ***P < 0.001. Columns, mean of four duplicates; bars, SEM. Blank means the blank group (oral administered PBS), L means the Low-concentration Salmonella Pullorum inoculation (1.39 × 108 CFU/mL) group, LD means the 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder for 3 days group, M means the Medium-concentration Salmonella Pullorum (2.78 × 108 CFU/mL) inoculation group, H means High-concentration Salmonella Pullorum (5.56 × 108 CFU/ mL) inoculation group.

The validation of FABP6 and ACE2 expression in proteome detection by RT-PCR

According to KEGG pathway, FABPs were mainly involved in the peroxisome proliferator-activated receptor (PPAR) pathway. Thus, RT-PCR was used to verify FABP6, ACE2 and PPARα mRNA expressions in the jejunum of TBSF. As shown in Fig. 9, higher levels of FABP6 and PPARα mRNA expression were determined in the blank group than in the other groups (P < 0.05), while lower levels of ACE2 mRNA expression were detected in the blank group than in the other groups (P < 0.05). In order to explore the correlation between FABP6, ACE2 and PPARα signal pathway, we sorted out the gene expression data, calculated the Pearson correlation coefficient, and speculated the correlation between them according to R and P values. The Fig. 10 showed that PPARα gene expression was positively associated with FABP6 gene expression ((P < 0.05). The results indicated that the difference of FABP6 expression in the jejunum of TBSF infected by S. Pullorum may regulated by PPARα pathway.

Fig. 9.

Fig. 9 dummy alt text

The significantly differentially expressed genes of Jejunum. (A) The mRNA relative expression levels of FABP6 gene. (B)The mRNA relative expression levels of PPARα gene. (C) The mRNA relative expression levels of ACE2 gene. Blank means the blank group (oral administered PBS), L means the Low-concentration Salmonella Pullorum inoculation (1.39 × 108 CFU/mL) group, LD means the 1.39 × 108 CFU/mL S. Pullorum inoculation + 0.1g/kg bw 20% florfenicol powder for 3 days group, M means the Medium-concentration Salmonella Pullorum (2.78 × 108 CFU/mL) inoculation group, H means High-concentration Salmonella Pullorum (5.56 × 108 CFU/ mL) inoculation group.

Fig. 10.

Fig. 10 dummy alt text

Pearson Correlation of significantly differentially expressed genes. *P < 0.05.

Discussion

Salmonella Pullorum and Salmonella enterica serovars associated with avian paratyphoid both belong to the genus Salmonella of the family Enterobacteriaceae, sharing similar transmission routes (vertical transmission and fecal-oral transmission) and host adaptability. Salmonella Pullorum can contaminate eggs and thus pose a food safety risk, while avian paratyphoid Salmonella can cause acute gastroenteritis in humans by contaminating poultry meat and eggs. Given that foodborne pathogens have multiple invasion sites, a multifaceted intervention approach is required to effectively control poultry contamination throughout the broiler production cycle and processing stages (Hofacre et al., 2021). Therefore, investigating the functional targets of Salmonella Pullorum is also expected to provide insights for the prevention and control of avian paratyphoid Salmonella, thereby ensuring the quality and safety of chicken and egg products.

Histopathological feature diversities

Our results showed that that crypt depths were lower in the jejunum of L, LD, M and H group than in the jejunum of Blank group. The histopathological alterations in the jejunum were based primarily on injury to crypt. Jejunal crypts play an important role in the regulation of mucosal immune homeostasis in the digestive tract, and they serve as the habitat for intestinal epithelial stem cells and are responsible for cell renewal and repair(Touhara et al., 2025). Therefore, the results indicated that the higher jejunal crypt depth will help repair the damaged part of the jejunum and ensure the digestion and absorption function. In addition, the jejunal crypts in the LD group suggested oral administration of florfenicol didn't have a positive impact on functions of intestinal mucosal barrier. In the study of effects of oral florfenicol on intestinal structure of mice, it was found that florfenicol caused mucosa injury in the jejunum, similar to the results of our study (Yun et al., 2020).

