Abstract
Objective
The objective of this study was to investigate the effects of rituximab (RTX) intrathecal injection on antibody levels in serum and cerebrospinal fluid (CSF), hippocampal tissue and neuronal injury and the behaviour of central neuropsychological lupus erythematosus (cNPSLE) model mice and to further explore the effects of RTX on microglia (MG) polarisation and related signalling pathways.
Methods
Female MRL/lpr mice received intrathecal RTX, with C57BL/6 and MRL/mpj mice as controls. Behavioural performance was evaluated using the open field test, novel object recognition and Porsolt swim task. Autoantibody levels in serum and CSF were measured by ELISA. Hippocampal pathology was assessed by H&E and Nissl staining. M1-type MG activation (Iba-1+/CD32+), CD20+ B-cell infiltration and immunoglobulin G (IgG) deposition were examined via immunohistochemistry and immunofluorescence. Immune transcriptome sequencing and in vitro polarisation assays were used to identify regulatory pathways.
Results
Intrathecal injection of RTX reduced the levels of antibodies in the serum and CSF of MRL/lpr mice and alleviated brain tissue injury and neuronal injury. Moreover, hippocampal MG M1 polarisation was inhibited, and the number of CD20+ B cells and expression of IgG were reduced. Transcriptome sequencing revealed that the cAMP-dependent protein kinase A (cAMP/PKA) pathway may be involved in the activation of M1-type MG in the hippocampus. In vitro cell experiments demonstrated that RTX could reduce the expression of kinase cAMP-activated catalytic subunit alpha and phosphorylated-cAMP response element-binding protein/cAMP response element-binding pResponse Element-Binding Protein through the suppression of the cAMP/PKA pathway, thus inhibiting M1-type MG activation.
Conclusion
The data in this study revealed that the intrathecal injection of RTX can attenuate M1-type MG activation-mediated inflammatory neuronal injury in cNPSLE model mice.
Keywords: Autoimmune Diseases; B-Lymphocytes; Lupus Erythematosus, Systemic
WHAT IS ALREADY KNOWN ON THIS TOPIC
Central neuropsychiatric lupus erythematosus (cNPSLE) is a severe manifestation of SLE characterised by neuroinflammation, microglial activation and neuronal injury. Although rituximab (RTX) has shown therapeutic potential in refractory SLE, its effects on intrathecal immune regulation and microglial polarisation in cNPSLE remain poorly understood.
WHAT THIS STUDY ADDS
This study demonstrates that intrathecal administration of RTX reduces serum and cerebrospinal fluid autoantibody levels, alleviates hippocampal inflammatory infiltration and neuronal damage and improves anxiety-like and cognitive behaviours in cNPSLE mice. Mechanistically, RTX inhibits M1-type microglial activation by suppressing the cAMP/PKA/CREB signalling pathway, thereby mitigating neuroinflammation and neuronal injury.
HOW THIS STUDY MIGHT AFFECT RESEARCH, PRACTICE OR POLICY
These findings provide experimental evidence supporting intrathecal RTX as a potential therapeutic approach for cNPSLE. Recognition of its role in regulating microglial polarisation and neuroinflammatory signalling may inform future translational studies and guide individualised treatment strategies for patients with neuropsychiatric lupus.
Introduction
Central neuropsychological lupus erythematosus (cNPSLE) is a serious neurological and psychiatric complication arising from SLE and is one of the leading causes of death in patients with SLE.1 The various clinical manifestations of cNPSLE are associated with its complex pathogenesis. Various pathogenic processes, such as immune cell overactivation, autoantibody generation and inflammatory mediator production, disrupt the blood-brain barrier (BBB) to trigger an inflammatory response, resulting in the activation of glial cells, neurodegeneration and behavioural disorders. However, the specific pathogenesis of cNPSLE remains largely unclear.2,4
Resident microglia (MG) are the main immune cells of the central nervous system (CNS) and play important roles in activating inflammatory responses, shaping neural circuit connections and pruning synapses role in via the release of cytokines and the phagocytosis of presynaptic/postsynaptic elements. In cNPSLE, MG phagocytosis of neurons and synapses is mediated mainly by antibodies and complement proteins in the cerebrospinal fluid (CSF).5,7 In addition, various inflammatory mediators can also activate MG.8 9 Pathology studies have revealed a large amount of reactive MGs in the brain tissues of cNPSLE patients.10 In clinical studies, Ercan et al used diffusion-weighted imaging technology to find that the levels of metabolites from neurons and glial cells in the brains of cNPSLE patients were increased, which was related to neuronal oedema and MG-induced inflammation, indicating that MG is involved in CNS injury.11 Recent studies have shown that C1q in the brain can regulate the synaptic loss due to synaptic pruning by MG, which is key in the pathogenesis of cNPSLE.12 These study results have shown that MG activation plays important roles in the development of cNPSLE and related brain injury.
