Evaluation of the antioxidant and anti-inflammatory efficacy of fermented Polygonatum sibiricum using zebrafish model

Abstract

Background

Fermentation may enhance the skincare potential of the traditional Chinese medicine Polygonatum sibiricum (PS). This study aimed to evaluate the anti-oxidant and anti-inflammatory efficacy of fermented Polygonatum sibiricum (FPS) using zebrafish models.

Methods

A UV-induced zebrafish skin oxidative stress model was established. Embryos were treated with FPS at concentrations of 0.05, 0.10, or 0.20 mg/mL. Evaluations included fin morphology, reactive oxygen species (ROS) levels, activities of antioxidant enzymes (SOD, CAT), malondialdehyde (MDA) content, skin cell apoptosis, and expression of inflammatory genes (PPAR-γ, NF-κB, iκbαa, AP-1). Additionally, a sodium lauryl sulfate (SLS)-induced inflammation model was used to assess neutrophil recruitment.

Results

FPS treatment dose-dependently ameliorated UV-induced fin shrinkage and significantly reduced ROS accumulation. At 0.20 mg/mL, FPS markedly elevated SOD and CAT activities while decreasing MDA levels (p < 0.01). It also reduced UV-triggered skin cell apoptosis and modulated key inflammatory genes. In the SLS model, FPS significantly suppressed neutrophil migration (p < 0.05). Conclusions: FPS demonstrated significant protective effects against skin damage by alleviating oxidative stress, reducing apoptosis, and suppressing inflammation in zebrafish, supporting its potential as a natural ingredient for cosmetic applications.

Highlights

• •Fermented Polygonatum sibiricum (FPS) alleviates UV-induced fin damage in zebrafish.
• •FPS reduces reactive oxygen species (ROS) and skin cell apoptosis after UV exposure.
• •FPS enhances antioxidant enzyme (SOD, CAT) activities and decreases MDA levels.
• •FPS modulates PPAR-γ/NF-κB/AP-1 pathway genes to suppress inflammation.
• •FPS inhibits neutrophil migration in a sodium lauryl sulfate-induced inflammation model.

1. Introduction

Skin plays a crucial role in many physiological processes and social interaction. Meanwhile, a series of factors particularly UV irradiation strongly drive skin aging that cause skin oxidative stress and lead to disorders of skin morphology including skin tone unevenness, pigmentary disorder, skin roughness and wrinkles [1,2]. Cosmetic is important in the regulation of skin morphology [3,4]. However, the resource of cosmetics has been attention due to the effects of certain harmful chemicals and toxins on skin. Current efforts to mitigate the side effects of these ingredients in cosmetics include an addition of natural compounds derived from plant in cosmetics, which provides a healthier option for consumers [3]. Accumulating evidence substantiated the cosmetics derived from plants serve a function to against detrimental factors to skins such as skin aging, dryness and environmental damages, thereby improving the skin appearance [[5], [6], [7], [8]]. Nonetheless, very little is known of many of plant materials regarding their efficacy that boosts the necessity for more evidences to shed light on the effects of these herbal products [9].

The effectiveness of the natural products is also limited due to the complex structure of their compounds [10]. Fermentation has been shown to be an effective strategy to improve plant-based food that significantly improves biological activity of traditional medicine as compared to normal treatment [[11], [12], [13]]. Zhao et al. suggested that fermentation can increase antioxidant activity and improve biologically active compounds by breaking down the plant cell walls. Regarding the improvement of fermentation to plant materials in skincare, Majchrzak et al. showed that fermentation converts the complex structure of compounds to simple structure that improve the efficiency and bioavailability by altering epidermal compatibility and penetration into the skin [14,15].

Polygonatum sibiricum (PS) has been described as an important and versatile Chinese traditional medicine, which has a great potential in cosmetics industry that it provides abundant conducive materials, and a series of biological activities [[16], [17], [18]]. Previous studies have shown the efficacy of PS and its close relative Polygonatum kingianum in skincare [[19], [20], [21]]. PS possesses broad therapeutic effects due to its diverse bioactive constituents, such as polysaccharides, saponins, polyphenols, and flavonoids. These compounds exhibit antioxidant, antitumor, anti-inflammatory, hypoglycemic, and lipid-lowering properties [22]. Our previous research systematically investigated the enhancement of the lipid-lowering activity and underlying mechanisms of fermented Polygonatum sibiricum (FPS) by Lactobacillus plantarum NX-1. The research found that fermentation significantly increased the content of polysaccharides and saponins in the extract and substantially improved its in vitro cholesterol-binding capacity and pancreatic lipase inhibition rate. Untargeted metabolomic analysis revealed a notable increase in the levels of various bioactive metabolites related to bile acid metabolism (such as taurocholic acid, acetylcholine, and phosphocholine) and linoleic acid metabolism (e.g., (±)12,13-DiHOME and 13-OxoODE) in the fermented solution. This study provides new insights for developing functional Polygonatum products using probiotic fermentation technology [23].