Analysis of proteome diversities

The detrimental effects of S. Pullorum infection on chick growth performance can be attributed primarily to mucosal barrier injury (Tang et al., 2018). A study combined 16S rDNA sequencing with metabolomic profiling to investigate the effects of Salmonella Pullorum on the intestinal microbiota and metabolites of broilers, and found that Corynebacterium and Roseobacter exerted a particularly significant impact on metabolites, indicating that Salmonella Pullorum infection induces remarkable alterations in the composition and metabolic functions of the intestinal microbiota (Zhou et al., 2025). The jejunum of chicken is the main position for nutrient uptake despite little being known about its proteomic alteration during S. Pullorum invasion and florfenicol treatment (O'Reilly et al., 2016). In our study, we investigated the jejunal proteome of chicks infected with Salmonella pullorum, which was mainly enriched in pathways including signal transduction, viral infectious disease, bacterial infectious disease, neurodegenerative disease, cardiovascular disease, immune system, endocrine system, nervous system, digestive system, transport and catabolism, and lipid metabolism. In addition, through the integration of quantitative real-time PCR (qRT-PCR) results and proteomic analysis, numerous key differential proteins were identified, and these core substances are involved in fatty acid metabolism and immune responses. Florfenicol is a broad-spectrum veterinary antibiotic characterized by extensive in vivo distribution and rapid absorption, making it a first-line agent for the treatment and control of avian infectious diseases. In China, the usage rate of florfenicol in broiler farms reaches 78%, ranking first among commonly used antibiotics. Florfenicol is primarily absorbed via the gastrointestinal tract in animals (Shen et al., 2025); in our experiment, florfenicol supplementation inhibited the proliferation of Salmonella pullorum and alleviated perturbations to the jejunal proteome of chickens. Except that, we identified some proteins, such as FABP6 and ACE2, with significantly changed expression in the jejunum caused by S.Pullorum.

Validation by RT-PCR

The jejunum plays a vital role in the digestion and absorption of nutrients, and differences in its capacity to absorb nutrients are prone to have an impact on feed efficiency. In the jejunum of beef, FABP6 is differentially expressed gene and it have been previously associated with residual feed intake in other studies (Kern-Lunbery et al., 2024). For Broiler Chickens, gene expression of FABP6 in mucosa may work as a potential biomarker for gut barrier health (Chen et al., 2015). In zebrafish, the migrated fabp6 ileal enterocytes transdifferentiate into fabp2 jejunal enterocytes to fulfill the regeneration (Wei et al., 2023). Knockdown of FABP6 did not markedly affect the proliferation, apoptosis or migration of tumor cells. This gene was negatively correlated with immune infiltration, and its knockdown upregulated the expression of major histocompatibility complex class I and promoted the secretion of immune-related chemokines. Furthermore, FABP6 knockdown could facilitate the recruitment of CD8+ T cells (Lian, et al. 2022). A study showed that the function of the key gene MSX2 in spleen tissues was validated via quantitative real-time polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA) (Wu et al., 2025). In line with these findings, our experimental validation using RT-qPCR confirmed that FABP6 gene of the jejunum was significantly downregulated. Above all, the FABP6 protein is involved in jejunum barrier making it a potential candidate for gut barrier health and feed efficiency in Broiler Chickens.

ACE2 plays a pivotal role in gut barrier maintenance and intestinal stem cell proliferation, and shows comparably high levels of expression in the gastrointestinal system, in particular in jejunum (Harmer et al., 2002). In the jejunum of Rhesus Macaques infected with Simian Immunodeficiency Virus, the expression of ACE2 in protein level was also decreased (Boby et al., 2022). Some studies showed ACE2 and associated receptors exist in the gut of chicken and play a vital role in infectious diseases(Lei et al., 2023; Pach et al., 2021), and PPAR-α agonist can modulate inflammatory signaling pathway to reduce the interaction between virus and ACE2 (Vallée, 2022).Overall, the findings indicated a potential impact of S. Pullorum infection on expression of FABP6 and ACE2 proteins resulting in the injury of gut homeostasis.

Correlation of significantly differentially expressed genes

In the jejunum of TBSF, FABP6 are positive correlated with PPARα. The correlation between FABP6 and PPAR signal pathway has been found in many studies. For example, in mouse model of radiation-induced intestinal injury, lipid metabolism was a predominant pathway altered in the injury of gut homeostasis, and the protein-protein interaction network revealed FABP6 and PPARα are two of the top hub genes related to lipid metabolism (Sharma et al., 2024). Except that, in Pelodiscus sinensis, FABP6 was enriched in the PPAR signaling pathway(Ji et al., 2025). At present, there are few studies on the correlation between FABP6, ACE2 and PPARα of chicken. This may due to researchers pay more attention to the research on new treatment methods. Above all, the immune function of FABP6 and ACE2 in jejunum need to be further studied.

