The expression and mechanism of action of ADAMTS18 in endometrial cancer

Abstract

We aimed to measure ADAMTS18 expression in endometrial carcinoma (EC), atypical hyperplasia (AH), and normal endometrium, and determine its biological role in EC. Retrospectively, we analyzed clinicopathological data of the following groups: EC group (n = 64, endometrioid adenocarcinoma), AH group (n = 55), and control group (CON, n = 64, normal). ADAMTS18 expression was detected via immunohistochemical staining/immunofluorescence assay. Ishikawa EC cells were used in the following groups: ADAMTS18 group (overexpression plasmid), CON group (untreated), and NC group (null plasmid). The effects of ADAMTS18 on cell proliferation (CCK-8), migration/invasion (Transwell), and apoptosis (TUNEL) were assessed. ADAMTS18 expression was the lowest in the EC group and the highest in the CON group (P < 0.05). In Ishikawa cells, compared to the NC/CON groups, ADAMTS18 overexpression significantly decreased cell proliferation (after 72 h and 96 h), migration, and invasion, and enhanced cell apoptosis (all P < 0.05). Low ADAMTS18 expression was correlated with higher FIGO stage (≥ III) and larger tumor diameter (≥ 2 cm) in EC. ADAMTS18 downregulation was correlated with the poor prognosis of EC and suppressed tumor proliferation/invasion in vitro. ADAMTS18 overexpression modulated the behavior of EC cells by inhibiting their proliferation, invasion, and migration, and promoting their apoptosis. Functioning as a tumor suppressor, ADAMTS18 is a potential therapeutic target in EC.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10735-026-10737-y.

Introduction

EC is the sixth most common malignant tumor worldwide, with an increasing incidence in both Eastern and Western countries (Bray et al. 2024; Manule et al. 2023; Chen et al. 2022). In Europe and the United States, EC is ranked first among gynecologic malignant tumors, and the incidence of EC in China has increased to second place. The rejuvenation trend is mainly prominent in 14% of new cases in developed cities (Zheng et al. 2022). Although the 5-year survival rate of patients with early-stage EC can reach 74%-91%, the survival rate of advanced-stage metastatic cases is roughly 20% (Roškar et al. 2021), emphasizing the importance of early diagnosis. Atypical hyperplasia (AH), a precancerous lesion of EC, has a 50% risk of progressing to EC, which is significantly higher than that of benign endometrial hyperplasia (BEH), with a 5% risk of progression to EC (Raffone et al. 2021; Pandey and Yonder 2025). Although abnormal uterine bleeding is the main clinical manifestation of AH (Ring et al. 2022), nearly 30% of patients show asymptomatic and insidious progression (Ancheta et al. 2003). The existing diagnostic system relying on histopathological analysis cannot achieve accurate risk stratification (Hui et al. 2021), and there is an urgent need to establish effective molecular markers for early assessment.

The A disintegrin and metalloproteinase with thrombospondin motifs (ADAMTS) family, as multi-structural domain metalloproteinases, play dual roles in carcinogenesis by regulating extracellular matrix remodeling, angiogenesis, and tumor microenvironment (Apte 2009; Théret et al. 2021). Among them, ADAMTS18 has attracted much attention due to its tissue-specific functional differences in most solid tumors, such as esophageal adenocarcinoma, nasopharyngeal carcinoma (Jin et al. 2007), lung cancer (Zhang et al. 2019), colorectal cancer (Lu et al. 2017), breast cancer (Xu et al. 2017), cervical cancer (Zhang et al. 2018), and clear cell renal cell carcinoma (Xu et al. 2015). ADAMTS18 exerts oncogenic effects through anti-angiogenic and pro-apoptotic mechanisms, and its low expression is significantly correlated with tumor progression and poor prognosis; however, ADAMTS18 exhibits pro-cancer properties in gastric adenocarcinoma and pancreatic adenocarcinoma (Xu et al. 2015; Li et al. 2020), suggesting that its functions widely vary in different types of cancer. Previous studies have suggested that downregulation of ADAMTS18 expression in EC is correlated with increased tumor volume and progression of the FIGO stage (Zhang et al. 2018), but its expression dynamics, functional mechanism, and prognostic value in precancerous stages still remain unclear.

In this study, we systematically elucidated the biological function and clinical significance of ADAMTS18 in the development of EC by integrating multidimensional research strategies. Firstly, we employed immunohistochemical staining and quantitative PCR to measure the expression of ADAMTS18 in normal endometrial tissues, AH, and EC. Secondly, we constructed an ADAMTS18 overexpression EC cell model and investigated the regulatory mechanisms of ADAMTS18 in cell proliferation, migration, and apoptosis through functional experiments. Finally, we analyzed the correlation between ADAMTS18 expression level and the risk of lesion progression based on prospective cohorts. Our results provide novel molecular markers for the early diagnosis of EC and offer a theoretical basis for the stratified diagnosis and treatment of EC, which can help advance precision medicine for EC.

Methods

Tissue specimens

One hundred and eighty-three patients who underwent hysteroscopic curettage or total hysterectomy for abnormal uterine bleeding or postmenopausal bleeding at our hospital from January 2021 to December 2023 were included in this study and were divided into three groups based on postoperative pathological diagnosis: normal endometrial CON group (64 patients), AH group (55 patients), and EC group (64 patients). All surgeries were conducted following the standards of the International Federation of Gynecology and Obstetrics (FIGO Uterine Cancer Staging System, 2009). No hormonal drugs were administered to the enrolled patients. Patients with polycystic ovarian syndrome, coexisting ovulation abnormalities causing irregular menstruation, other malignant tumors, and autoimmune diseases were excluded. No radiotherapy or chemotherapy was conducted. Endometrial paraffin specimens were stored in a refrigerator at − 80 °C. Clinical data, such as age, BMI, tumor stage, and other medical data, were retrospectively collected through an electronic medical record system. Follow-up was conducted at 6 and 12 months postoperatively in the AH group. This study was approved by the Ethics Committee of Jinan Maternity Child Careand Hospital(Approval No. IRB KY-23–68).

Cells

The human endometrial cancer cell line Ishikawa was purchased from the tumor cell bank of the Chinese Academy of Sciences and was cultured in a medium containing 10% fetal bovine serum at 37℃ and 5% CO₂. The ADAMTS18 overexpression plasmid (Ishikawa-ADAMTS18) and the empty vector control were synthesized by GeneCopoeia. The primary antibody rabbit-derived ADAMTS18 was purchased from Three Eagles, and the secondary antibody CY3-labeled goat anti-rabbit IgG was purchased from Servicebio.

Immunohistochemical staining

Formalin-fixed-paraffin-embedded tissue sections were routinely dewaxed, hydrated, and subjected to EDTA-mediated high-temperature antigen repair and microwave antigen repair. The sections were sealed with 3% H2O2 and 10% rabbit serum, respectively. ADAMTS18 primary antibody working solution was prepared with PBS solution at a ratio of 1:200, covering the tissue sections, shaking at 4 °C, and incubating overnight. Pure PBS was used to replace the primary antibody working solution in the negative control group. The negative control group used pure PBS instead of a primary antibody working solution. After washing the unconjugated primary antibody with PBS solution, the corresponding primary antibody was conjugated with HRP-labeled goat anti-rabbit IgG secondary antibody, and the positive protein was visualized using the DAB method. The cell nuclei were restained with hematoxylin, dehydrated, and sealed. Staining was scored based on the intensity of staining in positive cells and the ratio of stained cells. The final staining score was calculated based on staining intensity and the percentage of stained cells.

Immunofluorescence

Formalin-fixed-paraffin-embedded tissue sections were deparaffinized, hydrated, and microwaved for antigenic repair. The sections were blocked with 3% BSA and 10% donkey serum, respectively. The ADAMTS18 primary antibody working solution was prepared with PBS solution at a ratio of 1:200. The tissue sections were covered, shaken at 4 °C, and incubated overnight, while pure PBS was used in the negative control group instead of the primary antibody working solution. After washing the unconjugated primary antibody with PBS solution, the corresponding primary antibody was conjugated with CY3-labeled goat anti-rabbit IgG secondary antibody. The cells were imaged under a confocal laser scanning microscope (PerkinElmer, USA) after staining with DAPI for 5 min.