Assessing the efficacy of PS to explore its potential application in healthcare, is critical for extending the use of Chinese traditional medicine even the development of Chinese traditional medicine or natural personal care industry. Meanwhile, the application of fermentation provides an alternative to formulate an appropriate pathway to improve the effectiveness of Chinese traditional medicines. Encouraged and inspired by the experimental results that the fermented PS effectively inhibited lipid accumulation in a high-fat diet-induced zebrafish model, we plan to expand the application of FPS. Given that chronic diseases such as obesity are primarily triggered by inflammatory factors in the body, and these factors can also lead to other conditions like oxidative stress-related diseases, we hypothesize that FPS should also possess excellent antioxidant and anti-inflammatory effects. To test this hypothesis, we have designed the present experiment [[24], [25], [26]].

This study employed zebrafish (Danio rerio) models to evaluate the skincare efficacy of FPS. The zebrafish model was selected based on two key advantages: first, its tail fin offers a well-established system to study epidermal cell response to injury and agent-mediated tissue repair [27]; second, its optical transparency during embryonic and larval stages allows for direct, non-invasive observation of skin effects [28]. Specifically, we aimed to: (1) assess the protective effect of FPS against UV-induced fin morphology damage; (2) determine its antioxidant activity by measuring levels of reactive oxygen species (ROS) and key antioxidant markers [superoxide dismutase (SOD), catalase (CAT), malondialdehyde (MDA)]; (3) evaluate its inhibitory effect on UV-induced skin cell apoptosis; (4) investigate its modulation of key genes (PPAR-γ, NF-κB, iκbαa, AP-1) within inflammatory pathways to elucidate the mechanism underlying its protection against UV-induced oxidative stress; and (5) further examine its anti-inflammatory efficacy using a sodium lauryl sulfate (SLS)-induced zebrafish skin inflammation model.

2. Materials and methods

2.1. Fermentation of Polygonatum sibiricum

PS was sourced from Anhui Wuxi Biotechnology Co., Ltd., located in Chizhou City, Anhui Province, China. Upon arrival at Guangdong Longseek Testing Co., Ltd., the PS rhizomes were dried at 50 °C for approximately 72 h until a constant weight was reached. The PS was fermented as described in our previous report [23]. In breif, the PS was pulverized into a fine, uniform powder. Distilled water (50 °C) was added to the PS powder, which was then incubated with cellulase and pectinase in a water bath at 50 °C for 90 min. Following this, glucose was added into the solution, decanted into fermentation cylinder and autoclaved at 50 °C for 15 min. Lactobacillus plantarum NX-1 [China General Microbiological Culture Collection Center (CGMCC) No.20109] was inoculated into the solution, which was then centrifuged at 100 rpm and incubated at 37 °C for 2 days. After centrifugation, the solution was transferred to a new bottle and centrifuged at 4000 rpm for 20 min. The aqueous supernatant was then collected and autoclaved at 118 °C for 15 min to prepare FPS for subsequent experiments.

2.2. Untargeted metabolomics

Metabolite Extraction and Instrumental Analysis by LC-MS/MS: Metabolite extraction was performed following a standardized protocol: 100 μL of sample was mixed with an internal standard and an extraction solvent (methanol:acetonitrile = 2:1), followed by vortexing, ultrasound-assisted extraction in an ice-water bath, low-temperature incubation, and centrifugation. The supernatant was collected for analysis, and a quality control (QC) sample was prepared. Analysis was conducted using an Agilent 1290 UHPLC system coupled with a Q-TOF G6545 mass spectrometer. Chromatographic separation was performed on an ACQUITY UPLC BEH C18 column with a mobile phase consisting of water and acetonitrile, each containing 0.1% formic acid, using a gradient elution program. Mass spectrometric detection was carried out in both positive and negative ESI modes, with a mass scan range of 50–1300 Da. MS/MS data were acquired at both low and high collision energies. The total ion chromatogram (TIC) of the PS and FPS in positive and negative ionization mode is shown in Figure S1-S4. For the complete raw data, please refer to the “Untargeted Metabolomic Profiling” file in the Supporting Information.

Untargeted Metabolomic Analysis: Quality control (QC) samples were prepared by pooling equal aliquots from all study samples and analysed at regular intervals throughout the batch to monitor system stability (Supporting Information, sheet 1). Peaks with a detection rate below 50% or a coefficient of variation greater than 30% in QC samples were excluded. Metabolomic profiling was performed using ultra-high performance liquid chromatography coupled with quadrupole-orbitrap mass spectrometry (UHPLC-Q Exactive Orbitrap MS, Thermo Fisher Scientific, Waltham, MA, USA) under both positive (ESI⁺) and negative (ESI⁻) electrospray ionization modes. Data were processed with MS-DIAL (v4.90) for peak detection, alignment, and quantification. Metabolites were annotated by matching against public databases (HMDB, MassBank, METLIN) with confidence levels assigned according to the Metabolomics Standards Initiative (MSI) Levels 1–3. Data preprocessing, normalization, and statistical analysis were carried out using R (v4.1.2) and the MetaboAnalyst R package (v6.0; available at https://www.metaboanalyst.ca/docs/RTutorial.xhtml).