Conclusions

This study includes histological, proteomic and RT-PCR methods to identify the effects of S.Pullorum on the jejunum of TBSF, and the results were verified with florfenicol treatment group. S.Pullorum results in decreased jejunal integrity and function, which might due to alters of intestinal structure proteins. The changes of proteins associated with the signal transduction, infectious disease and immune system suggests that S.Pullorum compromises Intestinal immune regulation and thus induces mucosal barrier injury. Moreover, in response to S.Pullorum invasion, the down-regulation of FABP6 and ACE2 indicate potential molecular adaptive mechanisms. After treatment with florfenicol, the expression levels of FABP6 and ACE2 have rebounded, indicating that these two molecules are expected to become new targets for treatment. This study significantly provide basic data on effects of S.Pullorum and florfenicol on the jejunum of TBSF and other broiler.

Funding sources

This research was supported by the Basic Research and Talent Training Program of Jiangxi Academy of Agricultural Science, Grant No. JXSNKYJCRC202449, and the National Major Project for Risk Assessment of Quality and Safety of Agricultural Products of Ministry of Agriculture and Rural Affairs of the People’s Republic of China, Grant No. GJFP20240302.

Abbreviations

S. Pullorum, Salmonella Pullorum; TBSF, Taihe Black-Bone Silky Fowls; DIA, data-independent acquisition; DEPs, differentially expressed proteins; FABP6, fatty acid-binding protein 6; PPARα, Peroxisome Proliferator - Activated Receptor Alpha, ACE2, Angiotensin - converting enzyme 2.

Data availability

Data are available in a publicly accessible repository (Chen T, et al., 2022; Ma J, et al., 2019). The data (IPX0013394001) presented in this study are openly available in iProX. The URL: https://www.iprox.cn/page/DSV021.html;?url=1757783795875Y6Eh. Password: Su4c.

CRediT authorship contribution statement

Mengjun Ye: Writing – original draft, Project administration. Li Zhang: Writing – review & editing, Validation. Lijuan Yuan: Writing – review & editing, Validation. Jianjun Xiang: Writing – review & editing, Validation. Qiegen Liao: Writing – review & editing, Validation. Wei Long: Data curation. Yifan Dong: Data curation. Xiren Yu: Data curation. Qiushuang Ai: Data curation. Suyan Qiu: Writing – review & editing, Project administration, Funding acquisition. Dawen Zhang: Writing – review & editing, Project administration, Funding acquisition.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Acknowledgments

First, we thank Shanghai Meiji Biomedical Technology Co., Ltd., for proteome detection. Next, we thank Wuhan servicebio technology CO.,LTD, for paraffin section making.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2026.106578.

Appendix. Supplementary materials

ASSOCIATED CONTENT

Supporting Information. The table is used to display the 86 differential proteins expressed in each group. This following file are available free of charge.

Protein name and Description (file type, i.e.,Excel)

mmc1.xlsx (15.9KB, xlsx)