Hormones, combined with glucocorticoids, biological inhibitors and intrathecal injections, have been used to treat cNPSLE, but owing to the high degree of disease heterogeneity, these combination treatments may not be sufficient.13 This is in part due to the limited penetration of drugs into the CNS through the BBB; for example, the levels of cyclophosphamide and rituximab (RTX) in CSF are only 20% and 0.1%, respectively, of those in serum.14 An international retrospective study evaluated the safety and efficacy of the intrathecal injection of RTX for the treatment of children with B-cell lymphoma (CD20+), and the results revealed that among the patients receiving intrathecal injection of RTX, 72 patients (20%), treated with or without other CNS-targeted therapies, achieved CNS remission. This international retrospective study also revealed that the intrathecal injection of RTX had a significant therapeutic effect and relatively limited toxicity.15 RTX specifically binds to the CD20 antigen on the surface of B cells, thus inducing B-cell apoptosis and inhibiting B-cell proliferation. Although RTX does not directly target MG, through B-cell depletion, the levels of tumour necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in the microenvironment can be reduced, thereby increasing IL-10 expression in MG and promoting tissue repair. Overall, the protective effect of RTX intrathecal injection and its effect on the biological function of MG was investigated in this study, thereby determining the potential value of RTX in the treatment of cNPSLE and offering new strategies for controlling and treating cNPSLE.
Materials and methods
Chemicals and reagents
RTX was obtained from Innovent Biologics (GYZ Zi: S20200022). Human immunoglobulin G1 (IgG1) isotype (HY-NP189A) was purchased from MedChemExpress. ANA (LJS-M-0155), anti-double stranded DNA (dsDNA) antibodies (LJS-M-2050), IgG (LJS-M-071) and complement C3 (LJS-M-0141) ELISA kits were purchased from Wuhan Lingjiesi Biotechnology.
Animals
Female specific pathogen-free grade C57BL/6 mice (6–8 weeks), wild-type control MRL/mpj mice and lupus-prone MRL/lpr mice (n=8 per group) were purchased from Cavens Laboratory Animal (Changzhou, China). All animals were housed under standard laboratory conditions (temperature 22±2°C, relative humidity 50–60% and a 12 hours light/12 hours dark cycle) with free access to food and water. The animals were allowed to acclimatise for 1 week prior to experimental procedures, and their health status was monitored daily throughout the study.
C57BL/6 mice (normal control group) and MRL/mpj mice (wild-type control group) were maintained for 4 weeks without intervention. MRL/lpr mice allocated to the model group received weekly intrathecal saline injections beginning at 12 weeks of age for four consecutive weeks. MRL/lpr mice in the RTX-treated group were maintained for the same period and subsequently administered weekly intrathecal injections of RTX (0.5 mg/kg) starting at 12 weeks of age for 4 weeks. Animal health status, including food and water consumption and survival, was monitored daily throughout the study.
Behavioural test
Standardised behavioural testing protocols were used to evaluate anxiety-like behaviours and cognitive function in each group of mice at 16 weeks of age. The behavioural tests included the open-field test (OFT), novel object recognition (NOR) and Porsolt swim task (PST).
Serum and CSF test
According to the manufacturer’s instructions provided with the ELISA kits, the concentrations of ANA, anti-dsDNA antibodies, IgG and complement C3 were measured in mouse serum and CSF.
Histopathology
Mice were euthanised at 16 weeks of age, and hippocampal tissues were collected for histological analysis. H&E staining was performed to assess pathological changes and inflammatory cell infiltration. Nissl staining was used to detect neuronal apoptosis or the depletion of Nissl+ neurons within the hippocampal circuits associated with emotion and learning in MRL/lpr mice. Immunohistochemistry (IHC) was employed to assess the expression of IgG (1:400, A10520, Thermo) and CD20+ B cells (1:100, 70168, CST) in the hippocampus. Immunofluorescence (IF) staining was conducted to visualise the colocalisation of Iba-1 (a microglial marker, 1:100, ab283319, Abcam) and CD32 (an M1 phenotype marker, 1:100, A01450-1, Boster), delineating the polarisation characteristics of MG.
Reverse transcription quantitative PCR
Total RNA was extracted from mouse hippocampal tissue using the Trizol lysis method (15596026CN, Thermo Fisher, Massachusetts, USA). Reverse transcription was performed with the PrimeScript II first Strand complementary deoxyribonucleic acid (cDNA) Synthesis Kit (6210A, Takara, Japan) to synthesise cDNA. Quantitative real-time PCR (qPCR) was conducted using SYBR FAST qPCR Master Mix (KM4101, KAPA Biosystems, Massachusetts, USA) on a PCR system (PR-96, Hangzhou Bioer Technology). Relative gene expression levels were calculated using the 2− ΔΔCt method. Specific primers (provided by Beijing Tsingke Biotech) are listed in table 1.