Establishment of stable cell lines

Neofect™ transfection reagent (GeneCopoeia) was used to construct the ADAMTS18 overexpression model, and the ADAMTS18 overexpression plasmid (CV702 vector) or empty vector plasmid (3 μg/well) was mixed with Opti-MEM medium and incubated at room temperature for 20 min to form DNA-transfection reagent complexes. The cells were inoculated in 12-well plates at a density of 8 × 10⁴ cells/well 24 h before transfection. When the fusion reached 50%–60%, the medium was replaced with fresh medium and the transfection complex was added. The cells were collected 72 h after transfection, and RT-PCR and Western blotting showed that ADAMTS 18 was stably expressed in Ishikawa cells.

qRT-PCR

The total RNA of Ishikawa cells was extracted using TRIzon reagent, and cDNA was synthesized using a reverse transcription kit (HiFiScript, containing gDNA removal function). cDNA was diluted tenfold, and 5 μl of cDNA was used to prepare a real-time fluorescence quantitative PCR system. PCR reaction was conducted with the following conditions: pre-denaturation for 3 min at 95 °C; 40 cycles (95 °C for 5 s, 60 °C for 30 s); lysis curve analysis (94 °C for 30 s, 60 °C for 90 s); dissolution curve analysis (94 °C 30 s, 60 °C 90 s). GAPDH was used as the internal reference. The primers for the internal reference gene and target gene were designed by Shandong Jiekai Biotechnology Co. and synthesized by Jinwei Zhi (Table 1). The relative expression of ADAMTS18 mRNA was calculated using the 2^− ΔΔCt method.

Table 1.

Primer design details table

Primer ID	Sequence (5' → 3')
ADAMTS18(99,399–2)-p1	CACACTGGACTAGTGGATCCCGCCACCATGGAGTGCGCCCTCCTGCTCGCGTGTG
ADAMTS18(99,399–2)-p2	CCTTGTAGTCACTTAAGCTTGGGATCTTCCTTGTGCATGACTTGCAGCATTG

Western blotting

After 48 h of cell culture in the ADAMTS18 and NC groups, the waste liquid was discarded, and the lysate was washed with PBS three times and then added to the lysate, mixed thoroughly, lysed on ice for 30 min, and then centrifuged at 12,000 r/min for 10 min. Then, the protein supernatant was collected. The protein concentration was measured using the BCA method. 50 μg of protein was added to each well, and the initial electrophoresis was conducted at 80 V, which was later changed to 120 V. The protein was transferred to the membrane for 90 min at a constant flow of 100 mA at 4 ℃. The membrane was incubated in 5% skimmed milk powder for 2 h. Thereafter the protein was incubated with the primary antibody (1:1000, overnight at 4 ℃) and secondary antibody (1:20,000, 90 min at 37 ℃). The color was developed using the ECL color kit, considering β-actin as the internal reference. β-actin was used as the internal reference, and the expression of target protein was analyzed using Image J software.

Cell proliferation assays

Ishikawa cells were inoculated in 96-well plates with 5 × 103 cells/well, and 100 μL of the culture medium was added to the culture for 24 h. The cells were transfected with NC (control) and ADAMTS18, respectively. After transfection for 0 h, 24 h, 48 h, and 72 h, 10 μL of CCK-8 was added to each well, and the cells were placed in a 37 °C incubator with a volume fraction of 5% CO₂ for 2 h. The optical density was detected at 450 nm.

Transwell assay

Transwell chambers were used to measure cell migration and invasion. For cell migration, cells stably expressing ADAMTS 18 were inoculated at 1 × 104 cells/well in the upper chamber containing 100 μl of serum-free medium, while 800 μl of the medium containing 10% FBS was added to the lower chamber. Cells in the upper chamber were incubated for 48 h and wiped off after fixation and staining. Migrating cells in the lower chamber were captured and counted using a microscope. Five fields of view at 400 × magnification were randomly selected. For invasion, a matrix gel barrier was pre-added to the upper chamber following the manufacturer’s instructions, and then 1 × 104 cells/well were cultured in the upper chamber. Subsequent steps were similar to the migration assay described above.

TUNEL assay

Formalin-fixed paraffin-embedded tissue sections were deparaffinized and rehydrated using standard protocols. After 72 h of transfection, Ishikawa cells were washed twice with cold PBS and incubated with a proteinase K solution for 15 min. Subsequently, 50 μL of TdT labeling reaction buffer was added to each sample and incubated at 37 °C for 2 h. After three washes with PBS, the cells were stained with DAPI. Finally, the samples were observed and photographed using a fluorescence microscope.

Statistical analysis

All statistical analyses were conducted using Statistical Package for the Social Sciences version 20.0 (SPSS. Chicago, IL, USA). Data are expressed as Mean ± SD. The groups were compared using student’s t-test. P < 0.5 was considered significant.

Results

ADAMTS18 expression levels in normal tissue, endometrial AH tissues, and EC tissue samples

ADAMTS18 protein was detected in all normal endometrial tissues, endometrial AH tissues, and EC tissues. The expression level of ADAMTS18 showed a gradual decrease from the normal endometrium group to the precancerous lesion group and further to the tumor group, with significant differences observed among normal endometrial tissues, endometrial AH tissues, and EC tissues (P < 0.01 and P < 0.001) (Fig. 1A). The protein expression level of ADAMTS18 was significantly higher in EC tissues than in endometrial AH tissues (P < 0.05). Meanwhile, the differential expression of ADAMTS18 among the three groups was further visualized using fluorescence immunoassay (Fig. 2).

Fig. 1.

Immunohistochemical staining of normal endometrial tissues, endometrial hyperplasia tissues, and endometrial cancer tissues with ADAMTS18 and its quantitative analysis (Bar = 100 μm)

Fig. 2.

Fluorescence immunoassay in normal endometrial tissue, endometrial hyperplasia tissue, and endometrial cancer tissue (Bar = 500 μm)

Association of ADAMTS18 expression with the clinicopathological features of EC

The median expression value of ADAMTS18 in immunohistochemical staining in 64 EC tissues was used as a cut-off point, and the patients were divided into a high-expression group (n = 21) and a low-expression group (n = 43). The correlation between ADAMTS18 expression and its clinical parameters was analyzed. The results showed that low ADAMTS18 protein expression was correlated with higher FIGO stage (≥ stage III) and larger tumor diameter (≥ 2 cm) (*P < 0.05, **P < 0.001). There was no significant correlation between ADAMTS18 expression and age, BMI, history of hypertension, and history of diabetes mellitus (P > 0.05) (Table 2).

Table 2.

Relationship between ADAMTS18 expression and clinicopathologic parameters in endometrial cancer tissues

Clinical characteristics	n	ADAMTS18 relative expression levela
		Low expression (n = 43)	High expression (n = 21)	X2	P
Ageb				0.007	0.934
≤ 55	30	20	10
≥ 56	34	23	11
BMI				3.108	0.078
< 28	43	32	11
≥ 28	21	11	10
Hypertension				0.071	0.790
Yes	32	21	11
No	32	22	10
Diabetes				0.496	0.481
Yes	14	11	3
No	50	32	18
Tumor size				11.997	< 0.001**
< 2 cm	51	40	11
≥ 2 cm	13	3	10
TNM stagec				3.969	0.046*
I + II	50	30	20
III + IV	14	13	1

BMI, body mass index. ^aBased on the mean value. ^bBased on the median. ^cBased on the FIGO endometrial cancer classification (2009).

The asterisks indicate levels of statistical significance for the reported results: A single asterisk (*) denotes P < 0.05 P<0.05, meaning the result is statistically significant at the 5% level. Double asterisks (**) denote P < 0.001 P<0.001, meaning the result is statistically significant at the 0.1% level (a higher threshold of significance)

Construction and validation of ADAMTS18-overexpressing stable cell lines

EC cell lines overexpressing ADAMTS18 were constructed by transfecting plasmids, while blank plasmids were transfected as controls. The mRNA levels of the screened cell lines were verified using real-time PCR and Western blotting. The results indicated that the expression of ADAMTS18 was successfully upregulated in the constructed cell lines, and genetically stable overexpression cell lines were obtained (Fig. 3).

Fig. 3.

Western Blot was used to detect the expression of the ADAMTS18 gene in overexpression-stable cell lines

Cell proliferative capacity in vitro: CCK-8 assay

In vitro proliferation ability of Ishikawa monolayer cell lines with lentiviral overexpression of ADAMTS18, and Ishikawa monolayer cell line transfected with overexpression plasmid NC were detected by CCK-8 assay. Compared to the NC group, the proliferation ability of Ishikawa cells was significantly decreased in the ADAMTS18 group at 72 h and 96 h (P < 0.05) (Fig. 4).

Fig. 4.

Overexpression of ADAMTS18 inhibits proliferation of Ishikawa cell

The ability of ADAMTS18 to promote the migration and invasion of EC cells in vitro: a Transwell assay

The results showed that compared to the CON and NC groups, the migratory ability of Ishikawa cells was significantly decreased after transfection with the ADAMTS18 overexpression plasmid (P < 0.05) (Fig. 5). We used the same cell line for Transwell invasion assay. Microscopic observation after 24 h of incubation showed that the ADAMTS18 overexpression group showed greater migration and invasion than the CON and NC groups (Fig. 6), indicating that ADAMTS18 overexpression promoted the invasion ability of EC cells.

Fig. 5.

Validation of the effect of ADAMTS18 overexpression on the number of migrating Ishikawa cells by Transwell and its quantitative analysis (200x)

Fig. 6.

Validation of the effect of ADAMTS18 overexpression on the number of invading Ishikawa cells by Transwell and its quantitative analysis (200x)

The ability of ADAMTS18 to promote apoptosis in EC cells in vitro: TUNEL assay

The Ishikawa monolayer cell group transfected with the overexpression plasmid ADAMTS18 revealed significantly enhanced apoptosis compared to the NC and CON groups (P < 0.05) (Fig. 7).

Fig. 7.

Detection of the number of apoptotic cells after TUNEL staining of different groups of cells and their quantitative analysis by flow cytometry validation

Discussions

As an important member of the secretory metalloproteinase ADAMTS family, dysfunction of ADAMTS18 is closely associated with a variety of gynecological and obstetric diseases. Previous studies have suggested that this protein may participate in both physiological and pathological processes of the female reproductive system, although its specific role in non-oncological settings remains under investigation. For example, ADAMTS1 is significantly upregulated in the serum of patients with severe hyperemesis gravidarum and shows a positive correlation with urinary ketone body levels, suggesting its potential value as a predictive biomarker (Timur and Guney 2022). ADAMTS4 and ADAMTS5 are abnormally upregulated in the amniotic fluid of pregnant women with gestational diabetes mellitus, indicating that they may be involved in the regulation of glucose metabolism (Melekoglu et al. 2019). In recent years, ADAMTS18 has attracted increasing attention because of its tumor-suppressive role in various malignant tumors. Numerous studies have demonstrated that ADAMTS18 is downregulated in several cancers, including cervical cancer, breast cancer, and lung cancer, and that its low expression is significantly associated with advanced tumor stage and poor prognosis (Nie et al. 2024). Mechanistically, the tumor-suppressive effects of ADAMTS18 are mainly mediated through the inhibition of epithelial–mesenchymal transition and tumor cell invasion by modulating key signaling pathways, such as AKT/NF-κB and Wnt/β-catenin (Guo and Zhang 2024). In addition, ADAMTS18 plays an important role in extracellular matrix remodeling. It can cleave matrix proteins such as fibronectin, thereby influencing the tumor microenvironment (Mushimiyimana et al. 2021). In the field of gynecological oncology, although the roles of other ADAMTS family members, including ADAMTS5 and ADAMTS8, in endometrial cancer have been reported (Yilmaz et al. 2020), the specific function of ADAMTS18 during endometrial carcinogenesis, particularly in the progression from atypical hyperplasia to carcinoma, as well as its underlying regulatory mechanisms, remain unclear.

ADAMTS18, as a new member of the family, has received increasing attention for its biological function and epigenetic regulation. In this study, we found that the expression of ADAMTS18 was decreased in NE, AH, and EC tissues, and its low expression was significantly and positively correlated with the FIGO stage of EC, the depth of tumor infiltration, and other indicators of poor prognosis. In vitro experiments revealed that ADAMTS18 overexpression significantly inhibited the proliferation, migration, and invasion of Ishikawa cells, and promoted their apoptosis, suggesting that it has a clear tumor-suppressive function. This finding supports the cancer-suppressive properties of the ADAMTS family in EC.

Available evidence suggests that ADAMTS18 silencing may be closely associated with epigenetic modifications. In various malignant tumors, low expression of the ADAMTS family members (e.g., ADAMTS8, 9, and 18) is associated with aberrant hypermethylation of CpG islands in the promoter region (Deva Magendhra Rao et al. 2019; Li et al. 2010; Xu et al. 2021). We hypothesized that ADAMTS18 may be regulated by DNA methylation in EC. This hypothesis was confirmed via methylation-specific PCR and pharmacological demethylation interventions. Notably, low expression of ADAMTS18 in patients with AH was significantly associated with disease progression, suggesting that it can serve as an early indicator for the transformation of AH to EC.