References

  1. Boby N., Cao X., Williams K., Gadila S.K.G., Shroyer M.N., Didier P.J., Pahar B. Simian immunodeficiency virus infection mediated changes in jejunum and peripheral SARS-CoV-2 receptor ACE2 and associated proteins or genes in rhesus macaques. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.835686. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Chen J., Tellez G., Richards J.D., Escobar J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front. Vet. Sci. 2015;26(2):14. doi: 10.3389/fvets.2015.00014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen T., Ma J., Liu Y., Chen Z., Xiao N., Lu Y., Fu Y., Yang C., Li M., Wu S., Wang X., Li D., He F., Hermjakob H., Zhu Y. IProX in 2021: connecting proteomics data sharing with big data. Nucleic Acids Res. 2022;50(D1):D1522–D1527. doi: 10.1093/nar/gkab1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ding L., Qi K., Zhou Y., Li Q., Liu M., Hu N., Wang J., Qiu J., Deng X., Xu L. Ingestion of artemisia argyit essential oil combats Salmonella pullorum infections by altering gut microbiota composition in chicks. Vet. Res. 2025;56(1):98. doi: 10.1186/s13567-025-01527-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Harmer D., Gilbert M., Borman R., Clark K.L. Quantitative mRNA expression profiling of ACE 2, a novel homologue of angiotensin converting enzyme. FEBS. Lett. 2002;532(1–2):107–110. doi: 10.1016/s0014-5793(02)03640-2. [DOI] [PubMed] [Google Scholar]
  6. Hofacre C.L., Rosales A.G., Costa M.D., Cookson K., Schaeffer J., Jones M.K. Immunity and protection provided by live modified vaccines against paratyphoid salmonella in poultry-an applied perspective. Avian Dis. 2021;65(2):295–302. doi: 10.1637/aviandiseases-D-20-00126. [DOI] [PubMed] [Google Scholar]
  7. Hou M., Ye M., Ma X., Sun Y., Yao G., Liu L., Li X., Hu Y., Wang J. Colon microbiota and metabolite potential impact on tail fat deposition of Altay sheep. Microbiol. Spectr. 2024;12(6) doi: 10.1128/spectrum.03103-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ismail M., El-Kattan Y.A. Comparative pharmacokinetics of florfenicol in the chicken, pigeon and quail. Br. Poult. Sci. 2009;50(1):144–149. doi: 10.1080/00071660802613286. [DOI] [PubMed] [Google Scholar]
  9. Ji L., Shangguan Y., Chen C., Wei C., Zhu J., Hong X., Liu X., Zhu X., Li W. Dietary tannic acid promotes growth performance and resistance against aeromonas hydrophila infection by improving the antioxidative capacity and intestinal health in the chinese soft-shelled turtle (pelodiscus sinensis) Antioxidants (Basel) 2025;14(1):112. doi: 10.3390/antiox14010112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Kern-Lunbery R.J., Rathert-Williams A.R., Foote A.P., Cunningham-Hollinger H.C., Kuehn L.A., Meyer A.M., Lindholm-Perry A.K. Genes involved in the cholecystokinin receptor signaling map were differentially expressed in the jejunum of steers with variation in residual feed intake. Vet. Anim. Sci. 2024;24 doi: 10.1016/j.vas.2024.100357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Lei M., Ma Y., Chen H., Huang P., Sun J., Wang X., Sun Q., Hu Y., Shi J. Emerging SARS-CoV-2 variants of concern potentially expand host range to chickens: insights from AXL, NRP1 and ACE2 receptors. Virol. J. 2023;20(1):196. doi: 10.1186/s12985-023-02123-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Li H., Zhao T., Yuan Z., Gao T., Yang Y., Li R., Tian Q., Tang P., Guo Q., Zhang L. Cartilage lacuna-biomimetic hydrogel microspheres endowed with integrated biological signal boost endogenous articular cartilage regeneration. Bioact. Mater. 2024;41:61–82. doi: 10.1016/j.bioactmat.2024.06.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Li S., Wang B., Zhang M., Yuan D., Li J., Li X., Liang G. Effects of berberine on the pharmacokinetics of florfenicol and levels of cytochrome P450 3A37, multidrug resistance 1, and chicken xenobiotic-sensing orphan nuclear receptor mRNA expression in broilers. Vet. Med. Sci. 2022;8(2):619–625. doi: 10.1002/vms3.660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lian W., Wang Z., Ma Y., Tong Y., Zhang X., Jin H., Zhao S., Yu R., Ju S., Zhang X., Guo X., Huang T., Ding X., Peng M. FABP6 expression correlates with immune infiltration and immunogenicity in colorectal cancer cells. J. Immunol. Res. 2022;2022 doi: 10.1155/2022/3129765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Liu X.Q., Wang