Abstract
Moraxella catarrhalis is a common commensal of the human respiratory tract that has been associated with a number of disease states, including acute otitis media in children and exacerbations of chronic obstructive pulmonary disease in adults. During studies to investigate the outer membrane proteins of this bacterium, two novel major proteins, of approximately 19 kDa and 16 kDa (named OMP J1 and OMP J2, respectively), were identified. Further analysis indicated that these two proteins possessed almost identical gene sequences, apart from two insertion/deletion events in predicted external loops present within the putative barrel-like structure of the proteins. The development of a PCR screening strategy found a 100% (96/96) incidence for the genes encoding the OMP J1 and OMP J2 proteins within a set of geographically diverse M. catarrhalis isolates, as well as a significant association of OMP J1/OMP J2 with both the genetic lineage and the complement resistance phenotype (Fisher's exact test; P < 0.01). Experiments using two ΔompJ2 mutants (one complement resistant and the other complement sensitive) indicated that both were less easily cleared from the lungs of mice than were their isogenic wild-type counterparts, with a significant difference in bacterial clearance being observed for the complement-resistant isolate but not for its isogenic ΔompJ2 mutant (unpaired Student's t test; P < 0.001 and P = 0.32). In this publication, we characterize a novel outer membrane protein of Moraxella catarrhalis which exists in two variant forms associated with particular genetic lineages, and both forms are suggested to contribute to bacterial clearance from the lungs.
The gram-negative bacterium Moraxella catarrhalis is a common commensal of the human upper respiratory tract which has been associated with a number of disease states, including acute otitis media in children (9, 14) and both acute and chronic bronchitis in adults (16, 32). Nosocomial outbreaks of this pathogen have also been reported (10, 34), as well as cases of nearly fatal pneumonia (11). The morbidity burden of M. catarrhalis is particularly noticeable in young children suffering from recurrent otitis media episodes (13) and in adults presenting with chronic obstructive pulmonary disease (35).
One particularly important virulence trait of M. catarrhalis is serum resistance (21), with several outer membrane proteins (OMPs) being implicated in the expression of this particular phenotype. Of particular importance is the UspA2 protein, a vitronectin binding protein whose N-terminal half may confer complement resistance on certain isolates (1, 33, 41). Other OMPs associated with virulence include the iron acquisition protein CopB (20), a hemagglutinin (28), and the lipooligosaccharide (44). Interestingly, there is increasing evidence to suggest that particular virulence traits are associated with distinct subpopulations of M. catarrhalis (8, 12, 42).
Several OMPs of M. catarrhalis have been shown to elicit an antibody response in humans and have therefore been suggested as potential vaccine candidates; these include the immunoglobulin D-binding protein (15) and the major heat-modifiable protein Omp CD (31, 43). However, an ideal vaccine candidate has not yet been described.
In this article, a novel outer membrane protein of M. catarrhalis that exists in two major forms (OMP J1 and OMP J2) is described and characterized. The sequence variation of the two forms and their relationship to both genetic lineage and the complement resistance phenotype are discussed. Preliminary investigations into the role of the protein were performed by comparing the clearance of two OMP J2 knockout (ΔompJ2) mutants with that of their isogenic wild-type counterparts in a mouse model of pulmonary infection.
MATERIALS AND METHODS
Bacterial isolates.
In total, a group of 96 M. catarrhalis isolates were utilized in this study, comprising 35 isolates from The Netherlands (1989-1997), 6 isolates from Ghana (1995), and 55 isolates from the United States (1991-1994; kindly supplied by H. Faden, Department of Pediatrics, Children's Hospital of Buffalo, Buffalo, New York). All of the isolates were cultured from children on Columbia blood agar, apart from six of the Dutch isolates, which were cultured from adults.
Identification of OMP J.
One-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis was performed using standard techniques, with 100 μg protein loaded per gel lane. Membrane fractions of M. catarrhalis were isolated by ultrasonic treatment and extraction in 1% sarcosyl according to the methodology previously described by Klingman and Murphy (24). Tandem mass spectrometry was performed on trypsin digests of the 19-kDa and 16-kDa proteins (OMP J1 and OMP J2, respectively) to identify their amino acid sequences, which were then compared to an in silico translation (all six reading frames) of the nonannotated M. catarrhalis genome sequence available at GenBank (accession numbers AX067426 to AX067466, comprising 41 contigs ranging in size from 429 bp to 261,300 bp). Identification of the relevant protein and gene sequences allowed PCR screening to be performed and sequencing primers to be designed.
PCR screening and sequencing of ompJ1/ompJ2 genes.
PCR screening of M. catarrhalis isolates for ompJ and its genetic variants was performed using standard PCR techniques and the primer pair 19kDres.f and 19kDres.r (details for all primers used are given in Table 1). The expected PCR product sizes were approximately 363 bp (ompJ1) and 333 bp (ompJ2). PCR sequencing of the ompJ genes from 14 M. catarrhalis isolates (representative of the total group of 96 isolates used in this study) was performed using the PCR sequencing primers 19kDseqf, 19kDseqf2, 19kDseqr, and 19kDseqr2. Details of the 14 representative isolates chosen for ompJ sequencing are shown in Table 2. Pulsed-field gel electrophoresis (PFGE) genotypes and complement resistance phenotypes were obtained by reference to the work of Verduin et al. and Hays et al. (18, 42).
