Effects of timing and morphology of blastomere cleavage on gene expression profiles of bovine in vitro fertilized embryos

Abstract

To efficiently produce high-quality bovine calves by transferring embryos obtained from in vitro fertilization (IVF), it is important to evaluate their ability to conceive and their ability to develop into normal litters. In this study, we aimed to clarify the effects of timing and morphology of blastomere cleavage on the gene expression status of bovine IVF embryos. Bovine IVF embryos were classified in four categories, which were divided according to the time of the first blastomere cleavage and the presence or absence of direct cleavage. In addition, the gene expression profiles of these embryos were examined. The timing and morphology of the blastomere cleavage was involved in pre-implantation development and gene expression status of bovine IVF embryos. Our results indicate the possibility of multiple evaluations for bovine IVF embryos and the selection of the most suitable embryos for embryo transfer.

The in vitro production (IVP) of bovine embryos is essential for promoting sire creation and calf production [1] . The use of ovum pick-up -in vitro fertilization (OPU-IVF) technology enables a more efficient production of bovine embryos than multiple ovulation and embryo transfer (MOET) programs [2]. However, the conception rate of bovine IVF embryos after embryo transfer (ET) is often lower than that of in vivo-derived (IVD) embryos [3,4,5]. Moreover, large-offspring syndrome, characterized by multiple pathologies, including increased birth weight and elevated perinatal mortality rate, is a serious problem in bovine IVP systems [6,7,8].

Normal calf productivity after ET is an important factor affecting the efficiency of bovine IVP systems, and various studies have been conducted on these developmental anomalies in IVF embryos [5]. Although bovine IVF embryos have various characteristics in terms of morphology [9], developmental kinetics [10], metabolism [11], and chromosomal aneuploidy [12], abnormalities in gene expression status have been identified as significant causes of aberrations in bovine IVF embryos [13, 14]. In our recent study, we reported a method for the expression profiling of 11 genes (IGFBP-2, IGFBP-3, AQP3, OCT-4, SOX2, FGF4, NANOG, TEAD4, CDX2, GATA3, and IFNT) involved in early development and implantation in individual bovine embryos, revealing the specificity of the expression profiles of the genes in bovine blastocyst embryos obtained from IVF procedures [15]. Our results demonstrated the possibility of evaluating the functionality and viability of bovine IVF embryos based on their gene expression status at the blastocyst stage.

On the other hand, Sugimura et al. showed that the timing and morphology of blastomere cleavage in bovine IVF embryos are associated with their quality and viability [16, 17]. Thus, (i) timing of the first cleavage, (ii) blastomere number at the end of the first cleavage, (iii) presence or absence of multiple fragments at the end of the first cleavage, and (iv) blastomere number at the onset of the lag-phase reflect bovine blastocyst quality and viability after ET [16]. Based on recent evidence that gene expression status influences the functionality and viability of bovine IVF embryos, we hypothesized that there is a relationship between blastomere cleavage status and gene expression in bovine pre-implantation embryos obtained from IVF procedures. Therefore, this study aimed to clarify the effects of timing and morphology of blastomere cleavage on the gene expression status of bovine IVF embryos.

Materials and Methods

Chemicals

All chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless stated otherwise.

Oocyte collection and in vitro maturation (IVM)

Cow ovaries were collected at a local slaughterhouse and transported to the laboratory at 38°C. Cumulus-oocyte complexes (COCs) were aspirated from follicles of 2–8 mm in size. Ten bovine COCs were matured in a 100 μl drop of IVMD-101 medium (Research Institute for the Functional Peptides, Yamagata, Japan). IVM was performed at 38.5°C in a humidified atmosphere containing 5% CO₂ in air for 20 h.