F., Jin J., Zhou Y.G., Ran J.S., Feng Z.Q., Wang Y., Liu Y.P. MyD88 polymorphisms and association with susceptibility to Salmonella pullorum. Biomed. Res. Int. 2015;2015 doi: 10.1155/2015/692973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Liu Z., Yu Y., Fotina T., Petrov R., Klishchova Z., Fotin A., Ma J. Multiplex PCR assay based on the citE2 gene and intergenic sequence for the rapid detection of Salmonella Pullorum in chickens. Poult. Sci. 2022;101(8) doi: 10.1016/j.psj.2022.101981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Ma J., Chen T., Wu S., Yang C., Bai M., Shu K., Li K., Zhang G., Jin Z., He F., Hermjakob H., Zhu Y. IProX: an integrated proteome resource. Nucleic Acids Res. 2019;47(D1):D1211–D1217. doi: 10.1093/nar/gky869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. O'Reilly E.L., Burchmore R.J., Sparks N.H., Eckersall P.D. The effect of microbial challenge on the intestinal proteome of broiler chickens. Proteome. Sci. 2016;15:10. doi: 10.1186/s12953-017-0118-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Pach S., Nguyen T.N., Trimpert J., Kunec D., Osterrieder N., Wolber G. ACE2-variants indicate potential SARS-CoV-2-susceptibility in animals: a molecular dynamics study. Mol. Inform. 2021;40(9) doi: 10.1002/minf.202100031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Pokrant E., Riquelme R., Maddaleno A., San Martín B., Cornejo J. Residue depletion of florfenicol and florfenicol amine in broiler chicken claws and a comparison of their concentrations in edible tissues using LC⁻MS/MS. Molecules. 2018;23(9):2211. doi: 10.3390/molecules23092211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Rodrigues I., Choct M. The foregut and its manipulation via feeding practices in the chicken. Poult. Sci. 2018;97(9):3188–3206. doi: 10.3382/ps/pey191. [DOI] [PubMed] [Google Scholar]
  22. Schat K.A., Nagaraja K.V., Saif Y.M. Pullorum disease: evolution of the eradication strategy. Avian Dis. 2021;65(2):227–236. doi: 10.1637/aviandiseases-D-21-00024. [DOI] [PubMed] [Google Scholar]
  23. Sharma S., Rehan A., Dutta A. A data mining approach to identify key radioresponsive genes in mouse model of radiation-induced intestinal injury. Biomarkers. 2024;29(8):505–517. doi: 10.1080/1354750x.2024.2420196. [DOI] [PubMed] [Google Scholar]
  24. Shen W., Wang K., Han Y., Wang H., Duan Z. Effects of florfenicol on body weight, intestinal inflammatory response, intestinal fluid metabolism and microorganisms in broilers. J. Vet. Sci. 2025;26(2):e25. doi: 10.4142/jvs.24194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Spalding M. Diseases of poultry. J. Wildlife Dis. 2009;45(1):251–256. doi: 10.7589/0090-3558-45.1.251. %J Journal of Wildlife Diseases. [DOI] [Google Scholar]
  26. Talukder H., Roky S.A., Debnath K., Sharma B., Ahmed J., Roy S. Prevalence and antimicrobial resistance profile of salmonella isolated from human, animal and environment samples in South Asia: a 10-year meta-analysis. J. Epidemiol. Glob. Health. 2023;13(4):637–652. doi: 10.1007/s44197-023-00160-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Tang Y., Foster N., Jones M.A., Barrow P.A. Model of persistent salmonella infection: salmonella enterica serovar pullorum modulates the immune response of the chicken from a Th17-type response towards a Th2-type response. Infect. Immun. 2018;86(8) doi: 10.1128/iai.00307-18. -18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Touhara K.K., Rossen N.D., Deng F., Castro J., Harrington A.M., Chu T., Garcia-Caraballo S., Brizuela M., O'Donnell T., Xu J., Cil O., Brierley S.M., Li Y., Julius D. Topological segregation of stress sensors along the gut crypt-villus axis. Nature. 2025;640(8059):732–742. doi: 10.1038/s41586-024-08581-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Tripathi Y.M., Chatla S.B., Chang Y.I., Huang L.S., Shieh G.S. A nonlinear correlation measure with applications to gene expression data. PLoS One. 2022;17(6) doi: 10.1371/journal.pone.0270270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Vallée A. Cannabidiol and SARS-CoV-2 infection. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.870787. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Wang X., Cheng Y., Zhang W., Lu Q., Wen G., Luo Q., Shao H., Pan Z., Zhang T. (P)ppGpp synthetases are required for the pathogenicity of Salmonella Pullorum in chickens. Microbiol. Res. 2021;245 doi: 10.1016/j.micres.2020.126685. [DOI] [PubMed] [Google Scholar]
  32. Wei X., Tan X., Chen Q., Jiang Y., Wu G., Ma X., Fu J., Li Y., Gang K., Yang Q., Ni R., He J., Luo L. Extensive jejunal injury is repaired by migration and transdifferentiation of ileal enterocytes in zebrafish. Cell Rep. 2023;42(7) doi: 10.1016/j.celrep.2023.112660. [DOI] [PubMed] [Google Scholar]
  33. Wilson R.L., Elthon J., Clegg S., Jones B.D. Salmonella enterica serovars gallinarum and pullorum expressing Salmonella enterica serovar typhimurium type 1 fimbriae exhibit increased invasiveness for mammalian cells. Infect. Immun. 2000;68(8):4782–4785. doi: 10.1128/IAI.68.8.4782-4785.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Wu J., Liang W., Liu A., Wang X., Fan Z., Ma X., Chen S., Fang C., Zhang X., Luo Q. Joint analysis of whole-genome methylation and transcriptome in avian pullorum disease and validation of gene function. BMC Genomics. 2025;26(1):617. doi: 10.1186/s12864-025-11821-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Xiang X., Huang X., Wang J., Zhang H., Zhou W., Xu C., Huang Y., Tan Y., Yin Z. Transcriptome analysis of the ovaries of Taihe black-bone silky fowls at different egg-laying stages. Genes (Basel) 2022;13(11):2066. doi: 10.3390/genes13112066. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Yang L., Chen Y., Bai Q., Chen X., Shao Y., Wang R., He F., Deng G. Protective effect of bifidobacterium lactis JYBR-190 on intestinal mucosal damage in chicks infected with Salmonella pullorum. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.879805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Ye M., Hou M., Peng Q., Jia S., Peng B., Yin F., Li N., Wang J. The microbiota and cytokines correlation between the jejunum and colon in Altay sheep. Animals (Basel) 2022;12(12):1564. doi: 10.3390/ani12121564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Ye M., Yuan L., Liao Q., Xiang J., Zhang L., Ai Q., Qiu S., Dong Y., Yu X., Zhang D. Residue depletion and withdrawal interval estimations of sulfamonomethoxine or doxycycline residues in chinese taihe black-bone silky fowls. Animals (Basel) 2025;15(5):640. doi: 10.3390/ani15050640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Yu K., Choi I., Kim M., Pyung Y.J., Lee J.S., Choi Y., Won S., Kim Y., Park B.C., Han S.H., Park T.S., Dalgaard T.S., Yun C.H. Florfenicol-induced dysbiosis impairs intestinal homeostasis and host immune system in laying hens. J. Anim. Sci. Biotechnol. 2025;16(1):56. doi: 10.1186/s40104-025-01186-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yun S., Guo Y., Yang L., Zhang X., Shen W., Wang Z., Wen S., Zhao D., Wu H., Chen J., Sun Y., Duan Z. Effects of oral florfenicol on intestinal structure, function and microbiota in mice. Arch. Microbiol. 2020;202(1):161–169. doi: 10.1007/s00203-019-01731-y. [DOI] [PubMed] [Google Scholar]
  41. Zhang D., Zhuang L., Jiang Y., Yang Y., Xu M., Dou X., Gong J. Efficient differentiation between Salmonella Pullorum and Salmonella Gallinarum by a fimH-based PCR-HRM. Avian Pathol. 2025;54(4):450–454. doi: 10.1080/03079457.2025.2450840. [DOI] [PubMed] [Google Scholar]
  42. Zhang L., Ye M., Dong Y., Yuan L., Xiang J., Yu X., Liao Q., Ai Q., Qiu S., Zhang D. Strict relationship between phenotypic and plasmid-associated genotypic of multidrug-resistant Escherichia coli isolated from Taihe black-boned silky fowl farms. Poult. Sci. 2025;104(6) doi: 10.1016/j.psj.2025.105082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Zhou X., Xu Y., Fang C., Ye C., Liang W., Fan Z., Ma X., Liu A., Zhang X., Luo Q. Transcriptome and metabolome reveal the mechanism of neuroendocrine regulation in ovarian development of broiler breeders. Genomics. 2025;117(3) doi: 10.1016/j.ygeno.2025.111035. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ASSOCIATED CONTENT

Supporting Information. The table is used to display the 86 differential proteins expressed in each group. This following file are available free of charge.

Protein name and Description (file type, i.e.,Excel)

mmc1.xlsx (15.9KB, xlsx)

Data Availability Statement

Data are available in a publicly accessible repository (Chen T, et al., 2022; Ma J, et al., 2019). The data (IPX0013394001) presented in this study are openly available in iProX. The URL: https://www.iprox.cn/page/DSV021.html;?url=1757783795875Y6Eh. Password: Su4c.


Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES