SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways

Zhiyong Yang; Yufeng Hu; Chunyong Yang; Yujie Li; Xueyuan Zhong; Zhenfu Wu; Yingjie Zuo; Shanyu Gan; Lin Chen; Ziyang Zeng; Guiheng Qi; Yuanbao Chen; Junjie Zhou; Xiao-Jing Zhang; Hongliang Li; Bin Yi

doi:10.1136/gutjnl-2025-336400

. 2025 Oct 17;75(2):e336400. doi: 10.1136/gutjnl-2025-336400

SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways

Zhiyong Yang ^1,⁰, Yufeng Hu ^1,⁰, Chunyong Yang ^1,⁰, Yujie Li ^1,⁰, Xueyuan Zhong ¹, Zhenfu Wu ¹, Yingjie Zuo ¹, Shanyu Gan ¹, Lin Chen ¹, Ziyang Zeng ², Guiheng Qi ¹, Yuanbao Chen ¹, Junjie Zhou ¹, Xiao-Jing Zhang ^1,^*, Hongliang Li ^1,^*, Bin Yi ^1,^✉

PMCID: PMC12911573 PMID: 41107038

Abstract

Background

The JAK/STAT pathway plays a pivotal role in hepatic ischaemia/reperfusion (I/R) injury, a serious perioperative complication. Although signal transducers and activators of transcription 1 (STAT1) activation is known to drive I/R-induced injury, the specific post-translational modifications (PTMs) governing its activity in hepatic I/R remain poorly understood.

Objective

This study identifies SMYD2, SET and MYND domain Containing 2 (SMYD2) as a critical regulator of STAT1 and investigates the mechanistic basis of SMYD2-mediated PTMs in modulating STAT1 function during hepatic I/R.

Design

Using an integrated transcriptomic-proteomic approach and functional screening, we identified SMYD2 as a critical regulator of STAT1 activation in hepatic I/R injury. Clinical correlations linked SMYD2 expression to postoperative liver function, while loss-of-function and gain-of-function studies in vitro and in vivo validated its mechanistic role.

Results

Our findings demonstrate that SMYD2 modulates hepatic I/R injury through the JAK-STAT1 pathway. Clinically, elevated SMYD2 expression correlated with improved liver function and better surgical outcomes following hepatectomy. Mechanistic studies revealed that SMYD2 physically interacts with STAT1 and mediates its methylation at lysine 175 (K175), thereby inhibiting STAT1 phosphorylation and nuclear translocation. Both in vitro and in vivo studies demonstrated that SMYD2 overexpression alleviated hepatic I/R injury, whereas its genetic depletion or pharmacological inhibition exacerbated the damage.

Conclusion

This study establishes SMYD2 as a novel negative regulator of STAT1 activity through K175 methylation, providing new insights into the epigenetic control of STAT1 during hepatic I/R injury. Our findings reveal a previously unrecognised mechanism for fine-tuning STAT1 signalling in hepatic I/R injury, and targeting the SMYD2-STAT1 axis may present a promising therapeutic strategy for mitigating I/R-associated liver damage.

Keywords: HEPATIC SURGERY, ISCHAEMIA-REPERFUSION, METHYLATION, ACUTE LIVER FAILURE

WHAT IS ALREADY KNOWN ON THIS TOPIC

The JAK/STAT signalling pathway plays a crucial regulatory role in hepatic ischaemia/reperfusion (I/R) injury, with signal transducers and activators of transcription 1 (STAT1) activation being a key driver of this pathological process.
Post-translational modifications (PTMs) play a crucial role in regulating STAT1 activity.
Methylation modification, a key PTM, critically regulates pathophysiological processes.

WHAT THIS STUDY ADDS

Methyltransferase-mediated PTMs modulate STAT1 function in hepatic I/R injury and identified SET and MYND Domain-Containing 2 (SMYD2) as a key regulator of STAT1.
Higher SMYD2 expression was associated with improved postoperative liver function and favourable clinical outcomes.
Overexpression of SMYD2 attenuates hepatocyte injury induced by hepatic I/R, conferring hepatoprotection.
The exacerbated effects observed in SMYD2-deficient hepatocytes are dependent on STAT1.
SMYD2 directly interacted with STAT1, catalysing its methylation at lysine K175, which subsequently decreased STAT1 phosphorylation and its nuclear translocation.

HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY

SMYD2 may function as a biomarker for the prognosis of post-hepatectomy liver failure following hepatectomy.
Targeting SMYD2 shows potential as a therapeutic approach for ameliorating hepatic I/R injury.

Introduction

Hepatic ischaemia/reperfusion (I/R) injury is a common and significant perioperative complication in patients undergoing hepatectomy, contributing substantially to post-hepatectomy liver failure (PHLF).¹ Despite compromising clinical outcomes, there are currently no effective pharmacological treatments for hepatic I/R injury that have been approved.^{2 3} The pathophysiology underlying hepatic I/R injury is complex, involving various signalling pathways and intricate intercellular interactions.^{4 5} Emerging evidence suggests that pro-inflammatory cytokines and hepatocyte apoptosis play critical roles in the progression of hepatic I/R injury.6,8 Oxygen deprivation, ATP depletion, glycogen consumption, oxidative stress and the inflammatory response ultimately trigger hepatocyte apoptosis.^{9 10} Thus, targeting inflammation and apoptosis presents a promising strategy to mitigate hepatic I/R injury and improve surgical outcomes.

Signal transducers and activators of transcription (STATs), particularly STAT1, are a central player in the immune response, particularly in the activation of pro-inflammatory cytokines like tumour necrosis factor (TNF)-α, interleukin (IL)-6, and IL-1β, which are key mediators of hepatic I/R injury. on reperfusion, STAT1 is activated via phosphorylation at tyrosine 701 (Y701), allowing it to dimerise and translocate to the nucleus. Once in the nucleus, STAT1 regulates the transcription of genes involved in inflammation, immune cell recruitment and tissue damage.¹¹ STAT1 activity is tightly regulated through a variety of post-translational modifications (PTMs), which modulate its function, stability, localisation and interactions with other proteins. These PTMs are critical in determining whether STAT1 promotes inflammation and apoptosis or contributes to cellular protection during hepatic I/R injury.

Methylation modification is a widespread PTM that plays a crucial role in regulating various pathophysiological processes.¹² Methylation of STAT1 is a relatively recent area of interest in the study of STAT signalling. Methylation typically occurs on lysine residues and is catalysed by methyltransferases, such as those from the SMYD (SET and MYND) family. SET and MYND domain-containing protein 2 (SMYD2), a member of the SMYD-methyltransferase family, catalyses the methylation of both histone and non-histone proteins, including STAT3 and tumour suppressors such as P53 and Rb.^{13 14} Due to the diverse range of substrates it methylates, SMYD2 is implicated in various physiological and pathological processes, including cell survival, apoptosis, differentiation and the inflammatory response.¹⁵ Recently, SMYD2 has been identified as a potential therapeutic target for ischaemic stroke, highlighting its broader relevance in ischaemic injury contexts.¹⁶ However, the role of SMYD2 in hepatic I/R injury remains poorly understood, necessitating further investigation.

In this study, we reveal that SMYD2 expression is significantly upregulated in both in vitro and in vivo models of hepatic I/R injury. Clinically, elevated SMYD2 levels correlate with improved postoperative liver function in hepatectomy patients, underscoring its protective role. Mechanistically, we demonstrate that SMYD2 catalyses STAT1 methylation at lysine 175 (K175), which attenuates STAT1 phosphorylation, impairs its nuclear translocation and suppresses downstream JAK-STAT1 signalling. These results establish a novel mechanistic connection between SMYD2 and hepatic I/R injury, highlighting its potential as a therapeutic target worthy of further investigation.

Materials and methods

Human liver samples

All adult patients undergoing elective hepatectomy were included, regardless of surgical indications. Patients with clinically significant preoperative liver dysfunction (Child-Pugh grade C), neurodegenerative disorders (eg, Alzheimer’s, Parkinson’s) or haematological diseases (eg, leukaemia, lymphoma) were excluded. Additional criteria for exclusion included a history of congenital heart disease and incomplete postoperative outcome data recording. The study analysed 31 paired pre-hepatectomy and post-hepatectomy liver biopsy specimens which were prospectively collected from the same patients undergoing liver resection at the First Affiliated Hospital of Army Medical University (Chongqing, China). An additional 30 post-hepatectomy specimens from other patients were obtained from the Hospital Biological Resource Bank at Southwest Hospital of Army Medical University (Chongqing, China). Pre-I/R biopsies were obtained prior to hepatic hilum occlusion, while post-I/R biopsies were collected before abdominal closure. Corresponding serum samples were acquired at three time points: pre-I/R, post-I/R and 24 hours postoperatively for liver function assessment. Clinical information was extracted from the electronic medical record system. All participants or their legal representatives provided written informed consent. The study protocol was conducted in accordance with the ethical principles of the Declaration of Helsinki. The detailed information of the samples was listed in online supplemental table S1.

Animals

Global Smyd2-knockout (Smyd2-KO) mice were generated using the CRISPR/Cas9 system. Briefly, the single-guide RNA (sgRNA) targeting the SMYD2 gene was designed with the sequence: sgRNA1 GATGCCGGGATGCGGATATA and sgRNA2 GTGGCTGGGGATCATGCCGA. The in vitro transcripts of sgRNA expression vector (pUC57-sgRNA, Addgene, 51132) and another expression vector (pST1374-Cas9, Addgene 44758) were purified, mixed and injected into single-cell fertilised eggs of C57BL/6 mice using the FemtoJet 5247 microinjection system. The fertilised eggs were then implanted into female mice acting as surrogates in order to generate F0 generation mice. The PCR-positive mice were bred to generate Smyd2-KO mice, while littermate negative mice served as control animals. The primers were identified as Smyd2 nested F1 (5’- CTTCCCATCTCAAACGGTTC −3’) and Smyd2 nested R2 (5’- AACTTGGCTGATGGTGTCCT −3’). Mice were housed under standard conditions with free access to food and water, in an air-filtered environment at a controlled temperature of 25°C and a 12-hour light/dark cycle. The hepatic I/R injury model was established by clamping the portal vein, hepatic artery and bile duct for 1 hour of ischaemia, followed by reperfusion for 6 hours. Liver and serum samples (for alanine aminotransferase (AST)/aspartate aminotransferase (ALT) measurement) were collected to assess the degree of liver injury. In the present study, all animal experiments were conducted using male mice. This choice was made primarily to minimise confounding variables related to hormonal fluctuations and to maintain consistency with the majority of previously established preclinical models of hepatic I/R injury. All animal procedures were approved by the Animal Care and Use Committee at Gannan Innovation and Translational Medicine Research Institute.

Statistical analysis

Statistical analyses were conducted using SPSS software. Data are presented as means±SD unless otherwise indicated. For comparisons between two groups with normally distributed data, a two-tailed Student’s t-test was applied. For non-normally distributed data, the Mann-Whitney U test was used for two-group comparisons. In cases of multiple comparisons involving two independent variables, a two-way analysis of variance (ANOVA) without repeated measures was employed. For comparisons across more than two groups, one-way ANOVA was used. When the assumption of homogeneity of variances was met, the Bonferroni post hoc test was applied, whereas Tamhane’s T2 test was used when heteroscedasticity was observed. P values are indicated as *p<0.05; **p<0.01.

Further information on the materials and methods used can be found in the online supplemental methods.

Results

SMYD2 participates in the process of hepatic I/R through the JAK-STAT1 signalling pathway

Hepatic I/R injury is a complex and dynamic process that progresses rapidly. To gain a comprehensive understanding of the molecular events underlying hepatic I/R injury, we conducted digital gene expression analyses on liver tissue samples collected from mice at various time points (1, 3, 6, 12 and 24 hours) following 60 min of ischaemia and subsequent reperfusion (figure 1A). Transcriptomic reprogramming during I/R was further explored through k-means clustering, which revealed five major gene clusters showing the most significant expression changes over time. Notably, during the reperfusion phase, especially at 6 hours, there was a significant shift of genes and pathways, which is consistent with previous hepatic I/R injury studies¹⁷ (figure 1B). Further analysis revealed that these five major gene clusters were related to energy metabolism, inflammatory signalling, immune response, cell death and DNA repair. These signalling pathways, particularly those involved in immune response and inflammation, were rapidly activated throughout reperfusion, highlighting their crucial role in the pathogenesis of hepatic I/R injury (figure 1C). As a central regulator of inflammation and immune responses, the JAK-STAT pathway plays an important role in modulating gene expression programmes. The JAK-STAT pathway was significantly activated at the 6-hour time point, suggesting its pivotal role in driving transcriptional changes (figure 1D). To investigate this hypothesis further, we analysed the expression patterns of key components of the JAK-STAT pathway at various time points following reperfusion. STAT1, a cytoplasmic transcription factor, participates in mediating various biological responses, including inflammation and apoptosis. The activation of STAT1 is finely regulated by PTMs, such as phosphorylation and methylation modification. While phosphorylation is crucial for the activation of STAT1’s transcriptional activity, methylation may serve as a fine-tuning mechanism, adjusting STAT1’s ability to bind to DNA or interact with other proteins in response to various cellular signals. In our study, we performed a comprehensive analysis of the differentially expressed genes significantly altered at the 6-hour time point, along with STAT1 interacting molecules identified through database integration. Additionally, we focused on molecules involved in STAT1 methylation modifications to identify key regulators of STAT1 PTMs; 19 candidates were interactively selected (figure 1E,F). To further identify potential candidates that interact with STAT1 in hepatic I/R, particularly those involved in regulating protein methylation, we conducted hypoxia-reoxygenation (H/R) treatment in STAT1-overexpressing cells, followed by immunoprecipitation (IP) and mass spectrometry analysis. Five proteins associated with methylation modification were identified, among which Smyd2 and Prmt5 were included in the aforementioned list of 19 candidate molecules (figure 1G). To validate the impact of Smyd2 and Prmt5 on STAT1 activity, we first constructed a luciferase reporter plasmid containing the STAT1-response element and performed a luciferase activity assay. The results revealed that SMYD2 significantly suppresses STAT1 activity, suggesting that SMYD2 may serve as a critical methyltransferase regulating STAT1 function during hepatic I/R injury (figure 1H). Thereafter, we explore the significant function of SMYD2 on the JAK-STAT1 signalling pathway by assessing STAT1 activation in HepG2 cells and primary hepatocytes. When HepG2 cells were subjected to hypoxia for 6 hours followed by reoxygenation for 6 hours, SMYD2 overexpression reduced STAT1 phosphorylation induced by the H/R challenge (figure 1I). Overexpression of AdSmyd2 reduces the phosphorylation of Stat1 at tyrosine 701 (Y701) and serine 727 (S727) residues in response to H/R treatment compared with AdGFP control. Silencing Smyd2 by AdshSmyd2 enhances the phosphorylation of Stat1 at Y701 and S727 residues under similar H/R conditions compared with AdshGFP control (figure 1J,K). Consistent with its protective role, SMYD2 expression was significantly upregulated in mouse livers following hepatic I/R injury (figure 1L,M). This induction was recapitulated in primary hepatocytes subjected to H/R, with both SMYD2 messenger RNA (mRNA) and protein levels showing marked increases (figure 1N,O). Importantly, after H/R treatment, SMYD2 expression was significantly upregulated specifically in hepatocytes, while no notable change was observed in Kupffer cells. These results suggest that the protective role of SMYD2 in hepatic I/R injury may be primarily mediated through hepatocytes rather than immune cells such as Kupffer cells. Immunohistochemical analysis further confirmed SMYD2 upregulation in I/R-injured liver tissues (figure 1P).

SMYD2 expression negatively correlated with liver dysfunction in clinical hepatic I/R injury

To investigate the clinical relevance of SMYD2 in hepatic I/R injury, we first analysed SMYD2 expression in paired pre-hepatectomy and post-hepatectomy liver biopsies from patients. Pre-I/R biopsies were collected prior to hepatic hilum occlusion, while post-I/R biopsies were obtained before abdominal closure. Both quantitative PCR (qPCR), immunohistochemical staining and immunoblotting revealed significantly elevated SMYD2 mRNA and protein levels in post-hepatectomy samples compared with preoperative controls (figure 2A–C). To assess the clinical correlation, we expanded our cohort with 30 additional post-I/R biopsies from the Hospital Biological Resource Bank at Southwest Hospital of Army Medical University (figure 2D). In the combined analysis (n=61 post-hepatectomy samples), SMYD2 protein expression showed a significant negative correlation with postoperative serum ALT and AST levels (figure 2E), suggesting an association with hepatic injury. For outcome analysis, patients were divided into SMYD2-low (n=31) and SMYD2-high (n=30) groups based on median post-I/R SMYD2 protein expression (figure 2F). Compared with low SMYD2 group, post-hepatectomy individuals characterised by high SMYD2 expression exhibited significantly lower levels of ALT and AST at postoperative day 1, and lower levels of prothrombin time-international normalised ratio (INR), total bilirubin along with higher albumin at postoperative day 5 (figure 2G). These clinical findings strongly implicate SMYD2 as a critical regulator in hepatic I/R injury pathophysiology, with higher expression associated with superior postoperative liver function recovery.

Overexpression of SMYD2 demonstrates a protective effect on hepatocyte injury induced by hepatic I/R in hepatocytes

To further elucidate the function of SMYD2, we generated a SMYD2 knockdown primary hepatocytes were infected with adenovirus using SMYD2-specific short hairpin RNA (shRNA) (figure 3A). To investigate the role of SMYD2 in H/R stress, cells were exposed to 6 hours of hypoxia followed by 6 hours of reoxygenation. Cell viability was significantly reduced following SMYD2 knockdown, as evidenced by cell counting Kit-8 (CCK-8) and lactate dehydrogenase (LDH) assays (figure 3B,C). RNA sequencing (RNA-seq) revealed that SMYD2 knockdown upregulated pathways related to inflammation and cell death, with differentially expressed genes primarily enriched in inflammatory response and cell death pathways (figure 3D–F). qPCR analysis further confirmed activation of the nuclear factor κB (NF-κB) signalling pathway in SMYD2 knockdown hepatocytes, with elevated levels of pro-inflammatory cytokines such as IL-6, IL-1β, interferon β and Cxcl2 (online supplemental figure S1A). Western blot analysis showed that SMYD2 knockdown resulted in increased IKKβ phosphorylation and reduced IKBα phosphorylation, consistent with activation of the NF-κB pathway (figure 3G). Additionally, SMYD2 deficiency led to increased expression of pro-apoptotic markers, including Bax and cleaved caspase-3, and decreased expression of the anti-apoptotic protein Bcl-2 (figure 3H). In contrast, we overexpressed SMYD2 in primary hepatocytes by packaging an adenovirus expressing SMYD2 (figure 3I). CCK-8 and LDH assays demonstrated that SMYD2 overexpression promoted cell survival and reduced LDH release in the H/R model (figure 3J,K). RNA-seq analysis of SMYD2-overexpressing cells revealed a reduction in inflammation and cell death compared with controls (figure 3L–N). Western blot and qPCR analyses showed that SMYD2 overexpression decreased the expression of inflammatory markers and reduced IKKβ phosphorylation (figure 3O and online supplemental figure S1B). Notably, SMYD2 overexpression led to a decrease in pro-apoptotic factors, including Bax and cleaved caspase-3, relative to controls (figure 3P). We also constructed SMYD2-knockdown cell lines and overexpressed cells in HepG2 cells through lentiviral transduction with SMYD2-specific shRNA or overexpression plasmid, and observed the consistent conclusion (online supplemental figure S2A–H). Taken together, these findings provide compelling evidence that SMYD2 exerts a protective effect against H/R-induced liver injury.

STAT1 is required for the regulation effects of SMYD2 on hepatic I/R

To determine whether the exacerbated effects observed in SMYD2-deficient hepatocytes are dependent on STAT1, we treated hepatocytes with the STAT1 inhibitor fludarabine to block STAT1 activity. Under H/R conditions, SMYD2 knockdown significantly reduced cell viability, an effect that was efficiently inhibited by fludarabine, as evidenced by LDH assays (figure 3Q). qPCR analyses demonstrated that fludarabine effectively prevented the increase in pro-inflammatory cytokines and apoptotic factor levels induced by SMYD2 knockdown (online supplemental figure S3), while a 20 µM concentration of fludarabine successfully inhibited STAT1 phosphorylation (figure 3R). Furthermore, fludarabine reversed both the phosphorylation of STAT1 and the activation of the NF-κB signalling pathway induced by SMYD2 knockdown, concomitantly decreasing the elevated expression of apoptotic factors (figure 3S–U). These results suggest that the effects of SMYD2 on H/R injury may be partially mediated by STAT1.

SMYD2 interacts with STAT1 and suppresses its nuclear translocation

To further elucidate the detailed molecular mechanism by which SMYD2 regulates STAT1 activity during hepatic I/R injury, we first performed a confocal assay to validate the specific cellular location of SMYD2 and STAT1 in hepatocytes. Confocal microscopy revealed that both SMYD2 and STAT1 were localised in the cytoplasm and nucleus (figure 4A). Semi-endogenous and exogenous IP experiments confirmed that SMYD2 interacts with STAT1 in vivo (figure 4B,C). Additionally, glutathione S-transferase pull-down assays verified the direct interaction between SMYD2 and STAT1 (figure 4D). To map the structural domains responsible for this interaction, we generated continuous truncated forms of SMYD2 and STAT1. Notably, molecular localisation analysis revealed the CCD domain of STAT1 (amino acids 137–316) and the SET domain of SMYD2 (amino acids 97–243) might mediate the protein-protein interaction of SMYD2 and STAT1 (figure 4E,F).

These findings prompted us to investigate the role of SMYD2 in regulating JAK-STAT1 signalling. Previous studies have demonstrated that JAK-STAT1 signalling is activated during I/R injury, with STAT1 phosphorylation playing a central role in this process. Given that SMYD2 is predominantly cytoplasmic and that SMYD2 overexpression attenuates STAT1 phosphorylation, we further explored whether SMYD2 regulates STAT1 signalling in the cytoplasm before its nuclear translocation. Cytoplasmic and nuclear fractions assay confirmed these observations (figure 4G). We also examined the effects of H/R treatment on the subcellular localisation of SMYD2 and STAT1 in primary hepatocytes. As expected, confocal imaging showed that I/R treatment led to the accumulation of STAT1 in the nucleus, while SMYD2 remained predominantly in the cytoplasm (figure 4H). Furthermore, in SMYD2-overexpressing cells, we observed a significant reduction in both STAT1 phosphorylation and its nuclear translocation following H/R treatment (figure 4I). We therefore conclude that SMYD2 can bind to STAT1 in the cytoplasm and disrupt its nuclear translocation following hepatic I/R injury (figure 4J).

SMYD2 directly suppresses STAT1 phosphorylation via its methyltransferase activity targeted at lysine 175

Previous studies have demonstrated that non-histone methylation and the crosstalk between methylation and other modifications play an important role in regulating cellular functions, particularly gene transcription and signal transduction.¹² Based on our observation that SMYD2 directly interacts with STAT1 and possesses methyltransferase activity, we hypothesised that SMYD2 mediates the methylation of STAT1, thereby influencing its phosphorylation status. To test this hypothesis, we compared the methylation levels of STAT1 in HepG2 cells overexpressing SMYD2 to assess whether SMYD2 modulates STAT1 methylation. IP was performed using an anti-STAT1 antibody, followed by methylation analysis with an anti-methylation antibody. As expected, STAT1 methylation levels were significantly elevated in SMYD2-overexpressing cells compared with controls (figure 5A). Notably, this increase in STAT1 methylation was associated with a reduction in STAT1 phosphorylation. Furthermore, treatment with the SMYD2 inhibitor LLY-507 significantly decreased STAT1 methylation and concomitantly enhanced STAT1 phosphorylation (figure 5B). Our results further revealed that LLY-507 significantly counteracted the inhibitory effects of SMYD2 on STAT1 phosphorylation and nuclear translocation, suggesting that SMYD2 plays a key role in regulating STAT1 activity (figure 5C). Notably, our data indicate that SMYD2 enhances STAT1 methylation, which may be pivotal in the molecular cascade associated with hepatic I/R injury. The previous report indicated that identified STAT1 was methylated by seven methylated lysine residues, such as K114, K175, K296, K366, K525, K637 and K665.¹⁸ To further validate the SMYD2-mediated methylation sites on STAT1, we generated lysine-to-arginine substitution mutants of STAT1, including K114A, K175A, K296A, K366A, K525A, K637A, K665A and K636/K637A. These mutants, along with HA-tagged wild-type STAT1 (WT-STAT1), were transfected into HEK293T cells and labelled with or without SMYD2. Our findings demonstrate that the CCD domain of STAT1 (amino acids 137–316) mediates its interaction with SMYD2. To identify specific methylation sites, we examined a series of Hemagglutinin(HA)-tagged STAT1 lysine-to-alanine mutants by IP with anti-HA antibodies. Methylation was significantly reduced only in the K175A mutant, while no notable changes were observed in other mutants (K114A, K296A, K366A, K525A, K637A, K665A and K636/K637A) (figure 5D). We next evaluated the phosphorylation status of STAT1 at Y701 and S727. Overexpression of SMYD2 markedly decreased phosphorylation of both WT-STAT1 and all tested mutants except K175A. In contrast, the K175A mutant showed no reduction in phosphorylation at either site on SMYD2 overexpression (figure 5E). To assess the functional impact of K175 methylation, we expressed HA-tagged wild-type or K175A STAT1 in HepG2 cells, with or without Flag-SMYD2 co-expression, and monitored STAT1 nuclear translocation under H/R conditions. SMYD2 overexpression inhibited nuclear translocation of wild-type STAT1 but had no effect on the K175A mutant (figure 5F,G). Additionally, co-IP assays further revealed that the K175A mutation weakened the physical interaction between SMYD2 and STAT1 (figure 5H), indicating that K175 is critical for both methylation and functional engagement. Importantly, although SMYD2 still bound to the STAT1-K175A mutant, the STAT1-K175A mutant reversed the SMYD2’s function (figure 5I). Consequently, SMYD2 was unable to suppress STAT1 phosphorylation in K175A-expressing cells. These results collectively indicate that methylation at K175 is essential for SMYD2-mediated suppression of STAT1 phosphorylation and nuclear translocation. While the physical interaction between SMYD2 and STAT1 is necessary, it is insufficient to inhibit phosphorylation in the absence of K175 methylation, underscoring the site-specific regulatory role of this modification.