TABLE 1.
Primers used for this study
| Primer | Sequence (5′-3′) |
|---|---|
| 19kDres.f | CTAACGCTGCCATCAGCTAT |
| 19kDres.r | GTTGCATTACGGCTGGTAAC |
| 19kDseqf | CGTCATTTGGAACAAGACAGTT |
| 19kDseqf2 | TGAGTGCTAACGCTGCCATC |
| 19kDseqr | AAAGATAATTTATCATGATGGCTTA |
| 19kDseqr2 | CAACACCAACACCGCCTGCT |
| 19kDKO1f.Bam | GACTGGGGATCCGCGTATCACCGCCAATCACT |
| 19kDKO1r.Pst | GACTGCTGCAGCGCCAATAACGAAGAAGCTG |
| 19kDKO2r.Bam | GACTGGGGATCCTCACATCATGCGTGGACT |
| 19kDKO2f.Pst | GACTGCTGCAGGCGTTGAAGCAAGCTACA |
| 19kDaKO.ctrlf | GCACAGCAAGCGTAGTTATG |
| 19kDaKO.ctrlr | TGCGTTAAGCCTTGGTGATG |
| KanR1 | CTCGTGAAGAAGGTGTTGC |
| KanR2 | ATAAATGGGCTCGCGATAATGTC |
TABLE 2.
M. catarrhalis isolates chosen for ompJ gene sequencing
| Isolatea | Origin (yr of isolation) | Complement phenotype |
|---|---|---|
| 1.24 | The Netherlands (1989) | Resistant |
| 1.39 | The Netherlands (1989) | Sensitive |
| 3.14 | The Netherlands (1989) | Sensitive |
| 3.18 | The Netherlands (1989) | Sensitive |
| 3.9 | The Netherlands (1989) | Resistant |
| F3.57 | The Netherlands (1993) | Sensitive |
| H12 | The Netherlands (1989) | Resistant |
| 97/0233 | The Netherlands (1997) | Resistant |
| 25240 | ATCC reference isolate | Resistant |
| V02 | Ghana, Africa (1995) | Resistant |
| CK16-7 | New York (1990-92) | Sensitive |
| EE11-2 | New York (1990-92) | Resistant |
| MT17-3 | New York (1990-92) | Sensitive |
| MT17-6 | New York (1990-92) | Resistant |
1.24 to F3.57 are isolates from healthy (colonized) children; H12 and 97/0233 are positive blood culture isolates from children; and CK16-7 to MT17-3 are isolates from children prone to acute otitis media.
Preparation of ΔompJ gene knockout isolates.
The regions immediately flanking the ompJ gene were amplified using primer pair 19kDKO1f.Bam/19kDKO1r.Pst (700-bp upstream fragment) and primer pair 19kDKO2r.Bam/19kDKO2f (500-bp downstream fragment). Both fragments were then digested with PstI and ligated, and the 1,200-bp product (minus an internal 410-bp fragment of ompJ) was reamplified using primers 19kDKO1f.Bam and 19kDKO2r.Bam. The PCR product was digested with BamHI, ligated into plasmid pGEM-7zf(+) (Promega Corporation), and used to transform One Shot TOP10 Escherichia coli cells (Invitrogen). Plasmids containing the insert were selected by PCR analysis of white, ampicillin-resistant E. coli colonies. After extraction, the plasmid was digested using PstI, and an internal kanamycin resistance gene cassette (obtained by PstI digestion of plasmid pUC4K [Amersham Pharmacia Biotech]) was ligated into the ompJ PstI site. The construct was used to transform One Shot TOP10 E. coli cells, with selection on Mueller-Hinton (MH) agar containing 5 μg/ml kanamycin. M. catarrhalis isolates were subsequently naturally transformed with PCR amplification products [primer pair 19kDKO1f.Bam/19kDKO2r.Bam, with pGEM-7zf(+) ΩompJ ΔkanR as the template] and selected on MH agar containing 5 μg/ml kanamycin. The presence of the ΔompJ knockout construct in the chromosomes of kanamycin-resistant M. catarrhalis colonies was confirmed by PCR (primers 19kDaKO.ctrlf, 19kDaKO.ctrlr, KanR1, and KanR2) as well as by the absence of OMP J protein expression (established using one-dimensional SDS-PAGE analysis of outer membrane protein extracts). ΔompJ2 knockout constructs were prepared in M. catarrhalis isolates 3.9 and 3.18.
Pulmonary clearance study.
In order to determine the effect of OMP J on pulmonary clearance in a mouse model, two M. catarrhalis ompJ2-containing gene knockout mutants (3.9ΔompJ2 and 3.18ΔompJ2) were constructed and compared to their isogenic wild-type isolates in a mouse pulmonary clearance study. The mouse pulmonary clearance protocol was based on those published by Forsgren et al. (15) and Unhanand et al. (39). Basically, M. catarrhalis isolates were grown overnight at 37°C on either MH agar (wild-type isogenic isolates) or MH agar incorporating 5 μg/ml kanamycin (ΔompJ2 mutants) and then grown to mid-log phase in MH broth. A 50-μl volume containing 1 × 108 CFU of each isolate was inoculated intranasally into the lungs of anesthetized BALB/c mice, which were sacrificed at 0.5 and 3 h postinfection. Colony counts of surviving M. catarrhalis cells were performed on MH agar after overnight incubation at 37°C. Five mice were sacrificed for each isolate tested (total = 2 × 20 mice). Survival values (percentages) at 3 h postinoculation were calculated by taking the average CFU count of each isolate at the 0.5-h time point as 100%. Statistical analysis was performed by using a two-tailed unpaired student’s t test to compare the difference in lung log10 CFU/ml bacterial survivors 0.5 and 3 h after nasal inoculation. Further analysis involved generating growth curves for both the wild type and the isogenic ΔompJ2 mutants in order to verify that no significant difference in growth rates existed. The animal studies described in this publication were performed in accordance with the ethical and legal requirements of the Erasmus MC, Rotterdam, The Netherlands, and with the approval of the Animal Studies Ethics Committee of the same institution.
Serum bactericidal testing.
Serum bactericidal survival testing of M. catarrhalis isolates 3.9, 3.18, and their isogenic ΔompJ2 mutants was based on a protocol described by Attia et al. (1). Briefly, bacterial cultures were grown to mid-log phase (approximately 5 × 108 CFU/ml) in MH broth and diluted 1/1,000 in Veronal-buffered saline containing 0.1% (wt/vol) gelatin. Twenty microliters of this bacterial suspension was added to 160 μl Veronal-buffered saline-gelatin, and 20 μl of human pooled sera (HPS) (or 20 μl heat-inactivated pooled human sera that were previously incubated at 56°C for 30 min) was added. Ten-microliter aliquots of each reaction mix were plated onto MH agar after 0 and 30 min of incubation at 37°C. Four independent experiments were performed per bacterial isolate, using HPS obtained from eight healthy adult volunteers. Survival values (percentages) were calculated by comparing the means of results after 0 min and 30 min of exposure to HPS from four independent experiments. Statistical differences between wild-type and ΔompJ2 isolates were calculated using log10 CFU/ml survival values after 30 min of HPS exposure and two-tailed unpaired Student's t test (after first ensuring that there was no significant difference in CFU/ml results after 0 min of exposure to HPS).
RESULTS
Identification of OMP J.
One-dimensional SDS-PAGE analysis of outer membrane protein extracts from 48 of the 96 M. catarrhalis isolates used in this study revealed the presence of two putative proteins (of approximately 19 kDa and 16 kDa) and an association between protein and a complement-resistant or -sensitive phenotype (Fig. 1). Subsequent tandem mass spectroscopy analysis indicated that the two proteins consisted mainly of identical polypeptide sequences, indicating that both proteins were in fact two variants of the same protein. These sequences were found in only one translated open reading frame (ORF) within the whole M. catarrhalis proteome, allowing the protein and its genomic location to be identified. Using these data, the surrounding ORFs of ompJ were found to include genes encoding proteins involved in the recognition and processing of DNA lesions (uvrC) and glycolate metabolism (pgp), a glutamyl-tRNA synthetase (gluRS), and a protein involved in the suppression of a DnaK-like heat shock protein (data not shown).
FIG. 1.
One-dimensional SDS-PAGE gel of outer membrane proteins extracted from several complement-resistant and complement-sensitive isolates of M. catarrhalis. M, SDS-PAGE standards. Filled arrows indicate the positions of the two major forms of the OMP J protein. Resistant, complement-resistant phenotype; sensitive, complement-sensitive phenotype.
Sequencing and PCR screening of ompJ genes.
Sequence analysis of the ompJ genes from 14 geographically distinct M. catarrhalis isolates indicated that two distinct phylogenetic lineages existed (GenBank accession numbers DQ008974 to DQ008986 and DQ105644), with 90% identity (over 579 bp) between the two most divergent sequences (Fig. 2). This clustering occurred independent of the geographical origin of the isolates. Translation of the 14 gene sequences showed three insertion/deletion events which were common to each cluster, occurring at amino acid positions 69 to 71, 82 to 97, 138 to 144, and 151 to 153 of the isolate F3.57 sequence. Sequence comparisons of OMP J1 with known protein sequences indicated that the protein was similar to a hypothetical protein found in a closely related Psychrobacter sp. (GenBank accession number gi|52853456|ref|ZP_00145674.2|) but contained little sequence similarity with other known proteins. Secondary structure analysis revealed the putative positions of α-helix and β-sheet regions within the OMP J sequence, providing indications that OMP J may form a beta-barrel-type structure with considerable structural similarity to a superfamily of proteins which include the Omp21 protein from Comamonas (Deftia) acidovorans (3, 4), the Neisseria opacity-associated protein (Opa) (17), its homologue Neisseria surface protein A (NspA) (40), and Enterobacter cloacae outer membrane protein X (OmpX) (37, 38). The positions of two of the major insertion/deletion events occurred in a putative external loop (loop 2) of the predicted barrel-like structure.
FIG. 2.
(Top) OMP J amino acid sequences in 14 M. catarrhalis isolates. 25240, 3.14, 3.9, 97/0233, H12, 1.24, 1.39, and F3.57 are Dutch isolates; EE 11.2, CK 16.7, MT 17.3, and MT17.6 are American isolates; and V02 is a Ghanaian isolate. The dotted line above the sequences shows the signal peptide, and the other lines above the sequences show β-strands, numbered β1 to β8. L1 to L4, surface-exposed loops; T1 to T3, periplasmic turns; boxed residues, residues contributing to aromatic girdles; residues shown in bold, residues in β-strands facing the lipids. (Bottom) Dendrogram of the nucleotide sequences (Dice coefficient with unweighted-pair group method using average linkages). Pheno, complement phenotype, where “R” is resistant and “S” is sensitive; PFGE, genotypic lineages as previously determined by Verduin et al. (41) (1 and 2) and Hays et al. (18) (a and b).
PCR screening primers for ompJ were designed using conserved sequences found in both the ompJ1 and ompJ2 genes and yielded positive PCR products from 100% (96/96) of the M. catarrhalis isolates tested (Fig. 3). Of these, 97% (72/74) of complement-resistant isolates generated shorter PCR products, of approximately 333 bp (ompJ2-like), while 74% (14/22) of complement-sensitive isolates generated larger PCR products, of approximately 363 bp (ompJ1-like). This distribution of ompJ genes between complement resistance phenotypes was found to be highly significant (Fisher's exact test; P < 0.001). Importantly, there also appeared to be a significant correlation between the two major forms of ompJ genes and the genetic lineage (as determined by PFGE). In particular, by cross-referencing the results obtained with 41 isolates previously genotyped by Verduin et al. (42), it was observed that 22/28 isolates from a short-branched lineage harbored the ompJ2 gene and that 9/13 isolates from a longer-branched lineage harbored the larger ompJ1 gene. Further cross-referencing of ompJ PCR data to data for 55 American isolates previously genotyped by Hays et al. (18) indicated that 50/50 isolates from a short-branched lineage harbored the ompJ2-like gene and that 4/5 isolates from a longer-branched lineage harbored the larger ompJ1-like gene (data not shown). These results were highly significant (Fisher's exact test; P = 0.005 and P < 0.0001, respectively). PCR screening results did not reveal the presence of multiple ompJ PCR products within individual isolates. Furthermore, sequence searching of the only (unannotated) publicly available M. catarrhalis whole genome sequence (GenBank accession numbers AX067426 to AX067466) revealed the presence of only a single copy of the ompJ gene (ompJ2) within this isolate.
FIG. 3.
Gel showing ompJ PCR screening results obtained with 18 Dutch M. catarrhalis isolates. M, molecular size marker (bp). Lanes 1 to 18, Dutch M. catarrhalis isolates F1.11, F1.3, 8.3, 7.13, 7.10, 7.2, 6.12, 6.2, 5.12, 4.22, 4.16, 3.24, 3.21, 3.18, 3.14, 1.38, 1.12, and 1.9, respectively. Note the differences in size between ompJ1-like (363 bp) and ompJ2-like (333 bp) genes.
ΔompJ knockouts and pulmonary clearance studies.
Attempts to create ΔompJ2 gene knockouts in M. catarrhalis were successful for the complement-resistant isolate 3.9 and the complement-sensitive isolate 3.18 (Fig. 4), with further studies indicating that knocking out these ompJ2 genes did not affect the expression of other outer membrane proteins (Fig. 5).
FIG. 4.
Diagram and PCR gels showing insertion of kanamycin resistance cassette into ompJ genes of M. catarrhalis isolates 3.9 and 3.18. Primers: A1, 19kDaKO.ctrlf; A2, 19kDaKO.ctrlr; B, 19kDKO1f.Bam; C, 19kDKO2R.Bam; K1, KanR1; and K2, KanR2. 3.9 and 3.18, isolates 3.9 and 3.18, respectively; Δ, respective isogenic ΔompJ knockout mutants. Numbers indicate the positions of the 5′ ends of primers with respect to the 5′ end of the ompJ gene, as obtained from the unannotated M. catarrhalis genome sequence available at GenBank (accession numbers AX067426 to AX067466). The kanamycin resistance cassette inserted into the ompJ gene is 1,240 bp in length. Open reading frames in the vicinity of the ompJ gene include uvrC, encoding excinuclease ABC subunit C (gi|46141700|ref|ZP_00147050.2|); pgp, encoding a predicted phosphoglycolate phosphatase (gi|52853459|ref|ZP_00145679.2|); ompJ, encoding hypothetical Psychrobacter protein Psyc03002166 (gi|52853456|ref|ZP_00145674.2); gluRS, encoding glutamyl- and glutaminyl-tRNA synthetase (gi|41690542|ref|ZP_00147074.1|); and dnaKs, the gene for the DnaK suppressor protein (gi|41690541|ref|ZP_00147073.1|).
FIG. 5.
Composite one-dimensional SDS-PAGE gel showing outer membrane protein profiles for M. catarrhalis isolates 3.9 and 3.18 (wt) along with their respective isogenic ΔompJ mutants.
The average M. catarrhalis survival in a pulmonary mouse model 3 h after inoculation was measured to be 23%, 78%, 89%, and 92% for isolates 3.9, 3.9ΔompJ2, 3.18, and 3.18ΔompJ2, respectively (Fig. 6). Statistical analysis using two-tailed unpaired Student's t test indicated a statistically significant decrease in log10 CFU/ml bacterial survivors after 3 h for isolate 3.9 (P < 0.001), but not for its isogenic ΔompJ2 mutant (P = 0.32), isolate 3.18 (P = 0.25), or the isogenic 3.18ΔompJ2 mutant (P = 0.49). Moreover, both ΔompJ2 mutants survived in greater numbers than their respective wild-type parents. Growth curve comparisons showed no difference in exponential growth rate between the ΔompJ2 mutants and their respective isogenic isolates, although it was noted that the final concentration of ΔompJ2 mutant cells was somewhat lower in the plateau phase of the growth cycle (Fig. 7).
FIG. 6.
Graph showing percentages of pulmonary survival in a mouse challenge study for two wild-type isolates of M. catarrhalis and two isogenic ΔompJ2 gene knockout mutants. 3.9 and 3.18, wild-type isolates 3.9 (complement resistant) and 3.18 (complement sensitive), respectively; ΔompJ2, respective isogenic ompJ2 gene knockout mutant. Percentages of survival were determined by comparing CFU/ml values at 3 h postinoculation with CFU/ml values at 0.5 h postinoculation. Data are representative of five independent experiments. Error bars indicate standard errors of the means for percentage data.
FIG. 7.
Growth curves for two Moraxella catarrhalis wild-type isolates (3.9 and 3.18) and their isogenic ΔompJ2 gene mutants (3.9ΔompJ2 and 3.18ΔompJ2). OD660, optical density at 660 nm.
Serum bactericidal testing.
Serum bactericidal survival results for M. catarrhalis isolates 3.9, 3.18, and their respective isogenic ΔompJ2 mutants are shown in Fig. 8. No significant difference was observed between wild-type isolate 3.9 and its ΔompJ2 mutant in either HPS or heat-inactivated HPS (P = 0.44 and 0.16, respectively), although survival values were reduced for the 3.9ΔompJ2 knockout isolate in both HPS and inactivated HPS. The complement-sensitive isolate 3.18 actually showed an increase in survival in both HPS and heat-inactivated HPS. However, the significance of any conclusions that could be drawn was limited by the detection limit of the methodology used (zero colonies were recorded after incubation in HPS).
FIG. 8.
Effect of 10% (vol/vol) HPS and 10% heat-inactivated HPS on the percent survival of M. catarrhalis isolates 3.9 (complement resistant) and 3.18 (complement sensitive) compared to their respective ΔompJ2 gene mutants. Colony counts were performed at time zero and 30 min after the addition of serum, with percent survival being calculated relative to time zero. Standard error bars were calculated from the means of four independent experiments.
DISCUSSION
Early studies of the outer membrane proteins of M. catarrhalis identified and characterized eight major proteins within this species, ranging from 98 kDa to 21 kDa and named OMP A to OMP H (29). Several of these OMPs have now been characterized and include proteins involved in iron acquisition, e.g., CopB (7), LbpB/A (6), and TbpB (36), fatty acid uptake (5), and adhesion (22, 23, 26). A role for some of these proteins in M. catarrhalis virulence and pathogenicity has been suggested, including the UspA2 (1, 41) and OMP E (30) proteins, which appear to facilitate serum resistance. Other experiments have shown that a CopB-binding monoclonal antibody (MAb10F3) could enhance the clearance of M. catarrhalis in a mouse pulmonary disease model, binding to 70% of M. catarrhalis isolates tested (19). Furthermore, the finding that adults develop new serum immunoglobulin G and mucosal immunoglobulin A to bacterial surface epitopes after exacerbations of chronic obstructive pulmonary disease shows the importance of the humoral immune response to M. catarrhalis-mediated infection (2).
In this study, one-dimensional SDS-PAGE analysis of outer membrane protein extracts from several isolates of M. catarrhalis revealed the presence of a small and novel major outer membrane protein (OMP J) which was found to exist in two major forms, with molecular masses of approximately 19 kDa and 16 kDa (OMP J1 and OMP J2, respectively). Sequence analysis and database searching indicated limited homology between the OMP J protein and ompJ gene and other known protein and gene sequences, with the possible exception being a hypothetical protein found in a closely related Psychrobacter sp. However, secondary structure prediction for OMP J indicated that the protein might possess a barrel-like tertiary structure, which taken in context with the presence of a signal sequence, suggests that OMP J may be an integral membrane protein. Indeed, the sequence/structure results suggest that OMP J belongs to a superfamily of proteins that include the OPA (opacity) family of proteins of Neisseria spp., which mediate bacterial adherence to epithelial cells by interacting with (for example) the receptors for the human carcinoembryonic antigen cell adhesion molecule on human polymorphonuclear phagocytes. Other members of this superfamily include Neisseria surface protein A (NspA), a highly conserved protein of unknown function which is a promising vaccine candidate against both Neisseria meningitidis and Neisseria gonorrhoeae (27, 40). Structurally, the major difference between the two forms of OMP J seems to reside in the deletion of 12 amino acids forming part of a putative loop 2 region, but the consequences of this deletion with respect to the function and antigenic properties of the two proteins have yet to be determined.
PCR screening of isolates suggested that only a single copy of the ompJ gene is present in M. catarrhalis species and that it may be found in 100% of isolates, indicating a significant role for OMP J in the M. catarrhalis life cycle. No clear indication of the likely function of OMP J was obtained by inspecting neighboring ORFs, which appeared to comprise a mix of putative housekeeping genes involved in various metabolic and DNA repair activities. Note, however, that the direction of transcription of the ompJ gene lies in the opposite orientation to that of the neighboring ORFs.
A statistically significant association between the two major forms of OMP J, the genetic lineage, and the complement resistance phenotype was observed in diverse geographical isolates. However, serum resistance experiments using two ΔompJ2 mutants did not indicate a significant role for OMP J2 in facilitating complement resistance. It seems likely that the association of OMP J1 and OMP J2 with the complement phenotype is simply a consequence of their association with different genetic lineages previously associated with the differential expression of virulence traits (8). In fact, most evidence implicates the UspA2 outer membrane protein as the major contributor to the complement resistance phenotype within this species (1, 41).
Previous investigations have shown that alterations in the expression of outer membrane proteins and lipooligosaccharide in M. catarrhalis may significantly impact the in vivo clearance of isogenic mutants in a mouse model of pulmonary infection (25). Studies investigating the role of ompJ2 in the clearance of M. catarrhalis from the lungs of mice showed that the absence of OMP J2 resulted in a reduction in bacterial clearance from the lungs, suggesting that OMP J2 may actually be a target for the immune system.
In this publication, we identified and characterized a novel outer membrane protein (OMP J) of M. catarrhalis which appears to be present in two major lineage-specific forms. Furthermore, the ompJ gene appears to be universally present within the species and may play a role in immune system-mediated bacterial clearance from the lungs.
Acknowledgments
We thank H. Faden (Department of Pediatrics, Children's Hospital, Buffalo, New York) for kindly supplying the American M. catarrhalis isolates used in this study, as well as A. Ott (Department of Medical Microbiology, Erasmus MC).
This work was funded by the Sophia Children's Hospital Foundation, Erasmus MC, Rotterdam, The Netherlands (grant number 397).
REFERENCES
- 1.Attia, A. S., E. R. Lafontaine, J. L. Latimer, C. Aebi, G. A. Syrogiannopoulos, and E. J. Hansen. 2005. The UspA2 protein of Moraxella catarrhalis is directly involved in the expression of serum resistance. Infect. Immun. 73:2400-2410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bakri, F., A. L. Brauer, S. Sethi, and T. F. Murphy. 2002. Systemic and mucosal antibody response to Moraxella catarrhalis after exacerbations of chronic obstructive pulmonary disease. J. Infect. Dis. 185:632-640. [DOI] [PubMed] [Google Scholar]
- 3.Baldermann, C., and H. Engelhardt. 2000. Expression, two-dimensional crystallization, and three-dimensional reconstruction of the beta8 outer membrane protein Omp21 from Comamonas acidovorans. J. Struct. Biol. 131:96-107. [DOI] [PubMed] [Google Scholar]
- 4.Baldermann, C., A. Lupas, J. Lubieniecki, and H. Engelhardt. 1998. The regulated outer membrane protein Omp21 from Comamonas acidovorans is identified as a member of a new family of eight-stranded beta-sheet proteins by its sequence and properties. J. Bacteriol. 180:3741-3749. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bhushan, R., R. Craigie, and T. F. Murphy. 1994. Molecular cloning and characterization of outer membrane protein E of Moraxella (Branhamella) catarrhalis. J. Bacteriol. 176:6636-6643. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bonnah, R. A., H. Wong, S. M. Loosmore, and A. B. Schryvers. 1999. Characterization of Moraxella (Branhamella) catarrhalis lbpB, lbpA, and lactoferrin receptor orf3 isogenic mutants. Infect. Immun. 67:1517-1520. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bonnah, R. A., R. H. Yu, H. Wong, and A. B. Schryvers. 1998. Biochemical and immunological properties of lactoferrin binding proteins from Moraxella (Branhamella) catarrhalis. Microb. Pathog. 24:89-100. [DOI] [PubMed] [Google Scholar]
- 8.Bootsma, H. J., H. G. van der Heide, S. van de Pas, L. M. Schouls, and F. R. Mooi. 2000. Analysis of Moraxella catarrhalis by DNA typing: evidence for a distinct subpopulation associated with virulence traits. J. Infect. Dis. 181:1376-1387. [DOI] [PubMed] [Google Scholar]
- 9.Catlin, B. W. 1990. Branhamella catarrhalis: an organism gaining respect as a pathogen. Clin. Microbiol. Rev. 3:293-320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Cook, P. P., D. W. Hecht, and D. R. Snydman. 1989. Nosocomial Branhamella catarrhalis in a paediatric intensive care unit: risk factors for disease. J. Hosp. Infect. 13:299-307. [DOI] [PubMed] [Google Scholar]
- 11.Dyson, C., H. D. Poonyth, M. Watkinson, and S. J. Rose. 1990. Life threatening Branhamella catarrhalis pneumonia in young infants. J. Infect. 21:305-307. [DOI] [PubMed] [Google Scholar]
- 12.El-Ahmer, O. R., J. M. Braun, S. G. Amyes, D. M. Weir, J. Beuth, and C. C. Blackwell. 2003. Comparison of Moraxella catarrhalis isolates from children and adults for growth on modified New York City medium and potential virulence factors. J. Med. Microbiol. 52:853-859. [DOI] [PubMed] [Google Scholar]
- 13.Faden, H. 2001. The microbiologic and immunologic basis for recurrent otitis media in children. Eur. J. Pediatr. 160:407-413. [DOI] [PubMed] [Google Scholar]
- 14.Faden, H., Y. Harabuchi, and J. J. Hong. 1994. Epidemiology of Moraxella catarrhalis in children during the first 2 years of life: relationship to otitis media. J. Infect. Dis. 169:1312-1317. [DOI] [PubMed] [Google Scholar]
- 15.Forsgren, A., M. Brant, and K. Riesbeck. 2004. Immunization with the truncated adhesin Moraxella catarrhalis immunoglobulin D-binding protein (MID764-913) is protective against M. catarrhalis in a mouse model of pulmonary clearance. J. Infect. Dis. 190:352-355. [DOI] [PubMed] [Google Scholar]
- 16.Hager, H., A. Verghese, S. Alvarez, and S. L. Berk. 1987. Branhamella catarrhalis respiratory infections. Rev. Infect. Dis. 9:1140-1149. [DOI] [PubMed] [Google Scholar]
- 17.Hauck, C. R., and T. F. Meyer. 2003. “Small” talk: Opa proteins as mediators of Neisseria-host-cell communication. Curr. Opin. Microbiol. 6:43-49. [DOI] [PubMed] [Google Scholar]
- 18.Hays, J. P., C. van der Schee, A. Loogman, K. Eadie, C. Verduin, H. Faden, H. Verbrugh, and A. van Belkum. 2003. Total genome polymorphism and low frequency of intra-genomic variation in the uspA1 and uspA2 genes of Moraxella catarrhalis in otitis prone and non-prone children up to 2 years of age. Consequences for vaccine design? Vaccine 21:1118-1124. [DOI] [PubMed] [Google Scholar]
- 19.Helminen, M. E., I. Maciver, J. L. Latimer, L. D. Cope, G. H. McCracken, Jr., and E. J. Hansen. 1993. A major outer membrane protein of Moraxella catarrhalis is a target for antibodies that enhance pulmonary clearance of the pathogen in an animal model. Infect. Immun. 61:2003-2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Helminen, M. E., I. Maciver, M. Paris, J. L. Latimer, S. L. Lumbley, L. D. Cope, G. H. McCracken, Jr., and E. J. Hansen. 1993. A mutation affecting expression of a major outer membrane protein of Moraxella catarrhalis alters serum resistance and survival in vivo. J. Infect. Dis. 168:1194-1201. [DOI] [PubMed] [Google Scholar]
- 21.Hol, C., C. M. Verduin, E. E. Van Dijke, J. Verhoef, A. Fleer, and H. van Dijk. 1995. Complement resistance is a virulence factor of Branhamella (Moraxella) catarrhalis. FEMS Immunol. Med. Microbiol. 11:207-211. [DOI] [PubMed] [Google Scholar]
- 22.Holm, M. M., S. L. Vanlerberg, I. M. Foley, D. D. Sledjeski, and E. R. Lafontaine. 2004. The Moraxella catarrhalis porin-like outer membrane protein CD is an adhesin for human lung cells. Infect. Immun. 72:1906-1913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Holm, M. M., S. L. Vanlerberg, D. D. Sledjeski, and E. R. Lafontaine. 2003. The Hag protein of Moraxella catarrhalis strain O35E is associated with adherence to human lung and middle ear cells. Infect. Immun. 71:4977-4984. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Klingman, K. L., and T. F. Murphy. 1994. Purification and characterization of a high-molecular-weight outer membrane protein of Moraxella (Branhamella) catarrhalis. Infect. Immun. 62:1150-1155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kyd, J. M., A. W. Cripps, and T. F. Murphy. 1998. Outer-membrane antigen expression by Moraxella (Branhamella) catarrhalis influences pulmonary clearance. J. Med. Microbiol. 47:159-168. [DOI] [PubMed] [Google Scholar]
- 26.Lafontaine, E. R., L. D. Cope, C. Aebi, J. L. Latimer, G. H. McCracken, Jr., and E. J. Hansen. 2000. The UspA1 protein and a second type of UspA2 protein mediate adherence of Moraxella catarrhalis to human epithelial cells in vitro. J. Bacteriol. 182:1364-1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Martin, D., N. Cadieux, J. Hamel, and B. R. Brodeur. 1997. Highly conserved Neisseria meningitidis surface protein confers protection against experimental infection. J. Exp. Med. 185:1173-1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Murphy, S., M. Fitzgerald, R. Mulcahy, C. Keane, D. Coakley, and T. Scott. 1997. Studies on haemagglutination and serum resistance status of strains of Moraxella catarrhalis isolated from the elderly. Gerontology 43:277-282. [DOI] [PubMed] [Google Scholar]
- 29.Murphy, T. F. 1990. Studies of the outer membrane proteins of Branhamella catarrhalis. Am. J. Med. 88:41S-45S. [DOI] [PubMed] [Google Scholar]
- 30.Murphy, T. F., A. L. Brauer, N. Yuskiw, and T. J. Hiltke. 2000. Antigenic structure of outer membrane protein E of Moraxella catarrhalis and construction and characterization of mutants. Infect. Immun. 68:6250-6256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Murphy, T. F., J. M. Kyd, A. John, C. Kirkham, and A. W. Cripps. 1998. Enhancement of pulmonary clearance of Moraxella (Branhamella) catarrhalis following immunization with outer membrane protein CD in a mouse model. J. Infect. Dis. 178:1667-1675. [DOI] [PubMed] [Google Scholar]
- 32.Nicotra, B., M. Rivera, J. I. Luman, and R. J. Wallace, Jr. 1986. Branhamella catarrhalis as a lower respiratory tract pathogen in patients with chronic lung disease. Arch. Intern. Med. 146:890-893. [PubMed] [Google Scholar]
- 33.Nordstrom, T., A. M. Blom, A. Forsgren, and K. Riesbeck. 2004. The emerging pathogen Moraxella catarrhalis interacts with complement inhibitor C4b binding protein through ubiquitous surface proteins A1 and A2. J. Immunol. 173:4598-4606. [DOI] [PubMed] [Google Scholar]
- 34.Patterson, T. F., J. E. Patterson, B. L. Masecar, G. E. Barden, W. J. Hierholzer, Jr., and M. J. Zervos. 1988. A nosocomial outbreak of Branhamella catarrhalis confirmed by restriction endonuclease analysis. J. Infect. Dis. 157:996-1001. [DOI] [PubMed] [Google Scholar]
- 35.Sethi, S., N. Evans, B. J. Grant, and T. F. Murphy. 2002. New strains of bacteria and exacerbations of chronic obstructive pulmonary disease. N. Engl. J. Med. 347:465-471. [DOI] [PubMed] [Google Scholar]
- 36.Sims, K. L., and A. B. Schryvers. 2003. Peptide-peptide interactions between human transferrin and transferrin-binding protein B from Moraxella catarrhalis. J. Bacteriol. 185:2603-2610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Stoorvogel, J., M. J. van Bussel, J. Tommassen, and J. A. van de Klundert. 1991. Molecular characterization of an Enterobacter cloacae outer membrane protein (OmpX). J. Bacteriol. 173:156-160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Stoorvogel, J., M. J. van Bussel, and J. A. van de Klundert. 1991. Biological characterization of an Enterobacter cloacae outer membrane protein (OmpX). J. Bacteriol. 173:161-167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Unhanand, M., I. Maciver, O. Ramilo, O. Arencibia-Mireles, J. C. Argyle, G. H. McCracken, Jr., and E. J. Hansen. 1992. Pulmonary clearance of Moraxella catarrhalis in an animal model. J. Infect. Dis. 165:644-650. [DOI] [PubMed] [Google Scholar]
- 40.Vandeputte-Rutten, L., M. P. Bos, J. Tommassen, and P. Gros. 2003. Crystal structure of neisserial surface protein A (NspA), a conserved outer membrane protein with vaccine potential. J. Biol. Chem. 278:24825-24830. [DOI] [PubMed] [Google Scholar]
- 41.Verduin, C. M., M. Jansze, J. Verhoef, A. Fleer, and H. van Dijk. 1994.Complement resistance in Moraxella (Branhamella) catarrhalis is mediated by a vitronectin-binding surface protein. Clin. Exp. Immunol. 97:50. [Google Scholar]
- 42.Verduin, C. M., M. Kools-Sijmons, J. van der Plas, J. Vlooswijk, M. Tromp, H. van Dijk, J. Banks, H. Verbrugh, and A. van Belkum. 2000. Complement-resistant Moraxella catarrhalis forms a genetically distinct lineage within the species. FEMS Microbiol. Lett. 184:1-8. [DOI] [PubMed] [Google Scholar]
- 43.Yang, Y. P., L. E. Myers, U. McGuinness, P. Chong, Y. Kwok, M. H. Klein, and R. E. Harkness. 1997. The major outer membrane protein, CD, extracted from Moraxella (Branhamella) catarrhalis is a potential vaccine antigen that induces bactericidal antibodies. FEMS Immunol. Med. Microbiol. 17:187-199. [DOI] [PubMed] [Google Scholar]
- 44.Zaleski, A., N. K. Scheffler, P. Densen, F. K. Lee, A. A. Campagnari, B. W. Gibson, and M. A. Apicella. 2000. Lipooligosaccharide P(k) (Galα1-4Galβ1-4Glc) epitope of Moraxella catarrhalis is a factor in resistance to bactericidal activity mediated by normal human serum. Infect. Immun. 68:5261-5268. [DOI] [PMC free article] [PubMed] [Google Scholar]