Table 1. Primers used for q-PCR in this study.
| Gene | Primer | Sequence (5’−3’) | PCR products |
|---|---|---|---|
| Mus GAPDH | Forward | ATGGCCTTCCGTGTTCCTAC | 167bp |
| Reverse | AAGTCGCAGGAGACAACCTG | ||
| Mus iNOS | Forward | AGGGAATCTTGGAGCGAGTTG | 133bp |
| Reverse | GTGAGGGCTTGGCTGAGTGAG | ||
| Mus TNF-α | Forward | AGCACAGAAAGCATGATCCG | 212bp |
| Reverse | CTGATGAGAGGGAGGCCATT | ||
| Mus IL-6 | Forward | CACAGAGGATACCACTCCCAACAGA | 124bp |
| Reverse | ACAATCAGAATTGCCATTGCACAAC | ||
| Mus IFNα | Forward | CAATGACCTGCAAGGCTGTC | 183bp |
| Reverse | GAAGACAGGGCTCTCCAGAC | ||
| Mus BAFF | Forward | GTGGTGAGGCAAACAGGCTA | 271bp |
| Reverse | CGTCTCCGTTGCGTGAAATC |
BAFF, B-cell activating factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IFNα, interferon-α; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; qPCR, quantitative real-time PCR; TNF-α, tumour necrosis factor-alpha.
Western blot
Rat hippocampal homogenates (100 mg) were lysed in radio immunoprecipitation assay (RIPA) lysis buffer to extract total protein. The proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked at room temperature for 2 hours in 5% bovine serum albumin (BSA) dissolved in tris-buffered saline with tween (TBST). Primary antibodies were diluted as follows and incubated overnight at 4.0°C: kinase cAMP-activated catalytic subunit alpha (PRKACA, 1:5000, 27 398–1-AP, Proteintech Group); phosphorylated cAMP response element-binding protein (p-CREB1, Ser133, 1:6000, 28 792–1-AP, Proteintech Group, China); CREB (1:30000, 67 927–1-Ig, Proteintech Group, China). After primary antibody incubation, membranes were washed three times with TBST and then incubated with appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at 25°C. Signal detection and quantification were performed using a chemiluminescence imaging analyser (SH-523, Shenhua Science Technology, China) and Image-Pro Plus V.6.0 (Image-Pro Plus, RRID:SCR_007369).
Cell culture and treatment
BV-2 mouse microglial cells (LJS-m011, Wuhan Lingjiesi Biotechnology) were subjected to M1 polarisation using 100 ng/mL lipopolysaccharide (LPS) to establish an M1-type polarisation model.16 17 Cell viability changes after treatment with MG-conditioned medium were assessed using the Cell Counting Kit-8 (). BV2 cells were exposed to different concentrations of RTX to determine the optimal concentration (denoted as A). Reverse transcription (RT)-qPCR was used to measure the expression of M1 MG pro-inflammatory cytokines (inducible nitric oxide synthase (iNOS), TNF-α, IL-6), along with interferon-α (IFN-α) and B-cell activating factor of the TNF family (BAFF). Immunofluorescence was performed to assess changes in CD32 expression (M1 marker, 1:100, A01450-1, Boster). Western blotting was employed to detect the expression of candidate signalling pathway proteins.
RNA sequencing and bioinformatics analysis
Total RNA was extracted from hippocampal tissue, and RNA integrity was assessed using an Agilent 2100 Bioanalyser. Polyadenylated messenger RNA (mRNA) was enriched using Oligo(dT) magnetic beads and fragmented into short fragments, followed by synthesis of first-strand cDNA using random hexamer primers and second-strand synthesis with DNA polymerase I and RNase H. After end repair, A-tailing and adaptor ligation, cDNA libraries were purified, size-selected and amplified by PCR. Qualified libraries were sequenced on an Illumina platform to generate paired-end reads. Raw reads were quality-controlled to remove low-quality reads and adaptor sequences, yielding clean reads for downstream analysis.
Clean reads were aligned to the reference genome, and alignment quality was assessed through read distribution and coverage statistics. Gene expression levels were quantified, and differential expression analysis was performed using a threshold of |log2 fold change|≥2 and adjusted p value ≤0.05. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were conducted based on the differentially expressed genes to identify biologically relevant signalling pathways.
Statistical analysis
Statistical analysis was performed using SPSS V.20.0 (Chicago, Illinois, USA). Data originated from a minimum of three independent experiments and are shown as the SD of the mean. One-way analysis of variance or independent samples t-tests for multiple group comparisons were used to analyse and compare the data. A p value of <0.05 was considered statistically significant.