Finally, to evaluate the therapeutic potential of targeting SMYD2, we applied the selective SMYD2 inhibitor LLY-507 in the context of hepatic I/R injury. Consistent with the protective role of SMYD2 suggested by our genetic evidence, pharmacological inhibition with LLY-507 significantly exacerbated H/R-induced damage, as demonstrated by increased inflammatory responses and apoptosis via CCK-8 and molecular analyses (figure 5J,K). Furthermore, LLY-507 treatment enhanced the mRNA expression of key inflammatory and apoptotic factors, reinforcing the regulatory role of SMYD2 in these pathways (figure 5L). Although SMYD2 is present in the nucleus and has known histone methyltransferase activity towards lysine 4 (H3K4) and lysine 36 (H3K36), its nuclear role in I/R injury appears limited. We observed that neither inhibition (including with LLY-507), knockdown nor overexpression of SMYD2 altered global H3K4 or H3K36 methylation levels in H/R-injured HepG2 cells or primary hepatocytes (online supplemental figure S4A–C). Taken together, these results suggest that the protective function of SMYD2 is mediated primarily through its cytoplasmic action on the STAT1 pathway rather than through histone methylation in the nucleus. These findings also underscore that while SMYD2 represents a promising molecular target, therapeutic strategies may need to focus on enhancing—rather than inhibiting—its activity, given its clear protective role in hepatic I/R injury.

SMYD2 deficiency aggravates liver inflammatory response and damage during hepatic I/R injury

To further validate the function of SMYD2 in hepatic I/R injury, we constructed Smyd2 knockout (Smyd2-KO) mice (online supplemental figure S5A,B). The success of the Smyd2 knockout efficiency was confirmed by Western blot (figure 6A). Liver function tests revealed significantly elevated serum levels of ALT and AST in Smyd2-KO mice compared with WT mice (figure 6B). Histological examination showed significantly larger necrotic areas in Smyd2-KO mice. Additionally, immunofluorescence (IF) analysis indicated significantly increased infiltration of CD11b-positive inflammatory cells in the livers of Smyd2-KO mice. Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining also revealed increased apoptosis in Smyd2-KO mice compared with WT mice (figure 6C,D). To explore the molecular mechanisms underlying SMYD2’s protective effects in I/R injury, RNA-seq analysis was conducted on liver samples. Principal component analysis clearly distinguished SMYD2-deficient mice from WT controls (figure 6E). Gene set enrichment analysis (GSEA) revealed that the inflammation-related and apoptosis-related pathways were primarily enriched in Smyd2-KO mice group (figure 6F). The heatmap further supported the conclusion that SMYD2 deficiency exacerbated hepatic inflammation and injury, with upregulation of pro-inflammatory and pro-apoptotic genes (figure 6G). Furthermore, the phosphorylation of STAT1 was significantly upregulated in Smyd2-KO hepatic tissues, along with activation of the NF-κB signalling pathway (figure 6H,I). Similarly, western blotting results validated the aggravated cell apoptosis in Smyd2-KO mice (figure 6J). These findings suggest that SMYD2 deficiency promotes the development of hepatic I/R injury.

SMYD2 overexpression inhibits inflammation and apoptosis in the liver of mice

To further validate the role of SMYD2 in I/R-induced liver injury, we generated SMYD2-overexpressing mice by administering adenovirus expressing SMYD2 (Ad-Smyd2), with adenovirus expressing GFP (Ad-GFP) serving as a control. SMYD2 overexpression was validated by Western blot (figure 7A). Following 1 hour of ischaemia and 6 hours of reperfusion, mice underwent molecular, biochemical and histological analyses to assess liver injury, hepatic inflammatory response and apoptosis. SMYD2 overexpression significantly reduced serum ALT and AST levels, decreased the necrotic area and significantly inhibited cell death compared with Ad-GFP control mice. Additionally, Smyd2-overexpressing mice showed significantly lower infiltration of inflammatory cells, including CD11b-positive and Ly6G-positive cells, in the liver compared with controls (figure 7B–D). To explore the molecular mechanisms underlying SMYD2’s protective effects in I/R injury, RNA-seq analysis was performed on liver samples. GSEA revealed that inflammation-related and apoptosis-related pathways were predominantly enriched in the control group. The heatmap further supported the conclusion that SMYD2 overexpression attenuated hepatic inflammation and injury relative to Ad-GFP control mice. Specifically, pro-inflammatory and pro-apoptotic gene expression was significantly downregulated in the Smyd2 overexpressing mice (figure 7E–G). Western blot analysis confirmed that SMYD2 overexpression significantly inhibited STAT1 phosphorylation, cell death-associated protein expression and NF-κB signalling activation (figure 7H–J). These findings were consistent with results observed in I/R-treated primary hepatocytes. Collectively, these data provide compelling evidence for a protective role of SMYD2 in I/R-induced liver injury.

Discussion

As an inevitable and complex complication with serious consequences, hepatic I/R injury has long been a challenge for perioperative physicians. It is imperative to identify effective intervention targets to improve surgical prognosis. Previous studies have confirmed that the inflammatory response and hepatocyte apoptosis constitute critical steps in the pathogenesis of hepatic I/R injury.^{7 8 17 19} Thus, strategies aimed at preventing inflammation and hepatocyte apoptosis may hold promise as interventions.19,22 Our study establishes SMYD2 as a key cytoprotective regulator in hepatic I/R injury through modulation of the STAT1 signalling. Clinical correlation analysis revealed that higher SMYD2 expression levels were significantly associated with better postoperative liver function and improved clinical outcomes in hepatectomy patients. Both in vitro and in vivo experiments demonstrated that SMYD2 upregulation effectively attenuated hepatic I/R injury by mitigating inflammatory responses and reducing cellular apoptosis. Mechanistically, we identified that SMYD2 exerts its protective effects by catalysing STAT1 methylation, which in turn inhibits STAT1 phosphorylation and nuclear translocation. Notably, site-directed mutagenesis studies confirmed that methylation at K175 is essential for SMYD2-mediated protection against I/R-induced hepatocyte inflammation and apoptosis.

SMYD2, localises in both the nucleus and cytoplasm, functions as a lysine methyltransferase capable of methylating histone and non-histone protein substrates. Its diverse methylation targets enable SMYD2 to participate in various biological processes and diseases. In cancer, SMYD2 methylates key regulators such as p53 (at K370) and Rb (at K810), thereby influencing cell proliferation, apoptosis and cell-cycle progression.^{23 24} SMYD2 deficiency has also been shown to suppress colon tumour growth by enhancing TNF-induced apoptosis.²⁵ In inflammatory contexts, SMYD2 methylates NF-κB (K310/211) and STAT3 (K685), promoting their phosphorylation and contributing to inflammation and tissue growth.²⁶ It also modulates inflammatory signalling through TRAF2 methylation, facilitating NF-κB activation.²⁷ However, the role of SMYD2 in inflammation remains controversial.²⁸ For instance, one study showed that SMYD2 overexpression reduces proinflammatory cytokine production through H3K36 dimethylation, underscoring its context-dependent functions.²⁹ As a canonical histone methyltransferase, SMYD2 specifically catalyses methylation of histone H3 at lysine 4 (H3K4) and lysine 36 (H3K36).³⁰ SMYD2 has also been implicated in the regulation of HIV-1 latency through methylation of histone H4 at lysine 20.³¹ These modifications influence chromatin accessibility and gene expression by recruiting or excluding transcriptional regulators. In other contexts, SMYD2 inhibition reduces H3K4me and H3K36me levels, and ChIP experiments confirm its binding to promoters of cell-cycle genes like CDK4 and CDK6, modulating their expression.³² In contrast, under hepatic I/R injury, we observed that neither knockdown nor overexpression of SMYD2 altered H3K4 or H3K36 methylation levels in hepatocytes. Although SMYD2 is capable of nuclear histone methylation, our data indicate that its primary role during I/R occurs in the cytoplasm, where it regulates STAT1 phosphorylation independently of nuclear translocation. This finding is consistent with previous reports and helps clarify apparent discrepancies in SMYD2 function across studies.³³ This cytoplasmic mechanism aligns with certain previous reports and may help reconcile discrepancies regarding its nuclear functions. We recognise that the nuclear pool of SMYD2 may still contribute to transcriptional regulation under prolonged or alternative pathological conditions, and this represents an important area for future investigation.

STAT1, a key cytoplasmic transcription factor, plays a central role in numerous biological processes through its phosphorylation-dependent activation. Phosphorylation at conserved Y701 and S727 residues is critical for its function: Y701 phosphorylation facilitates dimerisation and nuclear translocation, enabling STAT1 to regulate genes involved in apoptosis and inflammation, while S727 phosphorylation fine-tunes transcriptional activity through interactions with DNA-bound cofactors. Notably, STAT1 and its homologue STAT3 have attracted considerable attention in I/R injury research.^{34 35} STAT3 has been shown to exert protective effects across various I/R models—deficiency in STAT3 exacerbates cardiomyocyte apoptosis after I/R injury.^{36 37} In contrast, STAT1 often plays a detrimental role, promoting inflammatory and apoptotic responses.³⁸ In hepatic I/R, STAT3 is known to mediate protection through modulation of inflammatory mediators and cellular responses.³⁹ Although the JAK-STAT pathway is a well-documented master regulator of inflammatory and immune responses and serves as a central signalling node during hepatic I/R injury, the specific role of STAT1 remains less defined. In the present study, we found STAT1 is activated in the early stage of hepatic I/R challenge. Through multi-omics analysis, we identified SMYD2 as a novel and specific methyltransferase that interacts with STAT1. Interestingly, we found that SMYD2 physically interacts most strongly with STAT1, while its binding with other STATs was notably weaker or undetectable under the same experimental conditions. We also found that SMYD2 binds to STAT1 and inhibits its interaction with JAKs (online supplemental figure S6). The underlying mechanism may be that the binding of SMYD2 to STAT1 may induce conformational changes in STAT1 or directly occupy the domain required for JAK binding, thereby physically blocking the interaction between STAT1 and JAKs. These findings suggest that SMYD2 may exhibit a preferential regulatory effect toward STAT1 rather than broadly targeting multiple JAK/STAT components. However, whether SMYD2 primarily regulates the JAK-STAT signalling pathway by affecting STAT1, and whether SMYD2 modulates JAK activity, remains to be further investigated. Further molecular localisation analysis revealed that the CCD domain of STAT1 and the SET domain of SMYD2 are essential for this interaction. Importantly, we demonstrated that SMYD2 methylates STAT1 at lysine 175 (K175), leading to suppressed phosphorylation at Y701 and S727. These findings support a model in which SMYD2 attenuates hepatic I/R injury by methylating STAT1 and constraining its phosphorylation-dependent activation.

The crosstalk between methylation and phosphorylation—a widespread yet poorly understood phenomenon in PTM—is increasingly recognised. For instance, SETD2-mediated methylation of STAT1 at K525 promotes phosphorylation by stabilising the phosphate-binding loop in its SH2 domain.¹⁸ Conversely, arginine methylation of STAT1 can influence its dephosphorylation kinetics.⁴⁰ Similarly, arginine methylation of FOXO1 by PRMT1 inhibits its phosphorylation and promotes apoptosis.⁴¹ SETD7-mediated methylation of STAT3 at K140 also suppresses its transcriptional activity.⁴² Our results align with these studies in suggesting that methylation can antagonise phosphorylation. We focused specifically on SMYD2-mediated methylation of STAT1 at K175 and its direct impact on STAT1 phosphorylation. While our current data do not provide direct evidence that SMYD2 regulates other PTMs such as acetylation or ubiquitination, we acknowledge that STAT1 activity is indeed modulated by a complex network of modifications, including phosphorylation, acetylation, ubiquitination and others, which can coordinately or antagonistically fine-tune its transcriptional activity. However, based on our mutagenesis and functional data, the K175 methylation by SMYD2 appears to exert its effect primarily through steric hindrance, limiting phosphorylation rather than directly altering other modification pathways.

In this study, our data demonstrate that SMYD2 expression is significantly upregulated during hepatic I/R injury, a phenomenon consistently observed in both preclinical models and clinical patient samples. Interestingly, although SMYD2 expression increases in response to I/R, higher SMYD2 levels correlate with improved clinical outcomes—specifically, patients with elevated SMYD2 exhibited lower serum ALT and AST levels, indicating reduced liver injury. This apparent paradox can be explained by our functional and mechanistic investigations. Through both in vitro and in vivo experiments, we confirmed that SMYD2 overexpression attenuates hepatic I/R injury, while its knockdown exacerbates cellular damage. Therefore, the natural upregulation of SMYD2 likely represents an endogenous protective mechanism that limits excessive inflammatory response and cell death during hepatic I/R. This compensatory response may serve to maintain cellular homeostasis under stress conditions. Significantly, the natural elevation of SMYD2 during hepatic I/R likely represents an endogenous protective response aimed at mitigating tissue damage. This hypothesis aligns with our observations. In the setting of acute liver injury, the transient upregulation of SMYD2 may serve as a compensatory mechanism to limit damage. However, possible molecular mechanisms driving SMYD2 upregulation need further study.

Hepatic I/R injury is a major contributor to PHLF pathogenesis, which occurs in 0.7%–34% of patients undergoing hepatectomy.⁴³ PHLF is characterised by complex symptoms, rapid progression and poor prognosis. Diagnostic criteria include an elevated INR and hyperbilirubinaemia emerging after postoperative day 5.⁴⁴ To analyse the clinical correlation between SMYD2 expression and the outcomes of patients suffering from I/R, we performed qRT-PCR and Western blot experiments using clinical specimens. Notably, elevated SMYD2 levels inversely correlated with the severity of liver dysfunction, as evidenced by lower incidence rate of PHLF and improved liver function in patients with high SMYD2 expression. Moreover, patients in the low SMYD2 expression group exhibited prolonged operative duration, extended hepatic artery/portal vein occlusion time and increased intraoperative blood loss, all of which were associated with poorer postoperative liver function, consistent with clinical observations. Developing SMYD2 as a diagnostic marker and exploring more advanced detection methods to enhance its clinical applicability. The accurate detection of SMYD2 in clinical settings indeed requires careful consideration of its expression at both RNA and protein levels. Currently, our data demonstrate that SMYD2 is upregulated during hepatic I/R injury and correlates with improved liver function, suggesting its potential as a prognostic biomarker. However, translating these findings into clinical diagnostics necessitates further validation in larger cohorts.

In conclusion, the present study provides heretofore unexplored evidence indicating that SMYD2 functions as a protective factor against hepatic I/R injury. Specifically, SMYD2 is capable of directly binding to STAT1 and catalysing the methylation of STAT1 at lysine 175. This molecular interaction results in a significant remission of cellular inflammation and apoptosis, which is subsequently followed by attenuated STAT1 activation and nuclear translocation. Given its demonstrated role in attenuating STAT1 phosphorylation and suppressing pro-inflammatory signalling, the development of therapeutic strategies aimed at enhancing SMYD2 expression or enzymatic activity may represent a promising approach for mitigating hepatic I/R injury and other inflammation-related pathologies. Future efforts may include the design of small-molecule agonists, gene therapy-based overexpression or epigenetic modulators that specifically enhance SMYD2 transcription or stability. However, such strategies would need to be carefully evaluated for cell-type specificity and potential off-target effects, particularly in light of SMYD2’s diverse roles in cancer and other diseases.

Supplementary material

online supplemental file 1

gutjnl-75-2-s001.docx^{(10.5MB, docx)}

DOI: 10.1136/gutjnl-2025-336400

online supplemental file 2

gutjnl-75-2-s002.pptx^{(2.3MB, pptx)}

DOI: 10.1136/gutjnl-2025-336400

Footnotes

¹Department of Anesthesiology, Southwest Hospital, Third Military Medical University (Army Medical University), Chongqing; State Key Laboratory of New Targets Discovery and Drug Development for Major Diseases, Gannan Innovation and Translational Medicine Research Institute, Gannan Medical University, Ganzhou, China

Funding: This work was supported by grants from the National Natural Science Foundation of China (No. 82470655 to BY, 82422013 to X-JZ, 82100658 to YL, 82270656 to LC, 82300684 to YH), National Science and Technology Major Project (2024ZD0530902 to X-JZ), the Key Project of Natural Science Foundation from Chongqing Science and Technology Development Foundation (CSTB2023NSCQ-ZDX0003 to BY), the Key R&D Program of Jiangxi Province of China (20223BBG71008 to YH), the Natural Science Foundation of Jiangxi Province of China (20242BAB23074 to YH, 20232ACB206007 to JZ), Henan Charity Federation Hepatobiliary Fund (GDXZ2023010 to JZ).

Provenance and peer review: Not commissioned; externally peer reviewed.

Patient consent for publication: Not applicable.

Ethics approval: The study was approved by the Ethics Committee of the First Affiliated Hospital of Army Medical University (Permit Number: (A)KY2025088). Participants gave informed consent to participate in the study before taking part.

Data availability free text: All study data and source data are available in this article and its Supplementary Information. The transcriptomic data presented in Figure 1 were derived from the Sequence Read Archive database (SRP117594). The RNA-seq data generated in this study have been deposited in the Sequence Read Archive repository: PRJNA1331674 (KO mice); PRJNA1331675 (mice with AdSmyd2 or control); PRJNA1331672 (Hepatocytes with AdSmyd2 or AdGFP under H/R condition); PRJNA1331673 (Hepatocytes with AdshSmyd2 or AdshGFP under H/R condition).