In vitro fertilization (IVF)

After in vitro maturation, COCs were fertilized in IVF-100 medium (Research Institute for the Functional Peptides). Cryopreserved semen was thawed, and sperm were washed twice by centrifugation (at 1800 rpm for 5 min) in IVF medium. Sperm were resuspended in IVF medium at a final concentration of 5.0 × 10⁶/ml. Fifteen to twenty COCs were placed into each sperm suspension drop. COCs and sperm were incubated for 6 h at 38.5°C in a humidified atmosphere containing 5% CO₂ in air.

In vitro culture (IVC)

After IVF, the embryos were cultured in a modified TALP (mTALP) medium [18] with 0.1% BSA. The mTALP medium with 0.1% BSA (125 μl) was placed within the circular wall of microwell culture dish (LinKID Micro 25, Dai Nippon Printing Co., Ltd., Kashiwa, Japan) and covered with paraffin oil. Twenty-five embryos were placed in the microwells of culture dish (one embryo per microwell). IVC was performed at 38.5°C in 5% O₂, 5% CO₂, and 90% N₂ with saturated humidity for 168 h.

Classification of embryos

The developmental status of embryos was observed and photographs of the embryos were taken at 20, 27, 55, 72, 96, 120, 144, and 168 h after insemination. In vitro cultured embryos were separated into four categories [16, 19]: (1) the first cleavage was completed within 27 h of the start of insemination (Cat. 1); (2) with two blastomeres at 27 h of the start of insemination, alternatively, with two blastomeres at the 20 h of the start of insemination and three or more blastomeres at 27 h of the start of insemination (Cat. 2); (3) multiple fragmentation (Supplementary Fig. 1) was not observed at 27 h after insemination (Cat. 3), (4) the number of blastomere in embryo was 6 or more (including 8-cell and 16-cell stage embryos) at 55 h after insemination (Cat. 4).

Production of IVD embryos

Donor cattle (Japanese Black) used for IVD embryo production were maintained at the Animal Research Center, Hokkaido Research Organization. Controlled internal drug release devices (CIDR^®1900, Zoetis Japan, Tokyo, Japan) were inserted into donor vagina during any stage of the estrous cycle. After 4 days, 1 mg of estradiol benzoate (Eb; Kyoritsu Seiyaku, Co., Ltd, Tokyo, Japan) was administered to each cow. Starting 4 days after Eb injection, follicle-stimulating hormone (FSH; Antrin^®-R10, Kyoritsu Seiyaku) was injected intramuscularly to each cow twice daily in decreasing doses for 3 days until a total dose of 20 A.U. was reached. The CIDR was removed 48 h after FSH treatment initiation, and prostaglandin F2α (cloprostenol 0.5 mg/cow; Resipron^®-C, ASKA Animal Health Co., Ltd, Tokyo, Japan) was injected intramuscularly to induce luteolysis. The donor cows were artificially inseminated (AI) 24 h after estrus onset or approximately 16 h after the injection of a GnRH agonist (Fertirelin acetate at 100 μg/cow; CONCERAL, MSD Animal Health Co., Ltd, Tokyo, Japan) using frozen-thawed semen from a Japanese Black sire. The blastocysts were non-surgically recovered by uterine flushing using balloon catheters (Fujihira Industries, Co., Ltd., Tokyo, Japan) on days 7.5–8 (AI = Day 0). The recovered blastocysts were classified according to the International Embryo Technology Society (IETS) manual [20]. Only the embryos at the expanded blastocyst stage with IETS Code 1 were considered IVD embryos.

RNA extraction and whole transcriptome amplification (WTA)

RNA extraction and WTA were performed as previously described [15]. The zona pellucida of expanded blastocysts was manually removed using a micromanipulator equipped with a microblade (Feather Safety Razor, Osaka, Japan). RNA extraction and WTA were performed using the REPLI-g WTA Single Cell Kit (QIAGEN, Hilden, Germany) according to the manufacturer's instructions. For RNA extraction, zona-free embryos were individually collected into 0.2 ml tubes containing 7 μl PBS (Thermo Fisher Scientific, Waltham, MA, USA) and 4 µl lysis buffer (built into the kit) was added. Thereafter, the samples were snap-frozen in liquid nitrogen and stored at –80°C until WTA. After WTA, amplified cDNA was diluted 1:100 with RNase-free water (Qiagen) and stored at –30°C.

Quantitative real-time PCR

Real-time PCRs were performed using a QuantStudio 3 Real-Time PCR system (Applied Biosystems, Tokyo, Japan), and the products were detected using SYBR Green included in the QuantiTect SYBR Green PCR Master Mix (Qiagen). A 2 µl aliquot of the RT product was used for each quantification. The amplification program was as follows: preincubation at 95°C for 15 min to activate HotStarTaq DNA Polymerase (Qiagen), followed by 45 cycles of denaturation at 94°C for 15 sec, annealing of primers at different temperatures (Table 1) for 30 sec, and elongation at 72°C for 30 sec. After the end of the last cycle, a melting curve was generated by starting fluorescence acquisition at 60°C and recording measurements at 0.3 increments up to 95°C.

Table 1. Primers sequences for quantitative real-time PCR.

Genes	Primer sequences (5′-3′)*	Annealing temperature (°C)	Fragment size (bp)	GenBank accession no.
GAPD	F- TTCAACGGCACAGTCAAGG	62	119	XM_618013
	R- ACATACTCAGCACCAGCATCAC
SDHA	F- GCAGAACCTGATGCTTTGTG	60	185	NM_174178.2
	R- CGTAGGAGAGCGTGTGCTT
YWHAZ	F- GCATCCCACAGACTATTTCC	60	120	BM446307.1
	R- GCAAAGACAATGACAGACC
IGFBP-2	F- ACTGTCACAAGCATGGCCTG	56	168	AF074854
	R- CCTCCTGCTGCTCATTGTAGA
IGFBP-3	F- ACTTCTCCTCTGAGTCCAAGC	56	210	NM_174556.1
	R- CGTACTTATCCACACACCAGC
AQP3	F- GCACAAGGAGCAGATGTGAA	59	209	NM_001079794
	R- TACAGGCTGAAGGTCCTGCT
OCT-4	F- GGTTCTCTTTGGAAAGGTGTTC	52	314	NM_174580.3
	R- ACACTCGGACCACGTCTTTC
SOX2	F- TCAGATGCAGCCCATGCAC	60	121	NM_001105463.1
	R-GGTGCCCTGCTGAGAATAGGAC
FGF4	F- TTCTTCGTGGCCATGAGCAG	52	206	NM_001040605
	R- AGGAAGTGGGTGACCTTCAT
NANOG	F- AATTCCCAGCAGCAAATCAC	55	215	DQ069776
	R- CCCTTCCCTCAAATTGACAC
TEAD4	F- AAGTTCTGGGCAGACCTCAA	60	249	XM_010827947
	R- GTGCTTCAGCTTGTGGATGA
CDX2	F- AGTGAAAACCAGGACGAAAGA	60	142	NM_001206299.1
	R-CTCTGAGAGCCCCAGCGT
GATA3	F- ATGAAACCGAAACCCGATGG	60	185	NM_001076804
	R- TTCACAGCACTAGAGAGACC
IFNT	F- GCAGTGCTTCAACCTCTTCC	62	155	NM_001168279.1
	R-TCCTTCCCATGTCAGAGTCC

^*F, forward; R, reverse.

A standard curve was generated for each amplicon by amplifying serial dilutions of known quantities. The PCR products for each gene were purified using a QIAquick PCR Purification Kit (Qiagen), quantified by measuring the absorbance at 260 nm using a NanoDrop (Nano Drop One; Thermo Fisher Scientific), and diluted. Serial 10-fold dilutions were amplified in every real-time PCR run to create a standard curve. The standards and cDNA samples were co-amplified in the same reaction prepared from the master mix. Fluorescence was acquired at each cycle to determine the threshold cycle or the cycle during the log-linear phase of the reaction at which fluorescence increased above the background for each sample. Final quantification was performed using the QuantStudio 3quantification software. The expression of the target gene in each run was normalized to that of the internal standard, GAPD, SDHA, and YWHAZ.

Gene expression profile of individual IVF and IVD embryos

Relative mRNA levels of IGFBP-2, IGFBP-3, AQP3, OCT-4, SOX2, FGF4, NANOG, TEAD4, CDX2, GATA3 and IFNT were determined, as previously described [15]. Gene expression levels in individual embryos were classified into three groups (low, medium, or high) using the quartile of relative mRNA abundance of each gene in IVF embryos that matched for all four categories, matched for 3 or less categories and IVD embryos. Embryos with a relative mRNA abundance smaller than the first quartile, intermediate, or larger than the third quartile were classified as having low, medium, or high expression, respectively. For each target gene, the proportion of embryos classified as having low, medium, or high expression was compared among different embryo groups.

Statistics analysis

The percentage data for embryo development were subjected to arcsine transformations. The transformed values and relative abundance values of mRNA expression were analyzed using one-way analysis of variance (ANOVA) or the Kruskal-Wallis test, followed by multiple pairwise comparisons using the Scheffé or Steel-Dwass method. A P value less than 0.05 denoted a statistically significant difference.

Results

Effect of timing and morphology of blastomere cleavage on preimplantation development of bovine IVF embryos

In the present study, 561 embryos obtained via IVF were cultured. The matching rates for Cat. 1, Cat. 2, Cat. 3, and Cat. 4 were 80.2, 65.4, 90.0, and 62.0%, respectively. The rate of embryos matching all four categories was 42.8%. The matching rates for Cat. 1, Cat. 2, Cat. 3, Cat. 4, and all four categories of embryos that developed to the blastocyst and expanded blastocyst≤ stage (total 184 embryos) were 94.6, 84.2, 91.8, 86.4 and 67.9%, respectively.

We examined the relationship between blastomere cleavage status on the early development of bovine embryos obtained from IVF (Table 2). Table 2 shows the final developmental stages of the bovine IVF embryos that matched each category. IVF embryos that failed to develop to the 16-cell stage had a significantly (P < 0.05) lower Cat. 4 and all four categories matching rates (20.7 and 15.8%, respectively), compared to Cat. 1, Cat. 2, and Cat. 3 (31.8–41.8%). In contrast, the matching rates of all four categories matched in embryos that developed to the blastocyst (39.1%) were significantly (P < 0.05) higher than Cat.1 and Cat.3 matched in embryos (30.2% and 26.3%, respectively).

Table 2. Effect of timing and morphology of blastomere cleavage on preimplantation development of bovine IVF embryos *.

Cat.	Total	Final stage of embryos
		16-cell >	16 to 32-cell	Morula	Blastocyst	Expanded blastocyst ≤
Cat.1	450	143 (31.8) b	23 (5.1)	105 (23.3)	136 (30.2) b	43 (9.6)
Cat.2	367	118 (32.1) b	15 (4.1)	81 (22.1)	112 (30.5) ab	41 (11.2)
Cat.3	505	211 (41.8) a	20 (4.0)	103 (20.4)	133 (26.3) b	38 (7.5)
Cat.4	348	72 (20.7) c	22 (6.3)	93 (26.7)	119 (34.2) ab	42 (12.1)
All Cat. matched	240	38 (15.8) c	10 (4.2)	64 (26.7)	94 (39.1) a	34 (14.2)

* Experiments were replicated eight times. Cat.1, the first cleavage was completed within 27 h of the start of insemination; Cat.2, with two blastomeres at 27 h of the start of insemination, alternatively, with two blastomeres at the 20 h of the start of insemination and three or more blastomeres at 27 h of the start of insemination; Cat.3, no Multiple Fragmentation at 27 h of insemination; Cat.4, at least 6-cell at 55 h of insemination. ^{a, b, c} Values with different superscription within each column differ significantly (P < 0.05).

Effect of timing and morphology of blastomere cleavage on gene expression in bovine IVF embryos

We evaluated the gene expression status of bovine IVF embryos at the blastocyst stage that matched all four categories or matched for 3 or less categories (Figs. 1–3). The transcripts of genes related to functions for inner cell mass (ICM, Fig. 1), trophectoderm (TE, Fig. 2), metabolism, and molecular transmission (Fig. 3) were analyzed. OCT-4 (Fig. 1A) and TEAD4 (Fig. 2B) transcript levels in embryos that matched all four categories were significantly (P<0.05) higher than that in embryos that matched 3 ≥ categories and IVD embryos. In contrast, FGF4, NANOG, CDX2, and GATA3 expression levels in IVF embryos, regardless of category match status were significantly (P < 0.01 or < 0.05) lower than those in IVD embryos (Fig. 1B, C and Fig. 2A and C, respectively). There were no differences in SOX2, IFNT, IGFBP-2, -3, and AQP3 transcript levels among the three embryo groups (Figs. 1D, 2D, and Figs. 3A, B, and C, respectively).

Fig. 1.

Relative abundance (mean ± SEM) of (A) OCT-4, (B) FGF4, (C) NANOG and (D) SOX2 transcripts at the all 4 categories matching, 3 ≥ categories matching, or in vivo-derived (IVD) embryos (n=12). ^{a, b} Different characters indicate a significant difference (P < 0.01 or 0.05).

Fig. 3.

Relative abundance (mean ± SEM) of (A) IGFBP-2, (B) IGFBP-3 and (C) AQP3 transcripts at the all 4 categories matching, 3 ≥ categories matching, or IVD embryos (n = 12).

Fig. 2.

Relative abundance (mean ± SEM) of (A) CDX2, (B) TEAD4, (C) GATA3 and (D) IFNT transcripts at the all 4 categories matching, 3 ≥ categories matching, or IVD embryos (n = 12). ^{a, b} Different characters indicate a significant difference (P < 0.01 or 0.05).

Gene expression profiling via WTA of bovine IVF embryos

In this study, gene expression profiling using WTA was performed on individual bovine IVF embryos that matched all four categories or matched for 3 or less categories (Fig. 4). In individual IVD embryos, there were no embryos with four or more genes classified as low (Fig. 4C), whereas there were three embryos matching all four categories (Fig. 4A), or five embryos matching 3 or less categories (Fig. 4B). Furthermore, embryos with six and nine genes classified as low were found among the IVF embryos that matched 3 or less categories (Fig. 4B).

Fig. 4.

Gene expression profile in individual bovine embryos (A: all 4 categories matching, B: 3 ≥ categories matching, C: in vivo derived (IVD). Each gene expression level in an individual embryo was classified using the quartile of relative abundance of each gene in A, B and C embryos. The embryos with relative abundance smaller than the first quartile, intermediate, or larger than the third quartile ware classified as having low (gray box), medium (open box), or high (black box) expression, respectively. In FGF4 mRNA analysis, non-specific PCR products were detected in 3 IVF embryos. Therefore, these samples were excluded from analysis (diagonal lines). The number of genes classified as low, medium, or high expression in each embryo is shown.

Discussion

Although aberrant expression of various genes regulating early embryonic development, implantation, and fetal development has been reported in bovine IVF embryos, there is limited information on the accumulation of aberrant gene expression in individual embryos and the characteristics of genes with abnormal expression. This study aimed to clarify the relationship between the gene expression profiles of individual bovine IVF embryos using the WTA method and the morphology of blastomeres cleavage in bovine IVF embryos.

Sugimura et al. [16] reported that in terms of the timing and morphology of bovine IVF embryos, when the timing of the first blastomere cleavage was earlier, the percentage of diploid embryos was high. Furthermore, when the embryo was divided directly from the 1-cell stage to 3 or more cells (direct cleavage), the percentage of diploid embryos decreased, and the proportion of embryos showing chromosomal abnormalities was higher [16]. It has also been reported that bovine IVF embryos with normal blastomere cleavage exhibit the fusion of two pronuclei, whereas direct cleavage embryos have three or more pronuclei and a higher percentage of embryos without pronuclei fusion [17]. Ploidy abnormalities in IVF embryos may be directly related to chromosome number, and thus, are likely to be the cause of early developmental loss, implantation failure, and abortions in bovine IVF embryos. In the present study, the times of the first blastomere cleavage and direct cleavage were evaluated using Cat. 1 and Cat. 2, respectively. Interestingly, among the embryos that matched Cat. 1, the proportion of embryos that developed to the blastocyst stage was lower than that of embryos that matched all four categories. In contrast, the developmental ability of the embryos that matched Cat. 2 showed no difference from embryos that matched all four categories. These results indicate the importance of the direct cleavage status in influencing the early development of bovine IVF embryos, such as the timing of the first cleavage and the direct cleavage combined to affect early development in bovine IVF embryos.

In this study, the match rates for Cat. 1, Cat. 2, Cat. 3, and Cat. 4 among embryos that developed to the blastocyst stage were high. Since bovine IVF embryos are generally transferred at the blastocyst stage, our results indicate that most embryos used for embryo transfer met the individual criteria for the timing and morphology of oocyte division. These data show that considering pregnancy rates and normal fetal development following the embryo transfer of bovine IVF embryos, it may be important to evaluate IVF embryos using multiple categories. In previous studies [16, 19], Cat. 2 was defined as the first cleavage occurring within 27 h after insemination and cleaved from 1-cell to 2-cell without direct cleavage, and directly cleaved from 1-cell to 3-cell or more. However, this study did not use ime-lapse cinematography (TLC), and instead employed alternative criteria to assess the presence or absence of direct cleavage. Although most Cat. 2 embryos have not undergone direct cleavage, more precise determination requires observation using a TLC.

In the present study, three distinct patterns were observed in the relationship between individual gene expression levels and the timing and morphology of blastomere cleavage in bovine IVF embryos. In the first group (OCT-4 and TEAD4), the gene expression levels in blastocyst stage embryos that met all four categories were higher than those in embryos that met three or fewer categories. The gene expression levels of FGF4, NANOG, CDX2, and GATA3 were lower in IVF embryos than in IVD embryos and did not increase regardless of the number of matched categories. The third group (the remaining five genes) included genes whose expression levels did not differ between IVF and IVD embryos. Sugimura et al. [16] reported that IGF2R and IFNT expression levels were elevated in bovine IVF embryos that were cleaved early, and IFNT expression level in normal blastomere cleavage embryos that did not undergo direct cleavage were not abnormal. We have shown that OCT-4 and TEAD4 are essential factors for the differentiation of the inner cell mass (ICM) and trophectoderm in bovine embryos [21], and this study reveals that the timing of blastomere cleavage and its morphology are involved in the expression of these important factors.

In our previous study [15], the gene expression profile of bovine IVF embryos using WTA methods developed independently shows an accumulation of low-expressed genes compared to IVD embryos. In the present study, we found through gene expression profiling, that the accumulation of low-expressed genes was observed in embryos matching with three or fewer categories, whereas the accumulation of low-expressed genes was reduced in embryos matching all four categories. Our results indicate that, the timing of blastomere cleavage and its morphology influence the gene expression profiles of individual bovine IVF embryos.

This study demonstrated that the timing of blastomere cleavage and the morphology of bovine IVF embryos are involved in pre-implantation development and gene expression profiles of embryos. However, the timing and morphology of blastomere cleavage remain unclear regarding the mechanisms controlling gene expression in bovine IVF embryos. Therefore, further investigation, such as DNA methylation and histone modification analyses, are required. These findings combined with our results will contribute to calf production using bovine IVF technology.

Conflict of interests

The authors have nothing to declare.