Results
Intrathecal injection of RTX improved neuropsychiatric symptoms and reduced antibody expression in the CSF and peripheral blood of MRL/lpr mice
The results of the OFT (figure 1A, C) revealed that the total time spent in the peripheral zone was increased and the total distance travelled (%) in the central zone was decreased in the MRL/lpr and MRL/mpj mice compared with the control mice, exhibiting anxiety-like behaviours. After RTX intervention, the mice remained in the central zone, and anxiety-like behaviour was mitigated. The NOR results (figure 1B, D) revealed that mice in the control and MRL/mpj groups spent more time exploring novel objects than familiar objects, whereas the mice in the MRL/lpr group spent less time exploring novel objects. Compared with those in the MRL/mpj and control groups, the discrimination index of the MRL/lpr group was significantly lower. However, after RTX intervention, the time spent exploring novel objects and the discrimination index increased. The PST results (figure 1E) revealed that the MRL/lpr mice exhibited significantly increased immobility time and decreased activity time in the OST compared with the MRL/mpj and control mice; after the RTX intervention, the immobility time significantly decreased. Moreover, serum and CSF antibody tests revealed that, compared with the control group, the MRL/lpr and MRL/mpj groups had higher autoantibody titres (including anti-ANA, anti-dsDNA and IgG titres) and lower complement C3 levels (figure 1F–M), indicating that the systemic autoimmune response and complement system were significantly activated in MRL/lpr mice. After the RTX intervention, autoantibody titres in the serum and CSF significantly decreased and the level of complement C3 increased in the MRL/lpr group. In summary, these data indicated that the intrathecal injection of RTX can mitigate anxiety behaviour and reduce the levels of autoantibodies in the serum and CSF of MRL/lpr mice.
Figure 1. (A) Open field test (OFT) in mice; (B) novel object recognition (NOR) test in mice; (C) proportion of time spent in the central area during the OFT; (D) proportion of time spent exploring the novel object during the NOR test; (E) duration of immobility for each group in the Porsolt forced swim test; (F–I) ELISA results showing serum levels of ANA, anti-dsDNA antibodies, IgG and complement C3; (J–M) ELISA results showing cerebrospinal fluid levels of ANA, anti-dsDNA antibodies, IgG and complement C3. *p<0.05, **p<0.01. anti-dsDNA; anti-double stranded DNA; IgG, immunoglobulin G; Rituxi, rituximab.
Intrathecal injection of RTX alleviated brain tissue injury in MRL/lpr mice and inhibited MG M1 polarisation
The results of H&E staining revealed extensive neuronal death in the brains of MRL/lpr mice (figure 2A). Nissl staining revealed that MRL/lpr mice lost Nissl+ neurons in the hippocampal circuits (figure 2B). IF was used to evaluate the expression of CD20+ B cell and IgG in the hippocampus (figure 2C, E), RT-qPCR was used to measure the expression of IFNα and BAFF. The results revealed that, compared with the control group, the MRL/lpr groups had an increased percentage of CD20+ B cells and upregulated IgG, IFNα and BAFF expression in the hippocampus. In the RTX group, the number of dead neurons and neuronal Nissl body damage in the hippocampus was reduced, the percentage of CD20+ B cells and expression of IgG, IFNα and BAFF in the hippocampus were significantly reduced and the immune response was suppressed, which led to the improvement of the neuropsychiatric symptoms (figure 2D, F, L, M). However, the specific mechanism remains unclear. Previous studies have shown that MG activation is a key mediator of the pathogenesis of cNPSLE; therefore, the effect of the intrathecal injection of RTX on MG activation in the hippocampus was further investigated. M1-type MG activation was evaluated by co-immunostaining IBA-1/CD32 in hippocampal sections, and the results revealed that the percentage of M1-type MG was significantly greater in the MRL/lpr group than that in the MRL/mpj and control groups; after the RTX treatment, the percentage of M1-type MG in the intervention group was significantly lower than that in the MRL/lpr group (figure 2G, H). RT-qPCR was used to measure the mRNA levels of proinflammatory cytokines (such as iNOS, TNF-α and IL-6) in the hippocampi of the mice in each group, and results showed that, compared with those in the MRL/mpj and control mice, the levels of proinflammatory cytokines in the hippocampi of the MRL/lpr mice were increased; after the RTX treatment, the levels of related proinflammatory cytokines in the intervention group were significantly decreased, indicating that the MG M1 polarisation was inhibited (figure 2I–K).
Figure 2. (A) H&E staining showing pathological changes; (B) Nissl staining illustrating changes in Nissl bodies; (C) immunofluorescence detection of CD20 expression; (D) relative expression levels of CD20 in each group; (E) immunofluorescence detection of IgG expression; (F) relative expression levels of IgG in each group; (G) immunofluorescence detection of Iba-1 and CD32 expression in each group; (H) proportion of Iba-1 and CD32 positive cells in each group; (I–K) RT-qPCR analysis of iNOS, TNF-α and IL-6 expression in mouse brain tissue; (L–M) RT-qPCR analysis of IFNα and BAFF expression in mouse brain tissue. *p<0.05, **p<0.01. BAFF, B-cell activating factor; Iba-1, ionised calcium-binding adapter molecule 1; IFN, interferon; IgG, immunoglobulin G; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; Rituxi, rituximab; RT-qPCR, reverse transcription quantitative PCR; TNF, tumour necrosis factor.
Transcriptomic analysis of potential mechanisms underlying the regulation of MG M1 polarisation by RTX intrathecal injection
To identify the regulators for the regulation of the MG M1 polarisation by the intrathecal injection of RTX, transcriptome sequencing analysis of the hippocampi of 16-week-old MRL/mpj versus MRL/lpr and MRL/lpr versus RTX mice was performed. The MRL/mpj versus MRL/lpr transcriptome assay revealed 24 551 genes and a subsequent screen revealed 261 differentially expressed genes (figure 3A). The MRL/lpr versus RTX transcriptome assay revealed 24 243 genes, and a subsequent screen revealed 211 differentially expressed genes (DEGs) (figure 3B). A Venn diagram revealed 34 shared DEGs between the two groups (figure 3C). GO enrichment analysis and KEGG pathway enrichment analysis were performed on the DEGs (figure 3D–G). The KEGG results showed that the two DEG sets were associated with the cAMP signalling pathway, whereas six DEGs in MRL/mpj versus MRL/lpr and seven DEGs in MRL/lpr versus RTX were associated with the cAMP signalling pathway.
Figure 3. (A) Volcano plot of differentially expressed genes between the MRL/mpj group and the MRL/lpr group; (B) volcano plot of differentially expressed genes between the MRL/lpr group and the rituximab group; (C) Venn diagram of differentially expressed genes from the two comparisons; (D, F) GO analysis and KEGG analysis of differentially expressed genes between the MRL/mpj group and the MRL/lpr group; (E, G) GO analysis and KEGG analysis of differentially expressed genes between the MRL/lpr group and the rituximab (RTX) group. GABA, gamma-aminobutyric acid; GnRH, gonadotropin-releasing hormone; GO, gene ontology; GTP, guanosine triphosphate; IL, interleukin; KEGG, Kyoto Encyclopedia of Genes and Genomes; NOD, nucleotide-binding oligomerisation domain; PKG, protein kinase G; Th, T helper; TRP, transient receptor potential.
Effect of RTX on the cAMP signalling pathway
cAMP binds to the regulatory subunit of PKA to release the catalytic subunit (PRKACA) and enter the nucleus. PRKACA phosphorylates various target proteins, including CREB and p-CREB, thereby regulating neuronal proliferation, differentiation, survival and synaptic plasticity.18 To verify the effect of RTX on the cAMP signalling pathway, the expression of cAMP signalling pathway members in mouse hippocampal tissue was detected by western blot (WB) analysis, and the results showed that, compared with those in the control group, the expression levels of PRKACA and p-CREB/CREB in the MRL/lpr and MRL/mpj groups were significantly reduced; after the RTX intervention, the expression levels of PRKACA and p-CREB/CREB in the RTX group were increased compared with those in the MRL/lpr group (figure 4B–D). The results revealed that the cAMP signalling pathway was inhibited in the MRL/lpr model group, and the inhibition of the cAMP signalling pathway could be abrogated after intervention with RTX.
Figure 4. (A) Heatmap depicting differentially expressed genes related to the cAMP signalling pathway in each group; (B) Western blot analysis of PRKACA, phosphorylated CREB (p-CREB) and total CREB expression; (C) quantitative analysis of PRKACA expression normalised to GAPDH in each group; (D) quantitative analysis of the p-CREB/CREB ratio in each group. *p<0.05, **p<0.01. cAMP, cyclic adenosine monophosphate; CREB, cAMP response element-binding protein; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PRKACA, protein kinase cAMP-activated catalytic subunit alpha.
RTX inhibited the activation of the cAMP/PKA signalling pathway in BV2 cells
The results of the CCK-8 experiment revealed that RTX at 5 µg/mL and 10 µg/mL could mitigate BV-2 cell damage caused by inflammation (figure 5A, B). The expression of IFNα and BAFF in the BV-2 cells in each group was measured via RT-qPCR, and the results revealed that LPS caused a significant increase in the expression of IFNα and BAFF in the BV-2 cells, and the degree of inflammation increased. After RTX intervention, the expression of IFNα and BAFF in the BV-2 cells was significantly reduced, and inflammation was relieved. After intervention with a cAMP pathway inhibitor, (N-[2-(p-bromocinnamylamino) ethyl]−5-isoquinolinesulfonamide) (H89), the effect of RTX was abrogated (figure 5C, D). The expression of the M1 MG marker (CD32) was detected by IF (figure 5E, F), and the expression of iNOS, TNF-α and IL-6 in BV2 cells was measured by RT-qPCR (figure 5G–I). Compared with that in the control group, the number of CD32+ cells and the expression of iNOS, TNF-α and IL-6 in BV2 cells in the inflammatory model were increased, indicating a significant increase in the level of MG M1 polarisation in BV2 cells. After RTX intervention, MG M1 polarisation was inhibited. After combination treatment with H89, the inhibitory effect of RTX on the MG M1 polarisation was reduced, suggesting that RTX regulates MG polarisation through the cAMP signalling pathway. Moreover, the expression of the cAMP signalling pathway-related proteins PRKACA and p-CREB/CREB was detected via WB analysis (figure 5J–L), and the results showed that RTX inhibited the abnormally activated cAMP signalling pathway in BV2 cells in the inflammation model.
Figure 5. (A) CCK-8 assay evaluating the effect of different concentrations of rituximab on BV-2 cell viability; (B) CCK-8 assay screening the effective concentration of rituximab on BV-2 cells post-LPS treatment; (C–D) RT-qPCR analysis of IFNa and BAFF expression in BV-2 cells across groups; (E) immunofluorescence detection of CD32 expression; (F) relative fluorescence intensity of CD32 in each group; (G–I) RT-gPCR analysis of iNOS, TNF-α and IL-6 expression in BV-2 cells across groups; (J–L) western blot analysis of PRKACA, phosphorylated CREB (p-CREB) and total CREB expression. *p<0.05, **p<0.01. BAFF, B-cell activating factor; CCK-8, Cell Counting Kit-8; CREB, cAMP response element-binding protein; IFN, interferon; IL-6, interleukin-6; iNOS, inducible nitric oxide synthase; LPS, lipopolysaccharide; PRKACA, kinase cAMP-activated catalytic subunit alpha; RT-qPCR, reverse transcription quantitative PCR; TNF, tumour necrosis factor.
Given that RTX is a chimeric anti-CD20 IgG1 monoclonal antibody, an IgG1 isotype control was included to exclude potential nonspecific effects mediated by IgG1. As shown in online supplemental figure 1A, treatment with IgG1 alone did not improve the viability of BV-2 cells following LPS stimulation. Consistently, RT-qPCR analysis demonstrated that IgG1 alone failed to reduce the LPS-induced upregulation of IFNα and BAFF in BV-2 cells (online supplemental figure 1B, C). Immunofluorescence analysis further revealed that IgG1 treatment did not decrease the expression of CD3 in LPS-stimulated BV-2 cells (online supplemental figure 1D, E). Additionally, IgG1 alone did not attenuate the LPS-induced expression of iNOS, TNF-α and IL-6 in BV-2 cells (online supplemental figure 1F–H).
Collectively, these results indicate that the anti-inflammatory and antipolarisation effects observed in BV-2 cells are not attributable to nonspecific IgG1 exposure, but rather reflect the specific biological activity of RTX.
Discussion
This study revealed that the intrathecal injection of RTX was safe, and the survival rate of the mice in the intervention group was 100%, which was consistent with previous studies.19 Intrathecal injection of RTX can reduce the expression of pro-inflammatory cytokines, decrease the levels of antibodies in serum and CSF, alleviate neurological damage in brain tissues, decrease the percentage of CD20+ B cells and IgG deposition in hippocampus and suppress MG M1 polarisation, thus alleviating anxiety-like behaviour and cognitive dysfunction in MRL/lpr mice. Drugs administered via the intrathecal injection route can bypass the BBB to achieve neuroprotective effects.
Previous studies have shown that MG activation can increase the release of cytokines and chemokines and enhance antigen presentation. Even if the BBB is intact in the early stage of cNPSLE, in situ activation of MG can induce the expression of pro-inflammatory cytokines in the brain and mediate synapse loss through the abnormal pruning of neural synapse phagocytosis to disrupt new neuron formation in the hippocampus. In addition, during the nephritis stage, the BBB is destroyed, which allows peripheral immune components, especially B cells, to infiltrate the hippocampus and aggravate local inflammation.5 12 20 Intracerebral injection of lupus serum IgG causes an MG inflammatory response through the involvement of the Fc signalling pathway and is regulated by B-cell-activating factors, suggesting that the activation of MG and the infiltration of immune components such as B cells into the CNS are key in the pathogenesis of cNPSLE.21 Currently, RTX can be used to treat refractory SLE with renal and NP symptoms.22 This study revealed that the intrathecal injection of RTX could reduce the levels of antibodies in CSF and serum and inhibit the infiltration of immune cells such as B cells in the hippocampi of mice, thereby inhibiting the activation of M1-type MG, reducing the expression of proinflammatory cytokines and mitigating neuropsychiatric behaviours. However, the specific mechanism remains unclear. Therefore, RNA sequencing was performed on the hippocampal tissues of the mice in the MRL/mpj and MRL/lpr and MRL/mpj and RTX groups. The results revealed significant differences in cAMP signalling pathway activity between the MRL/lpr, MRL/mpjp and RTX intervention groups. As an important second messenger, cAMP can regulate immune cell function through PKA and EPAC; therefore, we speculated that this might be one of the mechanisms by which RTX treatment alleviates brain damage in patients with cNPSLE.
The cAMP/PKA/CREB signalling pathway plays an important role in the pathogenesis of NPSLE by regulating inflammation, neural apoptosis, neuroplasticity and BBB integrity.23 24 Studies at the cellular level have revealed that RTX at 5–10 µg/mL could significantly inhibit the secretion of proinflammatory cytokines, reduce the activation of M1-type MG and inhibit the cAMP/PKA/CREB signalling pathway, which plays an important role in regulating synaptic plasticity, memory formation and the cellular stress response. H89 is often used as a ‘PKA-specific inhibitor’ to study PKA-involved signalling pathways.25 After H89 treatment, the expression of PRKACA and CREB/p-CREB decreased, the expression of proinflammatory cytokines increased in M1-type BV2 cells, and the fluorescence intensity of CD32 cells quantitatively increased, as shown by IF staining, suggesting that the intrathecal injection of RTX may inhibit MG M1 polarisation and reduce inflammatory cytokine levels via cAMP/PKA signalling pathway.
Here, our study still has some limitations. Although the MRL/lpr mouse model provides valuable mechanistic insights into lupus-related neuroinflammation under controlled experimental conditions, it cannot fully recapitulate the complex clinical heterogeneity of NPSLE patients who are often exposed to multiple medications and diverse autoantibody profiles. Second, some inflammatory mediators, such as IL-6, may originate from cells other than MG. Our mechanistic analyses were primarily conducted on hippocampal tissue, which may not precisely reflect the underlying mechanisms by which RTX ameliorates cNPSLE. Therefore, in future studies, we plan to employ single-cell transcriptome or double-labelling IF to elucidate the precise mechanisms of RTX in cNPSLE. If future studies confirm that this technique can be safely and effectively implemented, the potential neurotoxicity of RTX should still be carefully considered. Therefore, intrathecal administration of RTX is recommended only for patients with diffuse and refractory cNPSLE who have not responded to glucocorticoids, immunosuppressants or other biologic agents.
In conclusion, the effects of intrathecal injection of RTX on MG-related diseases involving neurotoxic autoantibodies, synaptic splicing, the BBB and the apoptosis signalling pathway will be further investigated in the future, and the therapeutic mechanisms will be comprehensively elucidated. Moreover, using serum and CSF samples from cNPSLE patients, antibody levels, B-lymphocyte subsets, neuroactive ligands and expression of proteins related to the cAMP/PKA signalling pathway can be investigated, and changes in the samples before and after RTX treatment will be analysed to explore the potential clinical mechanisms.
Supplementary material
Footnotes
Funding: This research received funding support from the National Natural Science Foundation of China (No.82460325), and Foundation of Zunyi Science and Technology Department (No.HZ 205(2023)).
Provenance and peer review: Not commissioned; externally peer reviewed.
Patient consent for publication: Not applicable.
Ethics approval: The study complies with the Declaration of Helsinki. This study was approved by the Animal Ethics Committee of Zunyi Medical University before its commencement (approval no.: 2023-0210).
Data availability free text: All data relevant to this study have been included in the manuscript. The data code supporting the findings of this study is available from the corresponding author on reasonable request.
Patient and public involvement: Patients and/or the public were not involved in the design, conduct, reporting or dissemination plans of this research.
Data availability statement
Data are available upon reasonable request.
References
- 1.Sarwar S, Mohamed AS, Rogers S, et al. Neuropsychiatric Systemic Lupus Erythematosus: A 2021 Update on Diagnosis, Management, and Current Challenges. Cureus. 2021;13:e17969. doi: 10.7759/cureus.17969. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Carrión-Barberà I, Salman-Monte TC, Vílchez-Oya F, et al. Neuropsychiatric involvement in systemic lupus erythematosus: A review. Autoimmun Rev. 2021;20:102780. doi: 10.1016/j.autrev.2021.102780. [DOI] [PubMed] [Google Scholar]
- 3.Wen J, Stock AD, Chalmers SA, et al. The role of B cells and autoantibodies in neuropsychiatric lupus. Autoimmun Rev. 2016;15:890–5. doi: 10.1016/j.autrev.2016.07.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Schwartz N, Stock AD, Putterman C. Neuropsychiatric lupus: new mechanistic insights and future treatment directions. Nat Rev Rheumatol . 2019;15:137–52. doi: 10.1038/s41584-018-0156-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Zhou Y, Chen L, Zheng X, et al. Microglia orchestrate synaptic and neuronal stripping: Implication in neuropsychiatric lupus. J Cellular Molecular Medi . 2024;28:2024. doi: 10.1111/jcmm.18190. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Wang X, Li Y, Wang Y, et al. Intracerebroventricular administration of lupus serum induces microglia activation and leukocyte adhesion in the cerebromicrovasculature of mice. J Neuroimmunol. 2019;334:576994. doi: 10.1016/j.jneuroim.2019.576994. [DOI] [PubMed] [Google Scholar]
- 7.Yun Y, Wang X, Xu J, et al. Pristane induced lupus mice as a model for neuropsychiatric lupus (npsle. In Review. 2023 doi: 10.21203/rs.3.rs-1842109/v1. Preprint. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Bialas AR, Presumey J, Das A, et al. Microglia-dependent synapse loss in type I interferon-mediated lupus. Nature New Biol. 2017;546:539–43. doi: 10.1038/nature22821. [DOI] [PubMed] [Google Scholar]
- 9.Wang K, Hou X, Lu H, et al. Ectopic CD4+ T cells in choroid plexus mediate neuropsychiatric lupus symptoms in mice via interferon-γ induced microglia activation. J Autoimmun. 2024;145:103199. doi: 10.1016/j.jaut.2024.103199. [DOI] [PubMed] [Google Scholar]
- 10.Salter MW, Stevens B. Microglia emerge as central players in brain disease. Nat Med. 2017;23:1018–27. doi: 10.1038/nm.4397. [DOI] [PubMed] [Google Scholar]
- 11.Ercan E, Magro-Checa C, Valabregue R, et al. Glial and axonal changes in systemic lupus erythematosus measured with diffusion of intracellular metabolites. Brain (Bacau) 2016;139:1447–57. doi: 10.1093/brain/aww031. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Han X, Xu T, Ding C, et al. Neuronal NR4A1 deficiency drives complement-coordinated synaptic stripping by microglia in a mouse model of lupus. Sig Transduct Target Ther. 2022;7:50. doi: 10.1038/s41392-021-00867-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Legge AC, Hanly JG. Recent advances in the diagnosis and management of neuropsychiatric lupus. Nat Rev Rheumatol . 2024;20:712–28. doi: 10.1038/s41584-024-01163-z. [DOI] [PubMed] [Google Scholar]
- 14.Li C, Wang Y, Lin Y, et al. Intrathecal injection of methotrexate and dexamethasone for vasculitis granuloma of the fourth ventricle: a case report and literature review. Clin Rheumatol. 2024;43:1217–26. doi: 10.1007/s10067-023-06777-4. [DOI] [PubMed] [Google Scholar]
- 15.Ceppi F, Weitzman S, Woessmann W, et al. Safety and efficacy of intrathecal rituximab in children with B cell lymphoid CD20+ malignancies: An international retrospective study. American J Hematol. 2016;91:486–91. doi: 10.1002/ajh.24329. [DOI] [PubMed] [Google Scholar]
- 16.Xian X, Cai L-L, Li Y, et al. Neuron secrete exosomes containing miR-9-5p to promote polarization of M1 microglia in depression. J Nanobiotechnol. 2022;20 doi: 10.1186/s12951-022-01332-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yan A, Liu Z, Song L, et al. Idebenone Alleviates Neuroinflammation and Modulates Microglial Polarization in LPS-Stimulated BV2 Cells and MPTP-Induced Parkinson’s Disease Mice. Front Cell Neurosci. 2018;12 doi: 10.3389/fncel.2018.00529. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Gao S, Cheng Q-C, Hu Y-G, et al. LncRNA AK148321 alleviates neuroinflammation in LPS-stimulated BV2 microglial cell through regulating microRNA-1199-5p/HSPA5 axis. Life Sci (1962) 2021;266:118863. doi: 10.1016/j.lfs.2020.118863. [DOI] [PubMed] [Google Scholar]
- 19.Rubenstein JL, Combs D, Rosenberg J, et al. Rituximab therapy for CNS lymphomas: targeting the leptomeningeal compartment. Blood. 2003;101:466–8. doi: 10.1182/blood-2002-06-1636. [DOI] [PubMed] [Google Scholar]
- 20.Nikolopoulos D, Manolakou T, Polissidis A, et al. Microglia activation in the presence of intact blood–brain barrier and disruption of hippocampal neurogenesis via IL-6 and IL-18 mediate early diffuse neuropsychiatric lupus. Ann Rheum Dis. 2023;82:646–57. doi: 10.1136/ard-2022-223506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Yang C, Hou X, Feng Q, et al. Lupus serum IgG induces microglia activation through Fc fragment dependent way and modulated by B-cell activating factor. J Transl Med. 2019;17:426. doi: 10.1186/s12967-019-02175-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Fanouriakis A, Kostopoulou M, Andersen J, et al. EULAR recommendations for the management of systemic lupus erythematosus: 2023 update. Ann Rheum Dis. 2024;83:15–29. doi: 10.1136/ard-2023-224762. [DOI] [PubMed] [Google Scholar]
- 23.Gao X, Zhang X, Cui L, et al. Ginsenoside Rb1 Promotes Motor Functional Recovery and Axonal Regeneration in Post-stroke Mice through cAMP/PKA/CREB Signaling Pathway. Brain Res Bull. 2020;154:51–60. doi: 10.1016/j.brainresbull.2019.10.006. [DOI] [PubMed] [Google Scholar]
- 24.Zhang H, Kong Q, Wang J, et al. Complex roles of cAMP-PKA-CREB signaling in cancer. Exp Hematol Oncol. 2020;9:32. doi: 10.1186/s40164-020-00191-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hu X, Yan J, Huang L, et al. INT-777 attenuates NLRP3-ASC inflammasome-mediated neuroinflammation via TGR5/cAMP/PKA signaling pathway after subarachnoid hemorrhage in rats. Brain Behav Immun. 2021;91:587–600. doi: 10.1016/j.bbi.2020.09.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data are available upon reasonable request.