2.3. Zebrafish embryo culture

Wild-type AB strain adult zebrafish were maintained at 28.5 °C, pH 7.5, under a 14/10-h (day/night) photoperiod, and 500-550 μm/cm conductivity in a zebrafish breeding system. Following this, zebrafish embryos were obtained from those adult zebrafish through natural mating before placed in E3 water and cultured in an incubator at 28 °C.

2.4. Zebrafish treatment

Prior to the assays, wild-type AB strain zebrafish embryos were collected and incubated in culture plates at 28 °C to 48 h in incubator. The experiment comprised the model group, three treatment group, plus an untreated control. In the following 24-h period, the zebrafish in model group and control group were incubated in the presence of 2 mL E3 water, while the zebrafish in treatment group were incubated in the presence of 2 mL of FPS at three concentrations viz. 0.05, 0.10 or 0.20 mg/mL (treatment groups). All the zebrafish were then exposed to UV light (20 mW/cm²) for 1.5 h to induce skin damage and establish zebrafish model of skin oxidative stress. Afterwards, the zebrafish embryos in each group were treated with refreshed E3 water or refreshed FPS for subsequent assessment.

2.5. Fin morphology recording and microscopy (experiment 1)

Six to 8-h post fertilization (6-8 hpf) zebrafish embryos were treated as described in zebrafish treatment. The zebrafish embryos were collected at 3-h post successful establishment of skin oxidative stress and incubation, followed by 3 washes with E3 water. A microscopy work was undertaken to observe the tail fins of zebrafish and the sizes were analysed using Image J.

2.6. FPS alleviates UV-induced oxidative stress in zebrafish by reducing ROS and enhancing antioxidant capacity (experiment 2)

ROS level: Six to eight hpf zebrafish embryos were collected then incubated in the presence of 100 μM phenylthiourea (PTU) for pigmentation inhibition. The zebrafish embryos were then treated as described in zebrafish treatment. The zebrafish embryos were collected at 3-h post successful establishment of skin oxidative stress and incubation then transferred to 96-well plates. The remaining liquid was removed then the zebrafish embryos were incubated in the presence of 200 μL of 5 μM fluorescent dye DCFH-DA at 28 °C for 30 min in incubator. The DCFH-DA on the zebrafish embryos was then removed using E3 water and anesthetized using 0.02% tricaine. A microscopy work was then undertaken to observe the ROS level in zebrafish embryos and the degree of fluorescence intensity was detected by Image plus 6.0.

SOD activity, CAT activity, and MDA level: A series experiments were undertaken to assess the antioxidative activity of FPS. Two-day post fertilization (2 dpf) zebrafish embryos were collected. The zebrafish embryos were treated as described in zebrafish treatment. The zebrafish embryos were collected at 18-h post successful establishment of skin oxidative stress and incubation, followed by 2 washes with E3 water. The zebrafish embryos were transferred to new clean tubes followed by removal of water in tubes. The zebrafish embryos were then milled using 400 μL pre-cooled phosphate buffered saline (PBS) and zirconia balls in tissue homogenizer. The supernatant of each sample was collected by centrifugation (10000 g) at 4 °C for 10-15 min. SOD activity in zebrafish was measured using the WST-1 method with a commercial SOD Assay Kit (G4306, Bioservice, Wuhan, China). CAT levels were determined following the protocol described by Liu et al. using a Catalase Assay Kit (G4307, Bioservice, Wuhan, China). Additionally, MDA levels were assessed via the TBA method using a Lipid Peroxidation (MDA) Assay Kit (G4302, Bioservice, Wuhan, China) [29].

2.7. Apoptosis of skin cells of the zebrafish embryo (experiment 3)

Six to 8-h post fertilization (6-8 hpf) zebrafish embryos were collected then incubated in the presence of 100 μM phenylthiourea (PTU) for pigmentation inhibition. The zebrafish embryos were then treated as described in zebrafish treatment. The zebrafish embryos were collected at 3-h post successful establishment of skin oxidative stress and incubation then transferred to 96-well plates. The remaining liquid was removed then the zebrafish embryos were incubated with an addition of 200 μL of 1 μg/mL acridine orange (AO) at 28 °C for 30 min in incubator for acridine orange fluorescent staining. Following this, the AO on the zebrafish embryos was removed using E3 water and anesthetized using 0.02% tricaine. A microscopy work was then undertaken to observe the apoptosis of skin cells of the zebrafish embryos and the degree of fluorescence intensity was detected by Image plus 6.0.

2.8. Quantification of gene expression assay (experiment 4)

To test whether the FPS have an effect on the expression of genes that associated with inflammatory pathway in zebrafish, 2 dpf zebrafish embryos were collected. The zebrafish embryos were then treated as described above. The zebrafish embryos were collected at 18-h post successful establishment of skin oxidative stress and incubation, and transferred to new clean tubes. Total RNA was extracted using RNA-Easy extraction kits (Tiangen, China) following the manufacturer's instructions. The contaminant genomic DNA was then removed and cDNA was synthesized using FastKing gDNA Dispelling RT SuperMix (Tiangen, China) according to the manufacturer's instructions. The mix consisted of 4 μL of Total RNA, 0.5 μg of FastKing gDNA Dispelling RT SuperMix, followed by an addition of H₂0 to a final volume of 20 μL. Following this, the mix solutions were preserved at 42 °C for 42 min and 95 °C for 3 min. Quantitative reverse transcriptase real time polymerase chain reactions (qPCR) were undertaken using gene-specific primers (Table 1). The qPCR mix consisted of 3 μL of cDNA sample, 10 μL of SYBR Green qPCR SuperMix, 6.2 μL of dH₂0, and 0.4 μL of each primer. qPCR was carried out using 40 cycles with the following temperature curve: 30s 95 °C, 10s 95 °C, and 30s 60 °C. The final melt curve was obtained by ramping from 60 to 95 °C while every sample had three replicates. The expression of specific genes was analysed by Real-Time PCR System (Tianlong, China) using 2^−ΔΔCt method.

Table 1.

The forward and reverse primers used in qPCR assay.

Target gene	Accession No.	Forward Primer	Reverse Primer
β-actin [30]	XM_030406939.1	GGTACCCATCTCCTGCTCCAA	GAGCGTGGCTACTCCTTCACC
PPAR-γ [31]	NM-131467.1	CTGCCGCATACACAAGAAGA	TCACGTCACTGGAGAACTCG
NF-κB1[32]	NM_001353873.1	AGTCAGCCTCAGATCCGTGTGTTT	TTGTAAGCAAGGCCCATCAACTGC
iκbαa [33]	NM_213184.2	GGTGGAAAGACTCCTGAAAGC	TGTAGTTAGGGAAGGTAAGAATG
AP-1 [33]	NM_199987.1	CCACCGCTCTCTCCTATC	ATCCTCTCCAGTTTCCTCTT

2.9. Skin inflammation (experiment 5)

Six to eight hpf Tg(mpx:eGFP) zebrafish embryos were collected then incubated in the presence of 100 μM phenylthiourea (PTU) for pigmentation inhibition. The zebrafish embryos were then treated using FPS at three concentrations viz. 0.05, 0.10 or 0.20 mg/ml, with an addition of sodium lauryl sulfate (SLS) for the establishment of zebrafish model of skin inflammation [34]. The zebrafish embryos were collected at 18-h post successful establishment of skin inflammation and incubation. The remaining liquid was removed then the zebrafish embryos were washed using E3 water and anesthetized using 0.02% tricaine. A microscopy work was then undertaken to observe neutrophils on zebrafish embryos’ skin and the degree of fluorescence intensity was detected by Image plus 6.0.

2.10. Observation and statistical analysis

All data sets were statistically analysed that means were expressed in mean ± SEM. t-test was performed to compare the means of control group and model group. Analysis of Variance (ANOVA) and Tukey's post-hoc comparisons were performed to compare the means of model group and treatment groups.

3. Results

3.1. Fin morphology recording and microscopy (experiment 1)

Ultraviolet (UV) radiation is the primary exogenous environmental factor leading to skin damage and aging. It readily induces physiological effects such as inflammatory responses, oxidative stress (which occurs when free radical production exceeds the body's clearance capacity and can cause severe damage to cellular structures), DNA damage, and even disruption of the active structures of collagen and elastin. Externally, these manifest as skin redness, pigmentation, laxity, and fine wrinkles. The zebrafish fin is analogous to human limbs, and its skin structure is similar to that of humans. UV-induced damage in zebrafish leads to a series of harmful physiological effects, visually observed as fin atrophy and reduced area. The effective absorption of UV radiation by skincare products on the skin surface helps prevent UV-induced damage. By comparing the recovery of the sunburned area (fin area) between the experimental and control groups, the anti-photoaging efficacy of FBS in zebrafish can be evaluated [35].

The fin morphology of zebrafish was significantly affected following UV irradiation that a lower relative fin size was observed in the model group as compared to the untreated control (p < 0.01) (Fig. 1A and B). Meanwhile, the presence of FPS ameliorated zebrafish fin following UV irradiation that showed a larger relative tail fin area as compared to model group (p < 0.01) (Fig. 1A and B). Statistical analysis revealed a positive correlation between the concentration of the agent and fin size in treatment group (Fig. 1B). The relative fin tail was greatest for 0.20 mg/mL FPS, with 87.90 ± 2.91%, as compared to 83.92 ± 2.19% for 0.10 mg/mL FPS and 78.27 ± 3.15% for 0.05 mg/mL FPS (Fig. 1B).

Fig. 1.

FPS alleviates UV-induced skin oxidative stress damage in zebrafish. (A) Representative microscopic images of zebrafish embryos showing the tail fin area. (B) Quantitative analysis of the relative tail fin area. Data are presented as mean ± SD. Statistical significance compared to the UV-irradiated control group is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. FPS, fermented Polygonatum sibiricum; UV, ultraviolet.

3.2. FPS alleviates UV-induced oxidative stress in zebrafish by reducing ROS and enhancing antioxidant capacity (experiment 2)

ROS are oxygen-containing chemically reactive molecules, including peroxides, superoxides, hydroxyl radicals, and others. ROS are naturally formed as byproducts of normal oxygen metabolism and play vital roles in cellular signaling and homeostasis. However, during ultraviolet exposure, ROS levels can increase dramatically. This may cause severe damage to cellular structures, a condition known as oxidative stress. Menadione can generate reactive oxygen free radicals. Oxidative stress occurs when the production of free radicals exceeds the body's capacity to clean them, leading to reduced activity of SOD. The antioxidant efficacy of the test substance was evaluated based on zebrafish yolk sac fluorescence intensity and SOD activity [[36], [37], [38], [39]].

The FPS showed a remarkable efficacy in decreasing ROS production induced by UV-irradiation that a higher degree of degree of fluorescence intensity was observed in model group (Fig. 2A). The statistical analysis revealed a significantly greater degree of fluorescence intensity model group (732.11%) as compared to the untreated control (100%) (p < 0.01), suggesting the increased ROS production in zebrafish embryo induced by UV irradiation (Fig. 2B). The presence of FPS significantly decreased the ROS production following UV irradiation. The effectiveness increased as concentration of FPS was increased from 0.05 to 0.20 mg/mL of the treatment that the best performance (151.01%) was given by FPS at the concentration of 0.20 mg/mL, followed by 179.86% for 0.10 mg/mL FPS and 385.49% for 0.05 mg/mL FPS (Fig. 2B). UV irradiation significantly decreased the activities of SOD and CAT (p < 0.01, p < 0.001, respectively; Fig. 2C and D). The zebrafish treated with 0.20 mg/mL FPS had greatest SOD activity, with 75.07 U/mg prot, as compared to 67.53 U/mg prot for 0.10 mg/mL FPS, and 55.96 U/mg prot for 0.05 mg/mL FPS (Fig. 2C). Likewise, the zebrafish treated with 0.20 mg/mL FPS had greatest CAT activity, with 7.67 U/mg prot, as compared to 6.60 U/mg prot for 0.10 mg/mL FPS, and 5.17 U/mg prot for 0.05 mg/mL FPS (Fig. 2D). UV irradiation significantly increased MDA level (p < 0.01; Fig. 2E). The MDA level decreased as the concentration of FPS was increased from 0.05 to 0.20 mg/mL of the treatment (p < 0.01) (Fig. 2E). The zebrafish in model group had a greatest MDA level of 0.504 U/mg prot. Meanwhile, 0.05, 0.10, and 0.20 mg/mL FPS treatment provided significantly lower MDA levels (0.396, 0.364, and 0.328 U/mg prot, respectively) as compared to model group (p < 0.05, p < 0.01, p < 0.01, respectively; Fig. 2E).

Fig. 2.

FPS reduces oxidative stress in UV-irradiated zebrafish by scavenging ROS and enhancing antioxidant capacity. (A) Representative fluorescence images showing intracellular ROS levels in zebrafish embryos (arrows indicate ROS signals). (B) Quantitative analysis of relative ROS fluorescence intensity. (C–E) Effects of FPS on the activities of antioxidant enzymes and levels of oxidative damage marker: (C) superoxide dismutase (SOD) activity, (D) catalase (CAT) activity, and (E) malondialdehyde (MDA) content. Data are presented as mean ± SD. Statistical significance compared to the UV-irradiated control group is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. FPS, fermented Polygonatum sibiricum; UV, ultraviolet; ROS, reactive oxygen species.

3.3. Apoptosis of skin cells of the zebrafish embryo (experiment 3)

The melanogenesis pathway in zebrafish is conserved with that in humans, and genes related to the melanin production process (such as tyr, mitf, sox10, and dct) are also highly homologous to their human counterparts. PTU, an organic sulfur-type tyrosinase inhibitor, can block pigmentation in zebrafish by inhibiting the tyrosinase-dependent melanogenesis pathway, thereby removing endogenous pigments without causing significant toxicity. Zebrafish embryos are transparent during early development, allowing direct observation of head melanocytes under a microscope. PTU treatment reduces melanin production in zebrafish, resulting in a more transparent appearance that facilitates the assessment of fluorescence intensity in subsequent experiments [40,41]. Subsequently, acridine orange staining is performed, and the green fluorescence intensity of zebrafish is quantified under microscopy to monitor apoptosis in skin cells [42].

A significantly higher degree of fluorescence intensity was observed in the model group as compared to the untreated control and the treatment groups (Fig. 3A). The statistical analysis revealed a significantly greater degree of fluorescence intensity model group (214.35%) as compared to the untreated control (100%) (p < 0.01), suggesting the increased total number of apoptotic cells detected in zebrafish embryo induced by UV irradiation (Fig. 3B). The presence of FPS significantly reduced the increased total number of apoptotic cells detected in zebrafish embryo following UV irradiation (p < 0.01) (Fig. 3B). However, the total number of apoptotic cells in zebrafish embryo decreased as concentration of FPS was increased from 0.05 to 0.20 mg/mL of the treatment that the best performance (77.25%) was given by FPS at the concentration of 0.20 mg/mL, followed by 87.16% for 0.10 mg/mL FPS and 136.50% for 0.05 mg/mL FPS (Fig. 3B). The results showed that FPS can decrease UV-induced apoptosis of skin cells of the zebrafish embryo, pointing at a possible role of this agent in skin morphology regulation.

Fig. 3.

FPS alleviates UV-induced skin cell apoptosis in zebrafish embryos. (A) Representative fluorescence images of apoptotic cells in the skin region of zebrafish embryos stained with acridine orange. (B) Quantitative analysis of relative apoptotic cell fluorescence intensity. Data are presented as mean ± SD. Statistical significance compared to the UV-irradiated control group is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. FPS, fermented Polygonatum sibiricum; UV, ultraviolet.

3.4. Quantification of gene expression assay (experiment 4)

Peroxisome Proliferator-Activated Receptor γ (PPARγ) is a ligand-activated nuclear receptor transcription factor that belongs to the nuclear hormone receptor superfamily. It plays a key role in regulating cell differentiation, development, metabolism (such as carbohydrate, lipid, and protein metabolism), and inflammatory responses [43]. Nuclear Factor-κB1 (NF-κB1) is a critical member of the NF-κB transcription factor family. It typically exists in two forms and plays a unique and central role in cellular signaling and gene regulation. Its biological significance includes being a core regulator of immunity and inflammation: as the primary partner of p65, p50 is essential for initiating rapid and effective inflammatory responses to infection and injury. It is involved in regulating the production of key mediators such as TNF-α, IL-6, and chemokines [44]. Nuclear Factor Kappa B Inhibitor Alpha (iκbα) is a crucial regulatory protein within cells, primarily responsible for controlling the activity of NF-κB. NF-κB is a transcription factor often referred to as the “master switch” of the cell, regulating hundreds of genes related to immunity, inflammation, cell growth, and survival [45]. Activator Protein-1 (AP-1) is a transcription factor complex composed of multiple protein subunits. AP-1 plays a pivotal role in cells by integrating various extracellular signals (such as growth factors and stress stimuli) and participating in the regulation of physiological processes like cell proliferation, differentiation, apoptosis, and inflammatory responses. Its activity is finely regulated by the MAPK signaling pathways (including the JNK, ERK, and p38 pathways). For example, the JNK pathway can enhance the transcriptional activity of AP-1 by phosphorylating c-Jun [46]. We selected the expression levels of these four genes to assess the anti-inflammatory and antioxidant effects of FPS in zebrafish [33].

UV irradiation and the treatment of FPS significantly regulated the expression of genes that associated with skin inflammation. The expression of PPAR-γ of zebrafish was significantly down-regulated after UV irradiation as compared to the untreated control, while the gene was significantly up-regulated in the presence of FPS that the effectiveness increased as concentration of FPS was increased from 0.05 to 0.20 mg/mL of the treatment (Fig. 4A). Meanwhile, the expressions of NF-κB, iκbαa, and AP-1 in zebrafish were significantly down regulated after UV irradiation as compared to the untreated control. All of the expression of three genes of zebrafish were significantly up regulated in the presence of FPS (Fig. 4B–D). It is noteworthy that 0.1 mg/mL FPS gave a better performance in down regulation of NF-κB and AP-1 following UV irradiation as compared to 0.05 and 0.20 mg/mL of FPS (Fig. 4B–D).

Fig. 4.

FPS modulates the expression of inflammation-associated genes in UV-irradiated zebrafish embryos. Relative mRNA expression levels of (A) PPAR-γ, (B) NF-κB, (C) iκbαa, and (D) AP-1. Data are presented as mean ± SD. Statistical significance compared to the UV-irradiated control group is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. FPS, fermented Polygonatum sibiricum; UV, ultraviolet.

3.5. Skin inflammation (experiment 5)

Tg(mpx:eGFP) is a genetically edited zebrafish strain with fluorescent labeling of neutrophils. This zebrafish strain can be used to detect the location and intensity of inflammation in the fish body. Higher fluorescence intensity at a specific site indicates greater neutrophil aggregation and more severe local inflammation [47,48]. SLS can simulate skin aging by inducing the production of large amounts of inflammatory factors. This model is used to investigate whether FPS can reduce inflammation in zebrafish [49].

A higher degree of fluorescence intensity was observed in the model group as compared to the untreated control and the treatment group (Fig. 5A). Statistical analysis revealed that the presence of FPS significantly reduced the number of neutrophils (Fig. 5B). Meanwhile, the effectiveness increased as concentration of FPS was increased from 0.05 to 0.20 mg/mL of the treatment that the best performance (30.25) was given by FPS at the concentration of 0.20 mg/mL, followed by 31.375 for 0.10 mg/mL FPS and 34.625 for 0.05 mg/mL FPS (Fig. 5B).

Fig. 5.

FPS suppresses SLS-induced skin inflammation in zebrafish embryos. (A) Representative fluorescence images showing neutrophil recruitment (as a marker of inflammation) in zebrafish embryos. (B) Quantitative analysis of the relative fluorescence intensity corresponding to infiltrated neutrophils. Data are presented as mean ± SD. Statistical significance compared to the SLS-treated control group is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001. FPS, fermented Polygonatum sibiricum; SLS, sodium lauryl sulfate.

4. Discussion

PS, the dried rhizome of a species within the Liliaceae family, has a long history of dual use in both medicine and diet within Traditional Chinese Medicine, spanning over two millennia. Its diverse pharmacological effects are attributed to a rich composition of bioactive compounds, such as polysaccharides, saponins, polyphenols, and flavonoids. These constituents contribute to its demonstrated biological activities, including antioxidant, antitumor, anti-inflammatory, hypoglycemic, and hypolipidemic properties [23]. From the non-targeted metabolomic differential analysis, it can be observed that the content of indolelactic acid in FPS is significantly higher than that in PS as shown in Fig. 6 (Additional differential metabolites can be found in Supporting Information, sheet 2). Indolelactic acid is an indole metabolite produced by gut microbiota, particularly certain species of Lactobacillus and Bifidobacterium, through the metabolism of dietary tryptophan. Acting as an agonist of the aryl hydrocarbon receptor (AhR), its primary function revolves around the regulation of gene expression [39]. By modulating target genes, the indolelactic acid–AhR signaling pathway plays several crucial roles in the human body, including promoting the differentiation of regulatory T cells (Tregs). These cells are essential for suppressing excessive immune responses and maintaining immune tolerance, thereby helping to alleviate intestinal and systemic inflammation. Additionally, it inhibits the differentiation of pro-inflammatory T helper 17 (Th17) cells, thereby mitigating pathological responses associated with autoimmune diseases such as inflammatory bowel disease. Furthermore, it regulates the production of cytokines such as IL-22 and IL-10, which are vital for maintaining mucosal barrier integrity and immune homeostasis [50].

Fig. 6.

Metabolomics analysis of PS and FPS. Heatmaps of significantly altered metabolites with FPS v.s. PS under negative-ion modes. Color gradients in heatmaps indicate relative metabolite abundance (red = upregulated; blue = downregulated).

Previous studies have shown that PS is an effective medical herb that contains a series of compounds and provides a series bioactivities [14,51], which serve a function in skincare [52,53]. Fermentation technique has also been applied to improve the effectiveness of PS [23,54,55]. However, so far, no studies have been undertaken to evaluate the efficacy of FPS regarding its effects on UV-induced skin damage by employing zebrafish model. In the present study, the FPS provided a good performance that effectively ameliorated skin damage after UV irradiation in zebrafish model of skin oxidative stress. Our findings are in line with a recent study by Wang et al. who showed FPS has a significant antioxidant, anti-Inflammatory and whitening potential [54]. Likewise, our findings showed that FPS significantly ameliorated the detrimental effects of UV irradiation on fin size, which could be attributed to the presence of flavone as described by Taai et al. [56]. In addition, the results revealed that FPS significantly ameliorated oxidative stress caused by UV irradiation, showing a remarkable efficacy in skin treatment as described by Cui et al. [14,51]. The results of qPCR assay revealed that FPS ameliorated skin inflammation by regulating PPARγ/NF-κB/AP-1 pathway as described by Zhang et al. [33]. Besides, zebrafish model of inflammation induced by SLS was employed to further examine the effects of FPS on inflammation.

The notion that medical herb can be fermented to improve the biological activities has been around for a long time, also in the context of skincare [57]. Accumulating evidence substantiates the increased efficacy of fermented plant materials in skincare [12,58,59]. The improvement could be attributed to the increased bioactivities of plant materials, and the conversion of complex compounds into simpler forms during fermentation increased absorption of beneficial compounds through the epidermis, thereby improving the effectiveness of plant materials [10]. ROS production and antioxidant activity are crucial markers to show skin in response to environment. ROS is associated with a series of skin disorders that the exposure of skin to negative factors such as air pollution, UV may lead to ROS generation in skin, thereby causing skin aging and inflammation [60]. With regards to other antioxidant markers (SOD activity, MDA level, and CAT activity), SOD has a positive correlation with skin appearance which contributes to skin protection by eliminating O₂^•−, MDA is associated with lipid oxidation, and CAT scavenges ROS for skin [61]. In the present study, UV irradiation significantly decreased SOD and CAT activities and increased MDA level in zebrafish. The results suggested that the FPS can significantly ameliorate the detrimental effects of UV irradiation on zebrafish that presence of FPS significantly increased SOD and CAT activities and decreased MDA level in zebrafish after UV irradiation. Previous study has shown the direct evidence that UV can induce skin inflammation [62]. NF-κB pathway is highly associated with the maintenance of immune homeostasis in epithelial tissues and both activation and inhabitation of NF-κB will cause skin inflammation and skin damage [63]. AP-1 serve a function in the regulation of immune system [64]. Meanwhile, PPAR-γ can reduce inflammation by modulating signal transduction pathways [65]. It can be inferred from the results that FPS on inflammation can significantly ameliorate inflammation and have a great potential in cosmetics production.

Of course, this experiment also has some limitations. For instance, an accurate component analysis of FPS was not conducted to clarify its composition and active ingredients. In the future, based on the previously identified efficacy direction, we will further carry out quantitative research on the components of FPS. Based on our finding that FPS possesses significant lipid-lowering efficacy, which is superior to that of PS, this study did not directly compare the two in animal experiments, representing a certain limitation [23]. Future research will focus on identifying the specific components in FPS responsible for its anti-inflammatory and antioxidant activities, as well as elucidating their mechanisms of action. This will enable the development of more medicinal and edible traditional Chinese medicines utilizing fermentation technology.

5. Conclusions

In conclusion, this study collectively demonstrates that FPS confers significant protective effects against UV-induced skin damage in zebrafish models. FPS effectively attenuated oxidative stress by reducing ROS generation, enhancing endogenous antioxidant enzyme activities (SOD and CAT), and decreasing lipid peroxidation (MDA). Furthermore, it mitigated UV-triggered skin cell apoptosis and suppressed inflammatory responses, evidenced by reduced neutrophil recruitment in an SLS model and modulation of key genes within the PPARγ/NF-κB/AP-1 signaling pathway. These findings underscore that the fermentation process can enhance the bioactivity of PS, yielding a material with potent antioxidant, anti-apoptotic, and anti-inflammatory properties relevant to skincare.

Our results substantiate the potential of FPS as a promising natural ingredient for cosmetic and dermatological applications aimed at mitigating photoaging and inflammation. Future studies employing mammalian models and clinical trials are warranted to further elucidate the underlying mechanisms, confirm its efficacy and safety in higher organisms, and facilitate its translational development into novel skincare formulations.

Author contributions

Conceptualization, WC, XX; methodology, WC, CY, and ZZ; validation, XX; investigation, WC, CY, YF, ZZ, XX; resources, XX; data curation, CY, YF and ZZ; writing—preparation of the original project, WC, XX; writing—reviewing and editing, CY, ZZ and XX; visualization, ZZ; supervision, ZZ, XX. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.

Ethics approval and consent to participate

All zebrafish procedures followed the 3R principles (Replacement, Reduction, Refinement) and complied with GB/T 35892-2018 ethical guidelines, under approval from the Laboratory Animal Welfare and Ethics Committee. All zebrafish experiments were approved and met the ethical standards of the Institutional Review Board of the Laboratory Animal Ethics Committee, Center of Human Microecology Engineering and Technology of Guangdong Province (approval number: IACUC MC 1101-01-2024).

Declaration of AI and AI-assisted technologies in the writing process

During the preparation of this work the authors used Deepseek-R1 in order to check spell and grammar. After using this tool, the authors reviewed and edited the content as needed and takes full responsibility for the content of the publication.

Funding

This study was funded by 2023 Chizhou City major science and technology special project, China.

Declaration of competing interest

The authors declared no potential conflicts of interest with respect to the research.

Abbreviations

UV, Ultra Violet; PS, Polygonatum sibiricum; FPS, fermented Polygonatum sibiricum; ROS, reactive oxidative species; SOD, superoxide dismutas; MDA, malondialdehyde; CAT, catalase; SLS, sodium lauryl sulfate.

Appendix A. Supplementary data

The following are the Supplementary data to this article:

Data availability

All data generated or analysed during this study are included in this published article and its supplementary information files.