Despite the initial advances in the study of ADAMTS18, there are still many unanswered questions about its mechanism of action. First, ADAMTS18 possesses metalloproteinase activity. It is also involved in non-enzyme-dependent signaling, and its specific mode of action must be analyzed based on proteomics. Second, previous studies were limited to in vitro experiments on the Ishikawa cell line, and a knockout animal model is necessary to validate the function of ADAMTS18 in vivo. Third, ADAMTS18 is an early warning indicator for the transition of AH to EC, which is important for preserving fertility in young patients with AH. Fourth, the correlation between ADAMTS18 and EC molecular typing is worth exploring. The three progressive cases in this study all had P53 mutations, suggesting that ADAMTS18 may be involved in the malignant transformation of specific molecular subtypes. In addition, the effect of ADAMTS18 expression level on sensitivity to treatment with progesterone, as well as its interaction with stromal remodeling and inflammatory response in the tumor microenvironment, are important directions for future research.

From a clinical translational perspective, the detection of ADAMTS18 is expected to compensate for the shortcomings of existing molecular typing techniques. Although the current molecular typing techniques based on TCGA can guide the selection of treatment options (e.g., POLE mutant is suitable for conservation therapy), there are limitations such as high costs of testing and long cycle time. As a quantitatively detectable protein marker, validation of the prognostic value of ADAMTS18 in a multicenter cohort can help establish a more convenient risk stratification system. Meanwhile, the combination of demethylating drugs (e.g., decitabine) with ADAMTS18 overexpression based on epigenetic regulatory mechanisms may provide new strategies for the treatment of EC.

In summary, the ADAMTS family, especially ADAMTS18, exhibits important pathophysiological significance and clinical translation potential in obstetric and gynecological diseases. Future studies should explore the molecular regulatory network through integrated multi-omics analysis. Large-sized prospective studies are needed to verify the clinical value of ADAMTS18, which will finally provide new targets for early intervention and precise treatment of endometrial lesions.

Conclusion

Our results demonstrated that ADAMTS18 expression was significantly downregulated in EC tissues compared to normal endometrium, with stepwise reduction from normal through atypical hyperplasia to carcinoma, and ADAMTS18 overexpression was closely associated with the biological behaviors of EC cells, such as proliferation, invasion, migration, and apoptosis. These findings suggest that this gene may be involved in the development and progression of EC. This finding has important clinical significance for our future studies on the screening of pre-cancer lesions, and the diagnosis, treatment, and prevention of EC in the uterus. Validation of the association of ADAMTS18 expression with the progression of AH and poor postoperative prognosis of EC in a larger dataset can guide clinical decision-making in patients with AH of the uterus.

Supplementary Information

Below is the link to the electronic supplementary material.

Abbreviations

EC

Endometrial carcinoma

AH

Atypical hyperplasia

BEH

Benign endometrial hyperplasia

ADAMTS

A disintegrin and metalloproteinase with thrombospondin motifs

PCOS

Polycystic ovary syndrome

Author contributions

Xinrui Li: Conceptualization, Methodology, Software; Data curation, Writing- Original draft preparation. Mingyue Xu: Visualization, Investigation; Yanhua Xu: Supervision; Xin Guo: Validation,Writing- Reviewing and Editing. All authors read and approved the final manuscript.

Funding

The authors did not receive support from any organization for the submitted work.

Data availability

Data will be made available on request.

Declarations

Conflict of interest

The authors declare no competing interests.

Ethical approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Jinan Maternity Child Careand Hospital. (Date:2023–8-30/NO:IRB KY-23–68). This study identified ADAMTS18 as a novel tumor suppressor in endometrial carcinoma (EC). Its downregulation can serve as a potential diagnostic/prognostic biomarker, correlating with advanced FIGO stage (≥ III) and larger tumors (≥ 2 cm). Critically, ADAMTS18 overexpression suppresses the proliferation, migration, and invasion of EC cells and promotes apoptosis, establishing its therapeutic potential as adjuvant therapy for EC.

Consent to participate

Informed consent was obtained from all individual participants included in the study.

Consent for publication

The authors affirm that human research participants provided informed consent for publication of the images in Figure(s) 1–7 and Table(s)1–2.