Patient and public involvement: Patients and/or the public were not involved in the design, or conduct, or reporting, or dissemination plans of this research.

Data availability statement

Data are available in a public, open access repository. All data relevant to the study are included in the article or uploaded as supplementary information.

References

1.Zhai Y, Petrowsky H, Hong JC, et al. Ischaemia–reperfusion injury in liver transplantation—from bench to bedside. Nat Rev Gastroenterol Hepatol . 2013;10:79–89. doi: 10.1038/nrgastro.2012.225. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Konishi T, Lentsch AB. Hepatic Ischemia/Reperfusion: Mechanisms of Tissue Injury, Repair, and Regeneration. Gene Expr. 2017;17:277–87. doi: 10.3727/105221617X15042750874156. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Cannistrà M, Ruggiero M, Zullo A, et al. Hepatic ischemia reperfusion injury: A systematic review of literature and the role of current drugs and biomarkers. Int J Surg. 2016;33 Suppl 1:S57–70. doi: 10.1016/j.ijsu.2016.05.050. [DOI] [PubMed] [Google Scholar]
4.Huang S, Ju W, Zhu Z, et al. Comprehensive and combined omics analysis reveals factors of ischemia-reperfusion injury in liver transplantation. Epigenomics. 2019;11:527–42. doi: 10.2217/epi-2018-0189. [DOI] [PubMed] [Google Scholar]
5.Quesnelle KM, Bystrom PV, Toledo-Pereyra LH. Molecular responses to ischemia and reperfusion in the liver. Arch Toxicol. 2015;89:651–7. doi: 10.1007/s00204-014-1437-x. [DOI] [PubMed] [Google Scholar]
6.Brenner C, Galluzzi L, Kepp O, et al. Decoding cell death signals in liver inflammation. J Hepatol. 2013;59:583–94. doi: 10.1016/j.jhep.2013.03.033. [DOI] [PubMed] [Google Scholar]
7.Zhou J, Guo L, Ma T, et al. N-acetylgalactosaminyltransferase-4 protects against hepatic ischemia/reperfusion injury by blocking apoptosis signal-regulating kinase 1 N-terminal dimerization. Hepatology. 2022;75:1446–60. doi: 10.1002/hep.32202. [DOI] [PubMed] [Google Scholar]
8.Yan Z-Z, Huang Y-P, Wang X, et al. Integrated Omics Reveals Tollip as an Regulator and Therapeutic Target for Hepatic Ischemia-Reperfusion Injury in Mice. Hepatology. 2019;70:1750–69. doi: 10.1002/hep.30705. [DOI] [PubMed] [Google Scholar]
9.Eltzschig HK, Eckle T. Ischemia and reperfusion--from mechanism to translation. Nat Med. 2011;17:1391–401. doi: 10.1038/nm.2507. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Soares ROS, Losada DM, Jordani MC, et al. Ischemia/Reperfusion Injury Revisited: An Overview of the Latest Pharmacological Strategies. Int J Mol Sci. 2019;20:5034. doi: 10.3390/ijms20205034. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Stark GR, Darnell JE., Jr The JAK-STAT pathway at twenty. Immunity. 2012;36:503–14. doi: 10.1016/j.immuni.2012.03.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Biggar KK, Li SS-C. Non-histone protein methylation as a regulator of cellular signalling and function. Nat Rev Mol Cell Biol. 2015;16:5–17. doi: 10.1038/nrm3915. [DOI] [PubMed] [Google Scholar]
13.Brown MA, Sims RJ, III, Gottlieb PD, et al. Identification and characterization of Smyd2: a split SET/MYND domain-containing histone H3 lysine 36-specific methyltransferase that interacts with the Sin3 histone deacetylase complex. Mol Cancer. 2006;5:26. doi: 10.1186/1476-4598-5-26. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Spellmon N, Holcomb J, Trescott L, et al. Structure and function of SET and MYND domain-containing proteins. Int J Mol Sci. 2015;16:1406–28. doi: 10.3390/ijms16011406. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Yi X, Jiang XJ, Fang ZM. Histone methyltransferase SMYD2: ubiquitous regulator of disease. Clin Epigenetics. 2019;11:112. doi: 10.1186/s13148-019-0711-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Wang J, Zhong W, Cheng Q, et al. Histone methyltransferase Smyd2 contributes to blood‐brain barrier breakdown in stroke. Clin Transl Med. 2022;12:e761. doi: 10.1002/ctm2.761. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Zhang X-J, Cheng X, Yan Z-Z, et al. An ALOX12-12-HETE-GPR31 signaling axis is a key mediator of hepatic ischemia-reperfusion injury. Nat Med. 2018;24:73–83. doi: 10.1038/nm.4451. [DOI] [PubMed] [Google Scholar]
18.Chen K, Liu J, Liu S, et al. Methyltransferase SETD2-Mediated Methylation of STAT1 Is Critical for Interferon Antiviral Activity. Cell. 2017;170:492–506. doi: 10.1016/j.cell.2017.06.042. [DOI] [PubMed] [Google Scholar]
19.Qin J-J, Mao W, Wang X, et al. Caspase recruitment domain 6 protects against hepatic ischemia/reperfusion injury by suppressing ASK1. J Hepatol. 2018;69:1110–22. doi: 10.1016/j.jhep.2018.06.014. [DOI] [PubMed] [Google Scholar]
20.Liu Y, Lu T, Zhang C, et al. Activation of YAP attenuates hepatic damage and fibrosis in liver ischemia-reperfusion injury. J Hepatol. 2019;71:719–30. doi: 10.1016/j.jhep.2019.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Wang X, Mao W, Fang C, et al. Dusp14 protects against hepatic ischaemia-reperfusion injury via Tak1 suppression. J Hepatol. 2017 doi: 10.1016/j.jhep.2017.08.032. [DOI] [Google Scholar]
22.Wang P-X, Zhang R, Huang L, et al. Interferon regulatory factor 9 is a key mediator of hepatic ischemia/reperfusion injury. J Hepatol. 2015;62:111–20. doi: 10.1016/j.jhep.2014.08.022. [DOI] [PubMed] [Google Scholar]
23.Huang J, Perez-Burgos L, Placek BJ, et al. Repression of p53 activity by Smyd2-mediated methylation. Nature New Biol. 2006;444:629–32. doi: 10.1038/nature05287. [DOI] [Google Scholar]
24.Cho H-S, Hayami S, Toyokawa G, et al. RB1 methylation by SMYD2 enhances cell cycle progression through an increase of RB1 phosphorylation. Neoplasia. 2012;14:476–86. doi: 10.1593/neo.12656. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Yu Y-Q, Thonn V, Patankar JV, et al. SMYD2 targets RIPK1 and restricts TNF-induced apoptosis and necroptosis to support colon tumor growth. Cell Death Dis. 2022;13:52. doi: 10.1038/s41419-021-04483-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Li LX, Fan LX, Zhou JX, et al. Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease. J Clin Invest. 2017;127:2751–64. doi: 10.1172/JCI90921. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Wu W, Wang J, Xiao C, et al. SMYD2-mediated TRAF2 methylation promotes the NF-κB signaling pathways in inflammatory diseases. Clin Transl Med. 2021;11:e591. doi: 10.1002/ctm2.591. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Rubio-Tomás T. The SMYD family proteins in immunology: An update of their obvious and non-obvious relations with the immune system. Heliyon. 2021;7:e07387. doi: 10.1016/j.heliyon.2021.e07387. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Xu G, Liu G, Xiong S, et al. The Histone Methyltransferase Smyd2 Is a Negative Regulator of Macrophage Activation by Suppressing Interleukin 6 (IL-6) and Tumor Necrosis Factor α (TNF-α) Production. J Biol Chem. 2015;290:5414–23. doi: 10.1074/jbc.M114.610345. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Wang L, Li L, Zhang H, et al. Structure of Human SMYD2 Protein Reveals the Basis of p53 Tumor Suppressor Methylation. J Biol Chem. 2011;286:38725–37. doi: 10.1074/jbc.M111.262410. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Boehm D, Jeng M, Camus G, et al. SMYD2-Mediated Histone Methylation Contributes to HIV-1 Latency. Cell Host Microbe. 2017;21:569–79. doi: 10.1016/j.chom.2017.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Li LX, Zhou JX, Wang X, et al. Cross-talk between CDK4/6 and SMYD2 regulates gene transcription, tubulin methylation, and ciliogenesis. Sci Adv. 2020;6 doi: 10.1126/sciadv.abb3154. [DOI] [Google Scholar]
33.Gao S, Wang Z, Wang W, et al. The lysine methyltransferase SMYD2 methylates the kinase domain of type II receptor BMPR2 and stimulates bone morphogenetic protein signaling. J Biol Chem. 2017;292:12702–12. doi: 10.1074/jbc.M117.776278. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Popov SV, Mukhomedzyanov AV, Voronkov NS, et al. Regulation of autophagy of the heart in ischemia and reperfusion. Apoptosis. 2023;28:55–80. doi: 10.1007/s10495-022-01786-1. [DOI] [PubMed] [Google Scholar]
35.Zeng G, Lian C, Yang P, et al. E3-ubiquitin ligase TRIM6 aggravates myocardial ischemia/reperfusion injury via promoting STAT1-dependent cardiomyocyte apoptosis. Aging (Albany NY) 2019;11:3536–50. doi: 10.18632/aging.101995. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Hilfiker-Kleiner D, Hilfiker A, Fuchs M, et al. Signal transducer and activator of transcription 3 is required for myocardial capillary growth, control of interstitial matrix deposition, and heart protection from ischemic injury. Circ Res. 2004;95:187–95. doi: 10.1161/01.RES.0000134921.50377.61. [DOI] [PubMed] [Google Scholar]
37.Zhong Y, Gu L, Ye Y, et al. JAK2/STAT3 Axis Intermediates Microglia/Macrophage Polarization During Cerebral Ischemia/Reperfusion Injury. Neuroscience. 2022;496:119–28. doi: 10.1016/j.neuroscience.2022.05.016. [DOI] [PubMed] [Google Scholar]
38.Doudin A, Riebeling T, Staab J, et al. Lack of STAT1 co-operative DNA binding protects against adverse cardiac remodelling in acute myocardial infarction. Front Cardiovasc Med. 2023;10:975012. doi: 10.3389/fcvm.2023.975012. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Han Y-F, Zhao Y-B, Li J, et al. Stat3-Atg5 signal axis inducing autophagy to alleviate hepatic ischemia-reperfusion injury. J Cell Biochem. 2018;119:3440–50. doi: 10.1002/jcb.26516. [DOI] [PubMed] [Google Scholar]
40.Zhu W, Mustelin T, David M. Arginine methylation of STAT1 regulates its dephosphorylation by T cell protein tyrosine phosphatase. J Biol Chem. 2002;277:35787–90. doi: 10.1074/jbc.C200346200. [DOI] [PubMed] [Google Scholar]
41.Yamagata K, Daitoku H, Takahashi Y, et al. Arginine methylation of FOXO transcription factors inhibits their phosphorylation by Akt. Mol Cell. 2008;32:221–31. doi: 10.1016/j.molcel.2008.09.013. [DOI] [PubMed] [Google Scholar]
42.Yang J, Huang J, Dasgupta M, et al. Reversible methylation of promoter-bound STAT3 by histone-modifying enzymes. Proc Natl Acad Sci U S A. 2010;107:21499–504. doi: 10.1073/pnas.1016147107. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Pang Q, Zhou S, Liu S, et al. Prognostic role of preoperative albumin-bilirubin score in posthepatectomy liver failure and mortality: a systematic review and meta-analysis. Updates Surg. 2022;74:821–31. doi: 10.1007/s13304-021-01080-w. [DOI] [PubMed] [Google Scholar]
44.Takahashi K, Gosho M, Miyazaki Y, et al. Preoperative albumin-bilirubin score and liver resection percentage determine postoperative liver regeneration after partial hepatectomy. World J Gastroenterol. 2024;30:2006–17. doi: 10.3748/wjg.v30.i14.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

online supplemental file 1

gutjnl-75-2-s001.docx^{(10.5MB, docx)}

DOI: 10.1136/gutjnl-2025-336400

online supplemental file 2

gutjnl-75-2-s002.pptx^{(2.3MB, pptx)}

DOI: 10.1136/gutjnl-2025-336400

Data Availability Statement

Data are available in a public, open access repository. All data relevant to the study are included in the article or uploaded as supplementary information.

[R1] 1.Zhai Y, Petrowsky H, Hong JC, et al. Ischaemia–reperfusion injury in liver transplantation—from bench to bedside. Nat Rev Gastroenterol Hepatol . 2013;10:79–89. doi: 10.1038/nrgastro.2012.225. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] 2.Konishi T, Lentsch AB. Hepatic Ischemia/Reperfusion: Mechanisms of Tissue Injury, Repair, and Regeneration. Gene Expr. 2017;17:277–87. doi: 10.3727/105221617X15042750874156. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R3] 3.Cannistrà M, Ruggiero M, Zullo A, et al. Hepatic ischemia reperfusion injury: A systematic review of literature and the role of current drugs and biomarkers. Int J Surg. 2016;33 Suppl 1:S57–70. doi: 10.1016/j.ijsu.2016.05.050. [DOI] [PubMed] [Google Scholar]

[R4] 4.Huang S, Ju W, Zhu Z, et al. Comprehensive and combined omics analysis reveals factors of ischemia-reperfusion injury in liver transplantation. Epigenomics. 2019;11:527–42. doi: 10.2217/epi-2018-0189. [DOI] [PubMed] [Google Scholar]

[R5] 5.Quesnelle KM, Bystrom PV, Toledo-Pereyra LH. Molecular responses to ischemia and reperfusion in the liver. Arch Toxicol. 2015;89:651–7. doi: 10.1007/s00204-014-1437-x. [DOI] [PubMed] [Google Scholar]

[R6] 6.Brenner C, Galluzzi L, Kepp O, et al. Decoding cell death signals in liver inflammation. J Hepatol. 2013;59:583–94. doi: 10.1016/j.jhep.2013.03.033. [DOI] [PubMed] [Google Scholar]

[R7] 7.Zhou J, Guo L, Ma T, et al. N-acetylgalactosaminyltransferase-4 protects against hepatic ischemia/reperfusion injury by blocking apoptosis signal-regulating kinase 1 N-terminal dimerization. Hepatology. 2022;75:1446–60. doi: 10.1002/hep.32202. [DOI] [PubMed] [Google Scholar]

[R8] 8.Yan Z-Z, Huang Y-P, Wang X, et al. Integrated Omics Reveals Tollip as an Regulator and Therapeutic Target for Hepatic Ischemia-Reperfusion Injury in Mice. Hepatology. 2019;70:1750–69. doi: 10.1002/hep.30705. [DOI] [PubMed] [Google Scholar]

[R9] 9.Eltzschig HK, Eckle T. Ischemia and reperfusion--from mechanism to translation. Nat Med. 2011;17:1391–401. doi: 10.1038/nm.2507. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] 10.Soares ROS, Losada DM, Jordani MC, et al. Ischemia/Reperfusion Injury Revisited: An Overview of the Latest Pharmacological Strategies. Int J Mol Sci. 2019;20:5034. doi: 10.3390/ijms20205034. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Stark GR, Darnell JE., Jr The JAK-STAT pathway at twenty. Immunity. 2012;36:503–14. doi: 10.1016/j.immuni.2012.03.013. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R12] 12.Biggar KK, Li SS-C. Non-histone protein methylation as a regulator of cellular signalling and function. Nat Rev Mol Cell Biol. 2015;16:5–17. doi: 10.1038/nrm3915. [DOI] [PubMed] [Google Scholar]

[R13] 13.Brown MA, Sims RJ, III, Gottlieb PD, et al. Identification and characterization of Smyd2: a split SET/MYND domain-containing histone H3 lysine 36-specific methyltransferase that interacts with the Sin3 histone deacetylase complex. Mol Cancer. 2006;5:26. doi: 10.1186/1476-4598-5-26. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Spellmon N, Holcomb J, Trescott L, et al. Structure and function of SET and MYND domain-containing proteins. Int J Mol Sci. 2015;16:1406–28. doi: 10.3390/ijms16011406. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R15] 15.Yi X, Jiang XJ, Fang ZM. Histone methyltransferase SMYD2: ubiquitous regulator of disease. Clin Epigenetics. 2019;11:112. doi: 10.1186/s13148-019-0711-4. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Wang J, Zhong W, Cheng Q, et al. Histone methyltransferase Smyd2 contributes to blood‐brain barrier breakdown in stroke. Clin Transl Med. 2022;12:e761. doi: 10.1002/ctm2.761. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Zhang X-J, Cheng X, Yan Z-Z, et al. An ALOX12-12-HETE-GPR31 signaling axis is a key mediator of hepatic ischemia-reperfusion injury. Nat Med. 2018;24:73–83. doi: 10.1038/nm.4451. [DOI] [PubMed] [Google Scholar]

[R18] 18.Chen K, Liu J, Liu S, et al. Methyltransferase SETD2-Mediated Methylation of STAT1 Is Critical for Interferon Antiviral Activity. Cell. 2017;170:492–506. doi: 10.1016/j.cell.2017.06.042. [DOI] [PubMed] [Google Scholar]

[R19] 19.Qin J-J, Mao W, Wang X, et al. Caspase recruitment domain 6 protects against hepatic ischemia/reperfusion injury by suppressing ASK1. J Hepatol. 2018;69:1110–22. doi: 10.1016/j.jhep.2018.06.014. [DOI] [PubMed] [Google Scholar]

[R20] 20.Liu Y, Lu T, Zhang C, et al. Activation of YAP attenuates hepatic damage and fibrosis in liver ischemia-reperfusion injury. J Hepatol. 2019;71:719–30. doi: 10.1016/j.jhep.2019.05.029. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R21] 21.Wang X, Mao W, Fang C, et al. Dusp14 protects against hepatic ischaemia-reperfusion injury via Tak1 suppression. J Hepatol. 2017 doi: 10.1016/j.jhep.2017.08.032. [DOI] [Google Scholar]

[R22] 22.Wang P-X, Zhang R, Huang L, et al. Interferon regulatory factor 9 is a key mediator of hepatic ischemia/reperfusion injury. J Hepatol. 2015;62:111–20. doi: 10.1016/j.jhep.2014.08.022. [DOI] [PubMed] [Google Scholar]

[R23] 23.Huang J, Perez-Burgos L, Placek BJ, et al. Repression of p53 activity by Smyd2-mediated methylation. Nature New Biol. 2006;444:629–32. doi: 10.1038/nature05287. [DOI] [Google Scholar]

[R24] 24.Cho H-S, Hayami S, Toyokawa G, et al. RB1 methylation by SMYD2 enhances cell cycle progression through an increase of RB1 phosphorylation. Neoplasia. 2012;14:476–86. doi: 10.1593/neo.12656. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Yu Y-Q, Thonn V, Patankar JV, et al. SMYD2 targets RIPK1 and restricts TNF-induced apoptosis and necroptosis to support colon tumor growth. Cell Death Dis. 2022;13:52. doi: 10.1038/s41419-021-04483-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.Li LX, Fan LX, Zhou JX, et al. Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease. J Clin Invest. 2017;127:2751–64. doi: 10.1172/JCI90921. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R27] 27.Wu W, Wang J, Xiao C, et al. SMYD2-mediated TRAF2 methylation promotes the NF-κB signaling pathways in inflammatory diseases. Clin Transl Med. 2021;11:e591. doi: 10.1002/ctm2.591. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] 28.Rubio-Tomás T. The SMYD family proteins in immunology: An update of their obvious and non-obvious relations with the immune system. Heliyon. 2021;7:e07387. doi: 10.1016/j.heliyon.2021.e07387. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R29] 29.Xu G, Liu G, Xiong S, et al. The Histone Methyltransferase Smyd2 Is a Negative Regulator of Macrophage Activation by Suppressing Interleukin 6 (IL-6) and Tumor Necrosis Factor α (TNF-α) Production. J Biol Chem. 2015;290:5414–23. doi: 10.1074/jbc.M114.610345. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R30] 30.Wang L, Li L, Zhang H, et al. Structure of Human SMYD2 Protein Reveals the Basis of p53 Tumor Suppressor Methylation. J Biol Chem. 2011;286:38725–37. doi: 10.1074/jbc.M111.262410. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R31] 31.Boehm D, Jeng M, Camus G, et al. SMYD2-Mediated Histone Methylation Contributes to HIV-1 Latency. Cell Host Microbe. 2017;21:569–79. doi: 10.1016/j.chom.2017.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R32] 32.Li LX, Zhou JX, Wang X, et al. Cross-talk between CDK4/6 and SMYD2 regulates gene transcription, tubulin methylation, and ciliogenesis. Sci Adv. 2020;6 doi: 10.1126/sciadv.abb3154. [DOI] [Google Scholar]

[R33] 33.Gao S, Wang Z, Wang W, et al. The lysine methyltransferase SMYD2 methylates the kinase domain of type II receptor BMPR2 and stimulates bone morphogenetic protein signaling. J Biol Chem. 2017;292:12702–12. doi: 10.1074/jbc.M117.776278. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Popov SV, Mukhomedzyanov AV, Voronkov NS, et al. Regulation of autophagy of the heart in ischemia and reperfusion. Apoptosis. 2023;28:55–80. doi: 10.1007/s10495-022-01786-1. [DOI] [PubMed] [Google Scholar]

[R35] 35.Zeng G, Lian C, Yang P, et al. E3-ubiquitin ligase TRIM6 aggravates myocardial ischemia/reperfusion injury via promoting STAT1-dependent cardiomyocyte apoptosis. Aging (Albany NY) 2019;11:3536–50. doi: 10.18632/aging.101995. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] 36.Hilfiker-Kleiner D, Hilfiker A, Fuchs M, et al. Signal transducer and activator of transcription 3 is required for myocardial capillary growth, control of interstitial matrix deposition, and heart protection from ischemic injury. Circ Res. 2004;95:187–95. doi: 10.1161/01.RES.0000134921.50377.61. [DOI] [PubMed] [Google Scholar]

[R37] 37.Zhong Y, Gu L, Ye Y, et al. JAK2/STAT3 Axis Intermediates Microglia/Macrophage Polarization During Cerebral Ischemia/Reperfusion Injury. Neuroscience. 2022;496:119–28. doi: 10.1016/j.neuroscience.2022.05.016. [DOI] [PubMed] [Google Scholar]

[R38] 38.Doudin A, Riebeling T, Staab J, et al. Lack of STAT1 co-operative DNA binding protects against adverse cardiac remodelling in acute myocardial infarction. Front Cardiovasc Med. 2023;10:975012. doi: 10.3389/fcvm.2023.975012. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] 39.Han Y-F, Zhao Y-B, Li J, et al. Stat3-Atg5 signal axis inducing autophagy to alleviate hepatic ischemia-reperfusion injury. J Cell Biochem. 2018;119:3440–50. doi: 10.1002/jcb.26516. [DOI] [PubMed] [Google Scholar]

[R40] 40.Zhu W, Mustelin T, David M. Arginine methylation of STAT1 regulates its dephosphorylation by T cell protein tyrosine phosphatase. J Biol Chem. 2002;277:35787–90. doi: 10.1074/jbc.C200346200. [DOI] [PubMed] [Google Scholar]

[R41] 41.Yamagata K, Daitoku H, Takahashi Y, et al. Arginine methylation of FOXO transcription factors inhibits their phosphorylation by Akt. Mol Cell. 2008;32:221–31. doi: 10.1016/j.molcel.2008.09.013. [DOI] [PubMed] [Google Scholar]

[R42] 42.Yang J, Huang J, Dasgupta M, et al. Reversible methylation of promoter-bound STAT3 by histone-modifying enzymes. Proc Natl Acad Sci U S A. 2010;107:21499–504. doi: 10.1073/pnas.1016147107. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Pang Q, Zhou S, Liu S, et al. Prognostic role of preoperative albumin-bilirubin score in posthepatectomy liver failure and mortality: a systematic review and meta-analysis. Updates Surg. 2022;74:821–31. doi: 10.1007/s13304-021-01080-w. [DOI] [PubMed] [Google Scholar]

[R44] 44.Takahashi K, Gosho M, Miyazaki Y, et al. Preoperative albumin-bilirubin score and liver resection percentage determine postoperative liver regeneration after partial hepatectomy. World J Gastroenterol. 2024;30:2006–17. doi: 10.3748/wjg.v30.i14.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

SMYD2-mediated methylation of STAT1 protects against hepatic ischaemia/reperfusion injury by blocking JAK-STAT1 signalling pathways

Zhiyong Yang

Yufeng Hu

Chunyong Yang

Yujie Li

Xueyuan Zhong

Zhenfu Wu

Yingjie Zuo

Shanyu Gan

Lin Chen

Ziyang Zeng

Guiheng Qi

Yuanbao Chen

Junjie Zhou

Xiao-Jing Zhang

Hongliang Li

Bin Yi

Abstract

Background

Objective

Design

Results

Conclusion

WHAT IS ALREADY KNOWN ON THIS TOPIC

WHAT THIS STUDY ADDS

HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY

Introduction

Materials and methods

Human liver samples

Animals

Statistical analysis

Results

SMYD2 participates in the process of hepatic I/R through the JAK-STAT1 signalling pathway

SMYD2 expression negatively correlated with liver dysfunction in clinical hepatic I/R injury

Overexpression of SMYD2 demonstrates a protective effect on hepatocyte injury induced by hepatic I/R in hepatocytes

STAT1 is required for the regulation effects of SMYD2 on hepatic I/R

SMYD2 interacts with STAT1 and suppresses its nuclear translocation

SMYD2 directly suppresses STAT1 phosphorylation via its methyltransferase activity targeted at lysine 175

SMYD2 deficiency aggravates liver inflammatory response and damage during hepatic I/R injury

SMYD2 overexpression inhibits inflammation and apoptosis in the liver of mice

Discussion

Supplementary material

Footnotes

Data availability statement

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases