Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2005 Dec;187(23):8104–8113. doi: 10.1128/JB.187.23.8104-8113.2005

Genetic and Biochemical Analysis of the Twin-Arginine Translocation Pathway in Halophilic Archaea

Kieran Dilks 1, María Inés Giménez 1, Mechthild Pohlschröder 1,*
PMCID: PMC1291277  PMID: 16291683

Abstract

The twin-arginine translocation (Tat) pathway is present in a wide variety of prokaryotes and is capable of exporting partially or fully folded proteins from the cytoplasm. Although diverse classes of proteins are transported via the Tat pathway, in most organisms it facilitates the secretion of a relatively small number of substrates compared to the Sec pathway. However, computational evidence suggests that haloarchaea route nearly all secreted proteins to the Tat pathway. We have expanded previous computational analyses of the haloarchaeal Tat pathway and initiated in vivo characterization of the Tat machinery in a model haloarchaeon, Haloferax volcanii. Consistent with the predicted usage of the this pathway in the haloarchaea, we determined that three of the four identified tat genes in Haloferax volcanii are essential for viability when grown aerobically in complex medium. This represents the first report of an organism that requires the Tat pathway for viability when grown under such conditions. Deletion of the nonessential gene had no effect on the secretion of a verified substrate of the Tat pathway. The two TatA paralogs TatAo and TatAt were detected in both the membrane and cytoplasm and could be copurified from the latter fraction. Using size exclusion chromatography to further characterize cytoplasmic and membrane TatA proteins, we find these proteins present in high-molecular-weight complexes in both cellular fractions.


Prokaryotes secrete proteins using a number of distinct translocation mechanisms. The greatest detail is known about how proteins traverse the membrane by way of the universally conserved Sec pathway. Proteins that are secreted via this pathway are targeted to a membrane-embedded Sec pore by virtue of an N-terminal secretion signal and are subsequently threaded though the pore in a linear unfolded conformation (18, 21). Although the vast majority of secretory proteins are translocated via the Sec pathway in most prokaryotes, it is apparent that alternative translocation mechanisms are playing crucial roles in the process of secretion in many organisms (23).

One alternate secretion pathway, the twin-arginine translocation (Tat) pathway, employs a similar N-terminal secretion signal for targeting of substrates (5). Virtually all Tat secretion signals possess critical twin arginine residues that are required for efficient translocation of the corresponding substrate. The Tat pathway is distinct from Sec translocation in that Tat substrates obtain tertiary structure in the cytoplasm and are secreted in a folded conformation (11).

The Tat pathway has been most widely studied in a model γ-proteobacterium, Escherichia coli. The E. coli Tat machinery consists of three functionally distinct membrane-localized proteins: TatA, TatB, and TatC (25, 30). TatA and TatB are comprised of a single N-terminal transmembrane segment, a cytoplasmic amphipathic helical region, and a C-terminal region. TatC possesses six transmembrane segments with the N and C termini localized in the cytoplasm. Recent cross-linking data suggest that Tat substrates initially bind the membrane via an interaction with TatB and TatC. The substrate is then passed to TatA in a ΔpH-dependent manner before translocation (1). Negative-stain electron microscopy suggests that TatA multimers are able to form a channel-like structure, and therefore a TatA complex may be acting as the secretory pore for Tat substrates (26). A large number of prokaryotes (including all archaea) have been predicted to lack a TatB homolog and instead encode a simpler TatAC system (31), which was surprising given that TatB was required for Tat translocation in E. coli (27). However, tatA alleles in E. coli that could suppress the ΔtatB phenotype have recently been identified, suggesting that a single TatA homolog in a TatAC system may perform the functions of both TatA and TatB from a TatABC system (7).

A number of organisms in addition to E. coli have been useful for providing insight into the mechanism of Tat targeting and translocation. In Bacillus subtilis it has been demonstrated that different TatA and TatC homologs are required for secretion of distinct Tat substrates, establishing that there is substrate specificity for different Tat component paralogs (16). Further characterization of a B. subtilis TatA homolog demonstrated that this protein (whose E. coli homolog strictly localizes to the inner membrane) is present in both cytoplasmic and membrane fractions. In addition, this cytoplasmic TatA can be copurified with its Tat substrate, alkaline phosphatase (22). With no known general mechanism of membrane targeting of Tat substrates, it is interesting to speculate that B. subtilis TatA homologs are responsible for substrate recognition and targeting.

The Tat pathway has historically been viewed as a specialized secretion mechanism that is responsible for the translocation of Sec-incompatible substrates. This view was generalized to prokaryotes based on the initial studies performed in E. coli, which demonstrated that the majority of Tat substrates were redox proteins that likely incorporate their cofactors and therefore acquire significant structure prior to translocation (5, 25, 30). However, recent in vivo and computational studies indicate that the Tat pathway is rather a general secretion pathway and in many organisms is responsible for the secretion of a wide spectrum of proteins, including metabolic enzymes, solute-binding proteins, virulence factors, and proteases (12, 13, 19). In fact, one haloarchaeon (adapted to growth in environments approaching salt saturation) has been predicted to secrete nearly all of its exported proteins via the Tat pathway and only a few substrates via the Sec pathway (24). This haloarchaeon, Halobacterium sp. strain NRC-1, may have evolved to route proteins to the Tat pathway as an adaptive response to the high intracellular (∼4 M KCl) and extracellular (∼4 M NaCl) salt conditions.

The computationally based hypothesis of haloarchaeal Tat utilization implies a crucial role of the pathway in these organisms. Hence, to ascertain the importance of the Tat pathway in haloarchaea, we initiated characterization of the Tat machinery components, focusing on the genetically and biochemically amenable model organism Haloferax volcanii. We have identified two tatA homologs and two tatC homologs in Haloferax volcanii: tatAo, tatAt, tatCo, and tatCt. Genetic analyses revealed that three of these genes are essential for viability. This is the first time the Tat pathway has been reported to be required for aerobic growth in rich medium. Deletion of the nonessential tatAo has no effect on the secretion profile of a verified Tat substrate. In addition, fractionation studies showed that the two identified TatA paralogs localized to both the membrane and cytoplasmic fractions, and copurified from cytoplasmic preparations. Further biochemical characterization of TatA proteins using size exclusion chromatography indicated that the majority of the cytoplasmic species is present in high-molecular-weight complexes.

MATERIALS AND METHODS

Reagents.

All enzymes used for standard molecular procedures were purchased from New England Biolabs, except for Taq DNA polymerase and Pfu Turbo DNA polymerase, which were purchased from Stratagene. Dodecyl maltoside was purchased from Anatrace, Inc. The ECL Plus Western blotting system, horseradish peroxidase-linked anti-mouse immunoglobulin (from sheep) and anti-rabbit immunoglobulin (from donkey), and Sephacryl S-400 HR were purchased from Amersham Biosciences. Polyvinylidene difluoride membrane was purchased from Osmonics. DNA and plasmid purification kits, nickel-nitrilotriacetic acid (Ni-NTA) Superflow resin, and Penta-His antibodies were purchased from QIAGEN. NuPAGE gels, buffers, and reagents were purchased from Invitrogen. Anti-Myc tag monoclonal antibody 1-9E10 was obtained from the Genetics Core Facility, University of Pennsylvania. Difco Agar and Bacto yeast extract were purchased from Becton, Dickinson and Company. Peptone was purchased from Oxoid. 5-Fluoroorotic acid (5-FOA) was purchased from Toronto Research Biochemicals. All other chemicals and reagents were purchased from either Fisher or Sigma.

Plasmids, strains, and growth conditions.

The plasmids and strains used in this study are listed in Table 1. Haloferax volcanii strains were routinely grown at 45°C in 18% modified growth medium (14). When generating plasmid-integrated knockout intermediates or tat deletion strains, Haloferax volcanii was grown in CA medium (6) supplemented with thymidine (40 μg/ml) or with thymidine, uracil (50 μg/ml), and 5-FOA (150 μg/ml), respectively. Haloferax volcanii medium was supplemented with novobiocin (0.3 μg/ml), thymidine, uracil, and 5-FOA when necessary. E. coli strains were grown at 37°C in NZCYM and supplemented with ampicillin (200 μg/ml) when necessary.

TABLE 1.

Strains and plasmids

Strain or plasmid Relevant properties Reference
Plasmids
    pMLH3 Ampr Nbr Mevr; Haloferax volcanii-E. coli replicative vector 15
    pGB70 Ampr; pUC19 containing Pfdx-pyrE2 6
    pTA106 Ampr; pUC19 containing Pfdx-trpA Thorsten Allers
    pTA131 Ampr; pBluescript II with BamHI-XbaI fragment from pGB70 containing Pfdx-pyrE2 2
    pKD1 pTA131 containing chromosomal tatAo region with Pfdx-trpA from pTA106 replacing tatAo gene This study
    pKD2 pTA131 containing chromosomal tatAt region with Pfdx-trpA from pTA106 replacing tatAt gene This study
    pKD3 pTA131 containing chromosomal tatCo region with Pfdx-trpA from pTA106 replacing tatCo gene This study
    pKD4 pTA131 containing chromosomal tatCt region with Pfdx-trpA from pTA106 replacing tatCt gene This study
    pKD5 Ampr Nbr; pMLH3 containing Pfdx-tatAo6HIS inserted in place of Mevr cassette This study
    pKD6 Ampr Nbr; pMLH3 containing Pfdx-tatAt6HIS inserted in place of Mevr cassette This study
    pKD7 Ampr Nbr; pMLH3 containing Pfdx-tatCo6HIS inserted in place of Mevr cassette This study
    pKD8 Ampr Nbr; pMLH3 containing Pfdx-tatCt6HIS inserted in place of Mevr cassette This study
    pKD10 Ampr Nbr; pMLH3 containing Pfdx-halocyaninIMYC inserted in place of Mevr cassette This study
    pKD11 Ampr Nbr; pMLH3 containing Pfdx-halocyaninIMYC with the core twin-arginine codons replaced with lysine codons inserted in place of Mevr cassette This study
    pKD15 Ampr Nbr; pMLH3 containing Pfdx-tatCtNterm-MYC inserted in place of Mevr cassette This study
Strains
    DH5α E. coli F− φ80dlacZΔM15 (lacZYA-argF)U169 recA1 endA1 hsdR17(rK− mK+) phoA supE44 thi-1 gyrA96 relA1 Invitrogen
    DL739 E. coli MC4100 recA+dam-13::Tn9 8
    H99 Haloferax volcanii ΔpyrE2 ΔtrpA ΔhdrB 2
    KD1 H99 containing pKD5 This study
    KD2 H99 containing pKD6 This study
    KD3 H99 containing pKD7 This study
    KD4 H99 containing pKD8 This study
    KD5 H99 ΔtatAo::trpA+ This study
    KD6 H99 ΔtatAt::trpA+ containing pKD5 This study
    KD7 H99 ΔtatCo::trpA+ containing pKD8 This study
    KD10 H99 containing pKD10 This study
    KD11 H99 containing pKD11 This study
    KD12 KD5 containing pKD10 This study
    KD15 H99 containing pKD15 This study
    KD20 H99 ΔtatAt::trpA+ containing pKD6 This study
    KD21 H99 ΔtatCo::trpA+ containing pKD7 This study
    KD22 H99 ΔtatCt::trpA+ containing pKD8 This study

Sequence analyses.

Sequence information for the tat gene homologs and flanking regions from Halobacterium sp. strain NRC-1, Haloferax volcanii, and Haloarcula marismortui were obtained from NCBI (http://www.ncbi.nlm.nih.gov/Ftp/), the University of Scranton (http://wit-scranton.mbi.scranton.edu/Haloferax/), and TIGR (http://www.tigr.org/tigr-scripts/CMR2/batch_download.dbi), respectively. Membrane topologies of Tat proteins were predicted using TMHMM (28). Sequence alignments were performed using ClustalW (29). Putative Tat substrates among the predicted Haloferax volcanii open reading frames (ORFs), which were obtained from http://wit-scranton.mbi.scranton.edu/Haloferax/, were identified using TATFIND 1.2 (12).

Assembly of knockout constructs.

The knockout constructs were generated as previously described (2). In brief, 300 to 800 nucleotides flanking each end of the gene of interest were PCR amplified (for a list of primers used, see Table 2). These amplified flanking regions were sequentially cloned into the haloarchaeal suicide vector pTA131; the upstream flanking region was cloned into pTA131 that had been digested with EcoRI and HindIII, followed by cloning of the downstream flanking region into the BamHI and XbaI sites. The only exception was the upstream flanking region of tatAt, which was cloned into pTA131 that had been digested with EcoRI and XhoI. The trpA gene under the control of the fdx promoter (Pfdx) was cut out of pTA106 using BamHI and XbaI and treated with T4 DNA polymerase, and inserted into the above pTA131-based constructs that had been digested with BamHI and EcoRI and subsequently treated with T4 DNA polymerase. Hence, the final construct inserts were identical to the corresponding chromosomal regions except for the fact that the tat genes were replaced by Pfdx-trpA flanked by restriction digest scars. The four constructs generated were pKD1 (tatAo knockout construct), pKD2 (tatAt knockout construct), pKD3 (tatCo knockout construct), and pKD4 (tatCt knockout construct).

TABLE 2.

Primers used for PCR amplification

Primer Sequence (5′-3′)a Target sequence
TatAoKO up for Hind GATCAAGCTTCCCACCCACGAACAAATC 797 bp upstream of tatAo start codon, extension towards gene
TatAoKO up rev EcoRI CATGGAATTCCATTACGTTCGGTTACGT 1 bp upstream of tatAo start codon, extension away from gene
TatAoKO down for Bam GTACGGATCCTAGTACGCGTCTCCCCCG tatAo stop codon, extension away from gene
TatAoKO down rev Xba GTACTCTAGACCTCGCCTTCGTCCTCTC 797 bp downstream of tatAo stop codon, extension towards gene
TatAtKO up for Xho GTACCTCGAGGAATCAGGTGCGCTACCG 798 bp upstream tatAt start codon, extension towards gene
TatAtKO up rev EcoR GTACGAATTCCATCTATTTCTGCGTTACC tatAt start codon, extension away from gene
TatAtKO down for Bam GTACGGATCCTGACCACAGCTCACTGTC tatAt stop codon, extension away from gene
TatAtKO down rev Xba GTACTCTAGAGTGTTCCCACAGCCAGAC 819 bp downstream of tatAt stop codon, extension towards gene
TatCoKO up for Hind GTACAAGCTTCGAAGATGCCGACGATGG 797 bp upstream of tatCo start codon, extension towards gene
TatCoKO up rev EcoRI GTACGAATTCCATTCAGGTGTCCTACG tatCo start codon, extension away from gene
TatCoKO down for Bam GTACGGATCCACCAAACTGAAGGTCGCC 512 bp upstream of tatCo stop codon, extension away from gene
TatCoKO down rev Xba GTACTCTAGAAGACAGGGCGACGAGGTC 136 bp downstream of tatCo stop codon, extension towards gene
TatCtKO up for Hind GTACAAGCTTGAGCGCGTTGAGGATGTC 802 bp upstream of tatCt start codon, extension towards gene
TatCtKO up rev EcoRI GTACGAATTCCATACGTACGTGGCGAAAGC tatCt start codon, extension away from gene
TatCtKO down for Bam GTACGGATCCGAGTGAGCACGGCGCACC 3 bp upstream tatCt stop codon, extension away from gene
TatCtKO down rev Xba GTACTCTAGACGATGGCCTGACTCGTCG 793 bp downstream of tatCt stop codon, extension towards gene
ForFdx GTAACGCCAGGGTTTTCC 199 bp upstream of pyrE2 start codon, extension towards pyrE2 gene
RevFdx CATGGCTGCAGAGTTCGGCT pyrE2 start codon, extension away from pyrE2 start codon
ForTatAo FdxOL AGCCGAACTCTGCAGCCATGCTGGATTCCATTCCG tatAo start codon, extension towards stop codon of tatAo
RevTatAo 6-His Xba GATCTCTAGATCAGTGATGGTGATGGTGATGCGGGCCGCCTCTACTCTCGGCTTCCGT 1 bp upstream of tatAo stop codon, extension towards start codon of tatAo
ForTatAt FdxOL AGCCGAACTCTGCAGCCATGTTCGAGACCATCACC tatAt start codon, extension towards stop codon of tatAt
RevTatAt 6-His Xba GATCTCTAGATCAGTGATGGTGATGGTGATGCGGGCCGCCGTTCGACGATTCCGTCGA 1 bp upstream of tatAt stop codon, extension towards start codon of tatAt
ForTatCo FdxOL AGCCGAACTCTGCAGCCATGGCGGACGAGGAGCGT tatCo start codon, extension towards stop codon of tatCo
RevTatCo 6-His Xba GATCTCTAGATCAGTGATGGTGATGGTGATGCGGGCCGCCGTTCCCGGTCCAGCGTAA 1 bp upstream of tatCo stop codon, extension towards start codon of tatCo
ForTatCt FdxOL AGCCGAACTCTGCAGCCATGTCCAGCGCCCTCGAC tatCt start codon, extension towards stop codon of tatCt
ForTatCt FdxOL_NtermMyc AGCCGAACTCTGCAGCCATGGAGCAGAAGCTCATCAGCGAGGAGGATCTGTCCAGCGCCCTCGAC tatCt second codon, extension towards stop codon of tatCt
RevTatCt 6-His Hind GATCAAGCTTTCAGTGATGGTGATGGTGATGCGGGCCGCCCTCCGCCGCGCCGCGGGC 1 bp upstream of tatCt stop codon, extension towards start codon of tatCt
Halocyanin For FdxOL AGCCGAACTCTGCAGCCATGACGCAACGGGTTTCC halocyanin1 start codon, extension towards stop codon of halocyanin1
Halocyanin RevMyc Hind GAAAGCTTTTACAGATCCTCCTCGCTGATGAGCTTCTGCTCCTCGACGACGACGACGCCG 1 bp upstream of halocyanin1 stop codon, extension towards start codon of halocyanin1
HaloKK For CAACGGGTTTCCAAGAAGTCGTTTCTCCACGCAACG bp 25 of the halocyanin1 gene, extension towards stop codon of halocyanin1
HaloKK Rev CTTCTTGGAAACCCGTTGCGTCAT bp 18 of the halocyanin1 gene, extension towards start codon of halocyanin1
a

Restriction endonuclease sites are underlined. Regions required for overlap PCR addition of Pfdx or alteration of twin arginine codons are in bold. Sequences encoding 6His or Myc tags are italic.

Generating chromosomal deletions.

Chromosomal deletion attempts were performed as previously described (2). The pKD1, pKD2, pKD3, and pKD4 constructs described above were extracted from E. coli DH5α and passed through E. coli DL739 to obtain nonmethylated DNA. Nonmethylated plasmids were then independently transformed into Haloferax volcanii H99 by virtue of the standard polyethylene glycol method (14). A single homologous recombination event between one of the flanking regions on the knockout construct and the chromosome (pop-in) was selected for by growth on CA (which lacks uracil and tryptophan) supplemented with thymidine. Positive selection for this recombination event occurs because the suicide plasmids pKD1 to pKD4 encode the pyrE2 and trpA genes, which are required for uracil and tryptophan biosynthesis, respectively.

Colonies were screened by PCR to confirm that the recombination event occurred at the proper location on the chromosome. Recombinants were next grown in liquid CA supplemented with thymidine and uracil for 48 h to allow a second recombination event that would result in excision of the plasmid from the chromosome (pop-out) to occur. Excision of the plasmid would result in either reversion to the parental locus or replacement of the gene on the chromosome with the Pfdx-trpA insert. However, under these growth conditions, cells require the trpA gene for growth. Therefore, of those cells that underwent a second recombination event, only those that replaced the tat gene on the chromosome with the Pfdx-trpA insert would be viable. After 48 h, the liquid cultures were transferred to CA plates supplemented with thymidine, uracil, and 5-FOA. These growth conditions only permit the growth of cells that have excised the plasmid from the chromosome in a manner that resulted in gene replacement with Pfdx-trpA. Colonies were screened by PCR to confirm the chromosomal replacement event occurred. If tat gene replacements were not obtained, pop-in cells were complemented with an exogenous copy present on the shuttle plasmid pMLH3 (see below). Chromosomal replacement of the tat gene in these strains was obtained as described above.

Construction of expression vectors.

The tatAo, tatAt, tatCo, and tatCt genes were placed under the control of Pfdx (20) and cloned into pMLH3 with a C-terminal 6-His tag, generating pKD5, pKD6, pKD7, and pKD8, respectively. In addition, the tatCt gene was placed under the control of Pfdx (20) and cloned into pMLH3 with an N-terminal Myc tag, generating pKD15. Pfdx was amplified from pGB70 using the FdxFor and FdxRev primers and the tat genes were amplified with the relevant primers (see Table 2). The tat genes were then placed under the control of Pfdx by overlap PCR using both the tat gene and the fdx promoter fragment as templates. The resulting Pfdx-tatAo, Pfdx-tatAt, and Pfdx-tatCo fragments were digested with EcoRI and XbaI and ligated into pGB70 that had been digested with EcoRI and XbaI and treated with calf intestinal phosphatase. The inserts were then subcloned into pMLH3 using BamHI and HindIII sites for both insert and vector. Alternatively, the Pfdx-tatCt fragments were digested with BamHI and HindIII and directly ligated to pMLH3 that had been digested with BamHI and EcoRI and treated with calf intestinal phosphatase. Construct fidelity was confirmed by sequencing. The resulting constructs were extracted from E. coli DH5α and passed through E. coli DL739 to obtain nonmethylated DNA. Nonmethylated constructs were then transformed into Haloferax volcanii H99 by the standard polyethylene glycol method (14). H99 strains possessing pKD5, pKD6, pKD7, pKD8, or pKD15 were designated KD1, KD2, KD3, KD4, and KD15, respectively.

The halocyanin 1 gene was cloned into pMLH3 under the Pfdx promoter using a strategy similar to that described for the tat genes, generating pKD10. In brief, the amplified halocyanin 1 gene was placed under the control of Pfdx by overlap PCR using both the halocyanin 1 gene and the fdx promoter fragment as templates (see Table 2 for primers used). The resulting Pfdx-halocyanin 1 gene fragment was digested with BamHI and HindIII and ligated into pMLH3 that had been digested with BamHI and HindIII and treated with calf intestinal phosphatase. The twin arginine residues of the gene product were altered to twin lysines via overlap PCR using pKD10 as the DNA template and primers (Table 2) that resulted in replacement of the two arginine codons (CGG CGG) with two lysine codons (AAG AAG). The fidelity of the mutant construct (pKD11) and pKD10 was confirmed by sequencing. The constructs were extracted from E. coli DH5α and passed through E. coli DL739 to obtain nonmethylated DNA and subsequently transformed into H99 or KD5 by the standard polyethylene glycol method (14). The H99 strains possessing pKD10 and pKD11 were designated KD10 and KD11, respectively, while strain KD5 possessing pKD10 was designated KD12.

Expression and localization of Tat component homologs and substrate.

Liquid cultures of strains KD1, KD2, KD3, KD4, KD10, KD11, KD12, and KD15 were grown until mid-log phase (optical density at 600nm, ∼0.6) and were subsequently fractionated. Cells were collected by centrifugation at 4,300 × g for 10 min at 4°C. The cell pellets were washed once in PB(2M)S (2.14 M NaCl, 2.68 mM KCl, 10.14 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4) with a final concentration of 10 mM EDTA, and then pelleted again as described and resuspended in 1/10th volume of PB(2M)S. Resuspended cells were disrupted on ice using the Dynatech Sonic Dismembrator (model 150) equipped with a microtip at setting 50 (eight 5-second pulses with 3-second intervals). Insoluble debris were pelleted by three rounds of centrifugation at 5,200 × g for 10 min at 4°C. The samples were then fractionated by ultracentrifugation at 314,000 × g for 30 min at 4°C.

The supernatant (cytoplasmic fraction) and pellet (membrane fraction) were separated and the pellets were resuspended in 1 ml of PB(2M)S. Both the supernatant and the resuspended pellet were ultracentrifuged again at 314,000 × g for 30 min at 4°C to remove any residual membrane and cytoplasmic contamination, respectively. Cytoplasmic proteins were precipitated with cold trichloroacetic acid (10%, vol/vol) and washed with cold acetone (80%, vol/vol). Proteins secreted into the media were also precipitated with cold trichloroacetic acid (10%, vol/vol) and washed with cold acetone (80%, vol/vol) for cultures of strains KD10, KD11, and KD12.

Western blotting details.

All protein samples were stored in 1× NuPAGE lithium dodecyl sulfate sample buffer and supplemented with 50 mM dithiothreitol. Samples were run on Bis-Tris NuPAGE gels under denaturing conditions using either morpholinepropanesulfonic acid (MOPS) or morpholineethanesulfonic acid (MES) running buffer. Proteins were transferred to polyvinylidene difluoride using the Bio-Rad Transblot-SD semidry transfer cell at 15 V for 30 min. Three buffers were used in semidry transfer: anode I (300 mM Tris, 10% [vol/vol] methanol, pH 10.4), anode II (25 mM Tris, 10% [vol/vol] methanol, pH 10.4), and cathode (25 mM Tris, 40 mM glycine, and 10% [vol/vol] methanol, pH 9.4). Polyvinylidene difluoride membranes were probed with the primary antibodies Penta-His (1:1,000), anti-Myc (1:1,000), or anti-TatAo (1:2,500) and the secondary antibodies anti-mouse immunoglobulin (1:10,000) or anti-rabbit immunoglobulin (1:10,000). Anti-TatAo antibodies (from a rabbit) were generously raised in the laboratory of Enno Hartmann (University of Lübeck, Lübeck, Germany) against a synthesized peptide (Cys-TETEAESR-COOH).

Characterization of TatAo and TatAt complexes.

We pelleted 2-liter cultures of H99 and KD2 at an optical density at 600 nm of ∼0.6 by centrifugation at 6,500 × g for 10 min at 4°C. Pellets were resuspended in 20 ml of PB(2M)S with a final concentration of 10 mM EDTA, frozen once at −80°C, and then thawed at 37°C. Cells were disrupted by passing the resuspended cells through a French Pressure Cell Press (SLM-Aminco) twice with a cell pressure of 20,000 lb/in2. Lysates were centrifuged at 17,400 × g for 10 min at 4°C to remove cellular debris and unbroken cells. The samples were then fractionated by ultracentrifugation at 184,000 × g for 1 h at 10°C. The supernatant (cytoplasmic fraction) and pellet (membrane fraction) were separated and the pellets were resuspended in 20 ml of PB(2M)S. Both the supernatants and the resuspended pellets were ultracentrifuged again at 184,000 × g for 1 h at 10°C to remove any residual membrane and cytoplasmic contamination, respectively. Membrane pellets were resuspended in 20 ml of PB(2M)S.

For Ni-NTA affinity chromatography, cytoplasmic fractions were incubated for 1 h at room temperature on a rolling platform with 1 volume of equilibration buffer, PB(2M)S in 20% glycerol with 20 mM imidazole. Ni-NTA resin was pelleted from a 50% slurry, washed three times with native binding buffer, PB(2M)S in 10% glycerol with 10 mM imidazole. The washed resin was added to the equilibrated cytoplasmic fraction and protein binding to the resin was allowed for 1 h at room temperature with continuous inversion, upon which the mixture was applied to a 2-ml column. The Ni-NTA beads were washed with 2 ml native binding buffer and 2 ml wash buffer, PB(2M)S in 20% glycerol with 40 mM imidazole. Bound proteins were eluted with 1 ml of elution buffer, PB(2M)S in 10% glycerol with 250 mM imidazole, in 0.25-ml fractions. For membrane samples the same protocol was used but dodecyl maltoside was added to all buffers to a final concentration of 0.2% (except for equilibration buffer, in which case the final concentration was 0.4%).

The fractions were also analyzed by size exclusion fast protein liquid chromatography; 0.3 ml of cytoplasmic or membrane fraction was loaded onto a Sephacryl S-400 HR column that was previously equilibrated in PB(2M)S buffer or PB(2M)S in 10% glycerol and 0.4% dodecyl maltoside, respectively. The flow was adjusted to 0.4 ml/min and 1.5-ml elution fractions were collected. The resolution of the column was determined under high-salt (2.68 M NaCl) conditions with the molecular weight marker kit (MW-GF-1000) from Sigma. Elution fractions were trichloroacetic acid precipitated and analyzed by Western blotting.

RESULTS

Genetic structure and computational characterization of haloarchaeal tat genes.

Recently, complete genome sequences have become available for two haloarchaeal species, Halobacterium sp. strain NRC-1 and Haloarcula marismortui, as well as partial genomic data for a third, Haloferax volcanii (4, 17)(http://wit-scranton.mbi.scranton.edu/Haloferax/). Our analyses of the three haloarchaea revealed that each haloarchaeon encoded one (Halobacterium sp. strain NRC-1 and Haloarcula marismortui) or two (Haloferax volcanii) tatA and two tatC homologs, which was consistent with previous examination of the Halobacterium sp. strain NRC-1 genome (9, 32).

In a number of bacteria, tat genes are encoded in a common operon, occasionally with genes encoding Tat substrates. Therefore, our analyses of the haloarchaeal Tat pathway included examination of the chromosomal regions surrounding the tat genes, which focused mainly on those in Haloferax volcanii (renamed here tatAo, tatAt, tatCo, and tatCt) (Fig. 1A). The tatAo and tatAt genes are located on the chromosome independently of other tat genes and genes encoding putative Tat substrates. However, interestingly, a gene predicted to encode the arginyl-tRNA (CCT) (which associates with the relatively rare AGG arginine codon) is located 78 base pairs downstream of the tatAt open reading frame. It should be noted that this genetic order was also found to be conserved for the tatA and Arg-tRNA (CCT) orthologs in Halobacterium sp. strain NRC-1 and Haloarcula marismortui.

FIG. 1.

FIG. 1.

Genetic structure and predicted membrane topology of tat genes and proteins. (A) Genetic arrangement of the four Haloferax volcanii tat genes on the chromosome. The gene downstream of tatAt encodes arginyl-tRNA (CCT) (arg). (B) Membrane topology of the Tat proteins using TMHMM to predict TMSs. The TatCt protein is likely the result of a gene duplication event, as there are two distinct TatC domains (comprised of the first six and last six TMSs), which are connected by two additional TMSs (the seventh and eighth TMSs). Putative amphipathic helices of TatAo and TatAt are also included in the diagram.

We speculated there was a connection between this tRNA and codon usage in Tat signal sequences and therefore examined putative Haloarcula marismortui Tat signal sequences predicted by TATFIND 1.2 for the presence of the AGG codon for either of the twin arginine residues. However, our analysis revealed that the percentage of arginines within the Tat motif encoded by AGG does not deviate significantly from the percentage of arginines encoded by AGG throughout this haloarchaeal genome (approximately 4.7% and 6.0%, respectively).

Analyses of the genetic arrangement of the tatC homologs revealed that the tatCo and tatCt start ATG codons are located 130 base pairs apart, with the two genes on opposite strands of the chromosome (Fig. 1A). Similar to the conservation of the genetic environment noted for that of tatAt, the organization of tatCo and tatCt is identical in all three haloarchaea analyzed.

The corresponding amino acid sequence of each tat gene from Haloferax volcanii was analyzed with TMHMM for the presence of transmembrane segment (TMS) (Fig. 1B). As is the case with all known TatA homologs, the TatAo (9.6kDa) and TatAt (9.7kDa) proteins were each predicted to possess a single N-terminal TMS followed by a cytoplasmic amphipathic helix and C-terminal region. Alignment of TatAo and TatAt revealed extremely high identity in the N-terminal two-thirds of the protein, yet the alignment exhibited relatively weak identity in the C-terminal third of the TatA paralogs (Fig. 2).

FIG. 2.

FIG. 2.

Amino acid sequence alignment of Haloferax volcanii TatA paralogs. The amino acid sequences of TatAo and TatAt were aligned using ClustalW. Identity between the two sequences is designated by a straight line, whereas strong and weak similarity is indicated by two dots and one dot, respectively. TMSs are shaded pink (α-1), whereas the residues predicted to compose the amphipathic helix are shaded green (α-2). For TatAo, a second possible amphipathic helix was identified and is shaded orange (α-3). A gap in the corresponding region of TatAt disrupts the potential amphipathic periodicity.

Similar to other TatC homologs, TatCo (47kDa) was predicted to possess six TMSs with the N and C termini localized in the cytoplasm. However, this protein possessed an extended cytoplasmic region at the N terminus. The other TatC homolog in Haloferax volcanii, TatCt (78 kDa), was predicted to possess 14 TMSs, again with the N and C termini localized in the cytoplasm. The atypical structures observed for the TatC homologs were also conserved in Halobacterium sp. strain NRC-1 (9) and Haloarcula marismortui and have only been identified in haloarchaeal species. It is noteworthy that the Haloarcula marismortui TatCo ortholog also possesses a C-terminal extension resulting in a 10-TMS protein.

The Tat pathway is essential in Haloferax volcanii.

We initiated genetic characterization of the Tat machinery components in Haloferax volcanii. We attempted to replace the chromosomally encoded copy of each tat gene with a prototrophic marker as described in Materials and Methods, which would effectively knock out the gene (results summarized in Table 3). The tatAo gene was successfully knocked out, generating strain KD5. KD5 (ΔtatAo) exhibited no phenotype commonly detected in mutants deficient in protein secretion; specifically, growth rates were unaltered at 30°C and 45°C, no gross defect in cell septation was perceivable, and growth on minimal media supplemented with a variety of carbon sources was equivalent to that of H99 (data not shown).

TABLE 3.

Essentiality of tat genes when Haloferax volcanii is grown aerobically in rich medium

Gene Knockout viable Knockout viable when complemented Knockout viable when complemented with paralog
tatAo Yes N/A N/A
tatAt No Yes Yes
tatCo No Yes Yes
tatCt No Yes No

In contrast to the lack of observable phenotype for tatAo, we were not able to generate knockout strains for tatAt, tatCo, and tatCt. However, before we could label the Tat pathway as essential for viability, we had to ensure that it was specifically loss of the tat gene from the organism that resulted in lethality and not an unaccounted polar effect. Therefore, we introduced a plasmid that expressed the relevant tat gene from a constitutive promoter into the knockout intermediate strains (which still possessed a chromosomal copy of the gene) and then selected for knockouts. We were now able to obtain chromosomal knockouts for tatAt, tatCo, and tatCt (Table 2). Hence, for the first time in any organism, we have demonstrated that the Tat pathway is essential for viability in Haloferax volcanii when it is grown aerobically in complex medium.

It was intriguing that tatAt was essential and tatAo was not, given how similar the sequences of the two gene products were found to be. We therefore set out to determine if tatAt could be knocked out when tatAo was expressed in trans from a constitutive promoter. Under these conditions, tatAt was successfully replaced with our prototrophic marker on the chromosome. While the tatCt gene could not be knocked out when the cells were supplied with a tatCo expression plasmid, tatCo was effectively knocked out when the cells were first supplied with a plasmid encoding the constitutive expression of tatCt (Table 2). This cross-complementation suggests that the Haloferax volcanii Tat machinery paralogs have similar and possibly partially overlapping functions.

Tat substrate analysis in wild-type and KD5 (ΔtatAo) strains.

The requirement of the Tat pathway for viability was not surprising, as previous preliminary computational analyses of the partial Haloferax volcanii genomic sequence indicated the majority of secretory proteins possess typical twin-arginine signal sequences (24). However, it is not clear whether the lethal phenotype is the synergistic result of blocking general translocation or a specific result of improper localization of certain essential proteins.

Recently, a more complete draft of the Haloferax volcanii genome has been assembled, and we analyzed the corresponding ORFs using TATFIND 1.2 to identify putative Tat substrates. The list of potential Tat substrates was scanned for possible essential proteins that would help explain the essential nature of the tatAt, tatCo, and tatCt genes. Candidate Tat substrate proteins essential or crucial for the growth of Haloferax volcanii under laboratory conditions included numerous solute-binding and transport genes (e.g., iron-binding protein) and five small blue copper proteins that may be involved in vital electron transfer events (i.e., halocyanins).

We chose one of the putative Tat substrates from this list, halocyanin 1, to verify the computational prediction and examine if there is a translocation defect of the protein in the absence of the tatAo gene. Halocyanin 1 was Myc tagged and placed under the control of a constitutive promoter, and the resulting plasmid construct was introduced into the H99 background. Although considerable amounts of the tagged protein were detected in the cytoplasmic fraction of this strain, the majority of this probable lipoprotein was membrane associated or secreted, as evident from detection of the mature protein in the membrane and culture medium, respectively (Fig. 3A, lanes 1 to 3).

FIG. 3.

FIG. 3.

Tat substrate localization for wild-type and mutant signal sequences and in the KD5 (ΔtatAo) background. Anti-Myc Western blot analysis of cytoplasmic (c), membrane (m), and culture medium (s) fractions from the wild-type H99 (wt) strain expressing the halocyanin 1 gene with a wild-type (halo1RR) or mutant (halo1KK) signal sequence (A) and the KD5 (ΔtatAo) strain expressing the wild-type halocyanin 1 gene (B).

Before this substrate could be analyzed in the KD5 (ΔtatAo) background, we first had to confirm that it is indeed secreted in a Tat-dependent manner. Since a tat null strain is not obtainable in Haloferax volcanii for verification of halocyanin 1 as a Tat substrate, the critical twin arginine residues in the signal sequence were replaced with twin lysine residues via standard recombination techniques. Introduction of the mutated halocyanin 1 gene into H99 resulted in no detection of the gene product in the membrane fraction or culture medium. Instead, the protein appears to be confined to the cytoplasm, confirming the computational prediction of its being a Tat substrate (Fig. 3A, lanes 4 to 6). In the cytoplasm, a larger band was also apparent only in the strains harboring the mutated halocyanin 1 gene, which may indicate the protein is subjected to modification or obtains different structures with different solubilities when its secretion is blocked.

The wild-type Myc-tagged halocyanin 1 gene construct was next introduced into the KD5 (ΔtatAo) background. Western blot analysis of cytoplasmic, membrane, and culture medium fractions revealed that despite a moderate increase in cytoplasmic retention of halocyanin 1, translocation of this Tat substrate was not grossly altered in the absence of tatAo compared to that in H99 (Fig. 3B, lanes 1 to 3). Hence, the translocation of at least one Tat substrate in Haloferax volcanii appears to be independent of the nonessential tatAo.

Expression and localization of Tat component homologs.

Initial biochemical characterization of the Haloferax volcanii Tat components involved determining their cellular localization. We introduced plasmids into H99 that expressed 6-His-tagged variants of the tat genes under the control of a constitutive promoter. We then analyzed the cytoplasmic and membrane protein content of the transformants (KD1, KD2, KD3, and KD4) via Penta-His Western blotting. For both TatAo and TatAt, significant protein levels were detected in both the cytoplasmic and membrane fractions (Fig. 4A). Although this could have been a result of poor fractionation technique, the detection of both TatCo and TatCt strictly in the membrane fraction indicated that our cytoplasmic preparation was free of membrane contamination.

FIG. 4.

FIG. 4.

Tat protein localization. (A) Penta-His Western blot analysis of cytoplasmic (c) and membrane (m) fractions from wild-type H99 (wt) and strains expressing His-tagged variants of tatAo, tatAt, tatCo, and tatCt. (B) Anti-TatAo Western blot analysis of cytoplasmic (c) and membrane (m) fractions from wild-type H99 (wt) for TatAo localization when expressed at chromosomal levels. As a negative control, KD5 (ΔtatAo) was also analyzed by anti-TatAo Western blot. Arrows indicate where each protein migrates.

A remaining concern was that constitutively expressed tatA genes resulted in abnormally high levels of protein and as a result, membrane integration of a subset of these components was impaired. To address this concern, anti-TatAo antibodies were generated and used to probe the localization of this protein when the gene was expressed at chromosomal levels (Fig. 4B). Analysis of H99 cellular fractions demonstrated that this dual localization of TatAo also occurred in the parental strain. Probing cytoplasmic and membrane fractions of the ΔtatAo strain (KD5) verified both the specificity of the anti-TatAo antibody and the lack of TatAo production in this strain (Fig. 4B).

It is noteworthy that the TatCt amino acid sequence yielded a predicted molecular mass of 78 kDa, but the Penta-His reactive species from KD4 membranes migrated at an estimated molecular mass of 55 kDa. This could suggest the single predicted tatCt ORF is actually comprised of two independent genes or there is a posttranscriptional-translational processing event occurring. However, when we performed anti-Myc Western blot analysis on membranes from cells expressing an N-terminally Myc-tagged version of tatCt (KD15), we observed that the reactive band migrated at the same molecular weight as noted for that from KD4 (Fig. 5). This strongly suggested that tatCt is a single ORF and that the unexpected sizes of the anti-Myc and Penta-His reactive bands resulted from the tatCt gene products running anomalously in the gel.

FIG. 5.

FIG. 5.

N-terminally tagged TatCt indicates the transcript/protein is not processed. Membrane preparation from wild-type H99 (wt) and a strain expressing a Myc-tagged variant of tatCt were analyzed by anti-Myc Western blot. The Myc-reactive band from the KD15 membrane runs at the same size as the His-reactive band from the KD4 membrane (Fig. 4A), suggesting TatCt runs anomalously in the gel.

Characterization of TatAo and TatAt.

The aim of our initial biochemical investigation of the Haloferax volcanii Tat pathway was identification of TatA component interactions and characterization of possible TatA complexes. Therefore, the KD2 strain was used in copurification studies to evaluate the presence of Tat component complexes in Haloferax volcanii. Cytoplasmic and membrane protein preparations from KD2 were subjected to Ni-NTA purification and the different fractions from the purification were analyzed via Penta-His and anti-TatAo Western blotting (Fig. 6). His-tagged TatAt was efficiently purified from both fractions. Interestingly, the TatAo protein copurified from the cytoplasmic fraction, while TatAo failed to copurify from the membrane preparation under the conditions employed. However, TatAt and TatAo interaction in membranes cannot be discounted from these results since the protein purification of each subcellular fraction required distinct conditions. Our analyses of the presence of complexes possessing TatCo and TatCt have so far proved unsuccessful due to technical issues as well as an inability to raise specific antibodies against these proteins.

FIG. 6.

FIG. 6.

Ni-NTA copurification of TatAo and TatAt. Cytoplasmic and membrane preparations from KD2 were subjected to Ni-NTA affinity chromatography and the elution fractions were probed with both Penta-His and anti-TatAo antibodies. E1, elution 1; E2, elution 2; E3, elution 3; E4, elution 4.

In order to determine if cytoplasmic and membrane-bound TatA proteins were present in larger complexes, the contents of Haloferax volcanii strains were further characterized using size exclusion fast protein liquid chromatography. The cytoplasmic and membrane fractions from the KD2 strain were loaded on a Sephacryl S-400 HR column and 1.5-ml elution samples were collected and probed with anti-TatAo or Penta-His antibodies (Fig. 7).

FIG. 7.

FIG. 7.

Characterization of cytoplasmic TatAo using size exclusion chromatography. Cytoplasmic and membrane proteins from KD2 were fractionated via fast protein liquid chromatography on a Sephacryl S-400 HR column and 1.5-ml elution fractions were collected and analyzed via anti-TatAo Western blot (bottom). The UV traces of the elution of three relevant standard molecules (blue dextran, apoferritin, and carbonic anhydrase) are shown to provide a relative size reference for the elution fractions (top).

Western blot analysis of cytoplasmic elutions revealed the majority of TatAo and TatAt were present in high-molecular-weight complexes, ranging from ∼400 to 2,000 kDa. Often we found the TatAt elution profile similar to that of TatAo, but in reproducing this experiment we occasionally observed TatAt elution in fractions representing lower molecular weights (data not shown). This may have been due to instability or dissociation of the TatAt complex(es) caused by TatAt protein overproduction in the KD2 strain. In order to rule out the possibility that the elution profile observed for TatAo from the KD2 strain was an effect of overproduction of TatAt, the cytoplasmic protein content of H99 was also subjected to size exclusion fast protein liquid chromatography. In both the H99 and KD2 strains, the elution profiles for TatAo were consistent and highly reproducible.

Chromatographic studies of the membrane fraction from KD2 indicated that, similar to cytoplasmic TatA proteins, membrane-bound TatAo and TatAt are in higher-molecular-weight complexes. However, the range of membrane-bound TatA complex sizes was relatively smaller, ranging from ∼30 to 700 kDa.

DISCUSSION

The most amazing features of the Tat pathway are the ability to translocate prefolded proteins without disrupting membrane integrity and the vastly different extents to which it is utilized among prokaryotes. An interesting mystery raised by the distinct usage of this pathway in diverse organisms is why proteins are targeted to the Tat pathway and not the Sec pathway. In many organisms, such as E. coli and the archaeon Pyrobaculum aerophilum, the Tat pathway is apparently almost exclusively dedicated to the secretion of a number of cofactor-containing redox proteins (5, 12). Here the precursor protein acquires its cofactor and therefore tertiary structure while in the cytoplasm. Hence, it appears that one major determinant for translocation via the Tat pathway is incompatibility with Sec transport.

In contrast, analyses of distinct haloarchaeal genomes suggest that the majority of their exported proteins are Tat substrates and the Sec pathway plays a relatively minor role in protein secretion (9, 24). Our genetic data, which indicated the Tat pathway was essential for viability in Haloferax volcanii grown aerobically in complex medium, strongly supports the computational data. It was previously hypothesized by two independent groups that this may be due to the high concentration of intracellular salt these organisms maintain to balance the high external concentration of sodium (9, 24). In particular, such high internal salt conditions may result in an accelerated protein folding rate to avoid cytoplasmic aggregation. Thus, the Tat pathway would be a more advantageous secretion pathway for the folded substrate.

If this was the sole driving force behind routing the majority of proteins to the Tat pathway, we would expect all halophilic organisms that balance external sodium with internal potassium to utilize the same secretion strategy. Recently, we were granted access to the preliminary genome sequence of Salinibacter ruber, a halophilic bacterium that, like haloarchaea, uses a high internal potassium concentration to balance the ∼4 M extracellular sodium conditions (3; www.tigr.org/tdb/ufmg/; K. Nelson and E. Mongodin, personal communication). However, using TATFIND 1.2 to examine the S. ruber draft genome sequence, only a few putative Tat substrates were identified, and it was apparent that this organism was not using the Tat pathway as the major route of protein secretion. Hence, high internal salt concentrations may not be the main factor determining secretory routing. However, it should be noted that there are major molecular differences in secretion between archaea and bacteria. For example, the lack of SecA and trigger factor in haloarchaea may make the Tat pathway a more optimal secretion mechanism, whereas the presence of these proteins in S. ruber may facilitate efficient secretion via the Sec pathway. Thus, protein-folding kinetics may be much faster in high-salt conditions, which might make it more favorable in haloarchaea to secrete the folded protein, whereas trigger factor and SecA may assist in maintaining the protein in a Sec-competent conformation in S. ruber.

In our examination of the Haloferax volcanii genome, four tat genes were identified. These genes exhibited unique characteristics in chromosomal organization and protein structure, most of which were conserved in all three haloarchaea investigated. Hence, any of these unique features may represent a specific adaptation to extensive Tat trafficking. For example, both TatC paralogs found in the haloarchaea are structurally atypical: one had an extended cytoplasmic N terminus, and the other was an internally duplicated gene product. It is interesting that two different modifications were observed for the TatC homologs, suggesting each haloarchaeal TatC has obtained a distinct modified function.

Evaluation of the E. coli TatC protein demonstrated it is an initial binding partner of the Tat signal sequence at the membrane (1), so the altered TatCo and TatCt proteins may have optimized preprotein binding. Equally, the haloarchaeal TatC proteins may allow more rapid formation or dissociation of potential TatAC or TatC-substrate complexes, facilitating greater turnover of active components or allowing interaction with an unidentified Tat component. Finally, the modifications may expand their function or allow for recognition or secretion of proteins in folding states not accepted in other organisms. We believe that it is unlikely these atypical TatC features were general adaptations to high-salt conditions, as it would be expected, for example, that both paralogs would possess an extended cytoplasmic N terminus. In addition, the TatC homolog identified by automated annotation of the S. ruber genome resembles a typical TatC protein, possessing none of the modified characteristics described for the Haloferax volcanii TatC protein. Although it is still possible that the two TatC homologs in haloarchaea obtained disparate structural features to adapt to the halophilic environment, these modified TatC proteins likely represent adaptation to the unique utilization of the Tat pathway in haloarchaea.

Computational investigation of the Haloferax volcanii TatA ortholog sequences revealed the N termini of the proteins are virtually identical, while the cytoplasmic C-terminal regions of the two are quite distinct. This alignment indicates the two proteins have similar (based on the high-identity regions) yet distinct (based on the weak-identity region) functions. The two TatA paralogs in B. subtilis, which differ considerably at the C terminus due to distinct lengths of the TatA proteins, are required for the translocation of different substrates (16). It may follow that TatAo and TatAt each interact with specific Tat substrates in Haloferax volcanii.

Without exception, known TatA homologs possess an N-terminal segment that resembles a TMS. It was therefore unexpected that TatA homologs were detected in Haloferax volcanii cytoplasmic fractions as well as in cytoplasmic fractions from B. subtilis and Streptomyces lividans (10, 22). The presumed role of TatA from work with E. coli has been formation of the translocation channel for the Tat pathway (26). However, identification of cytoplasmic TatA argues against this being the only role of this protein family in Tat secretion.

Currently, the physiological relevance of these TatA homologs present in the cytoplasm is not well understood. In B. subtilis, cytoplasmic TatA homologs copurify with Tat substrate, suggesting they may be involved in membrane targeting of the precursor (22). Although we have not yet addressed TatA homolog interaction with substrate in Haloferax volcanii, our initial characterization of TatAo and TatAt revealed they stably interact with each other in the cytoplasm. Also, cytoplasmic TatAo was found to be present in high-molecular-weight complexes ranging from 400 to 2,000 kDa. Further analysis of TatA proteins indicated that the majority of the membrane-bound proteins are also complexed. However, these complexes were smaller and apparently not comprised of both TatAo and TatAt. Therefore, in Haloferax volcanii, Tat substrates may initially interact specifically with either TatAo or TatAt that are part of a high-molecular-weight complex in the cytoplasm. The TatA engaged with a Tat substrate may then dissociate from the high-molecular-weight complex and integrate into the membrane, potentially at the site of a TatC protein. The lack of an identified TatAo-TatAt interaction in the membrane may indicate that if the high-molecular-weight TatA complexes detected by size exclusion are ring-like oligomers, they are largely homooligomers. It will be paramount in the future to more precisely characterize the function of cytoplasmic TatA and discern the purpose of different organisms' maintaining distinct TatA localization properties.

Using E. coli as a model organism to study the Tat pathway has been and surely will be an invaluable tool for identification and characterization of the translocation machinery and comprehension of this secretory mechanism. But clearly, continued analyses in other prokaryotes are necessary to gain a more complete insight into how this pathway functions, particularly how diverse organisms utilize the Tat pathway for distinct reasons and require different machinery components for efficient translocation. By studying the haloarchaea, we have identified a group of organisms that have routed the majority of secretory proteins to the Tat pathway and require the tat genes for viability. The Tat pathway of Haloferax volcanii (and other haloarchaea) may also provide extremely useful information on how to improve secretion efficiency through this pathway.

Acknowledgments

We thank Enno Hartmann for generously raising antibodies against TatAo. M. Meverach kindly provided pGB70, and T. Allers kindly supplied pTA106, pTA131, and the strain H99 that made our gene deletion studies possible. K. Nelson and E. Mongodin kindly provided the S. ruber draft genome sequence. Lauren Crocco provided important technical assistance.

Support was provided to K.C.D. from an NIH Cell & Molecular Biology Training Grant (reference no. T32-GM07229) and by a predoctoral fellowship from the American Heart Association (reference no. 0415376U) and to M.P. by a Department of Energy grant (reference no. DE-FG02-01ER15169).

REFERENCES

  • 1.Alami, M., I. Luke, S. Deitermann, G. Eisner, H. G. Koch, J. Brunner, and M. Muller. 2003. Differential interactions between a twin-arginine signal peptide and its translocase in Escherichia coli. Mol. Cell 12:937-946. [DOI] [PubMed] [Google Scholar]
  • 2.Allers, T., H. P. Ngo, M. Mevarech, and R. G. Lloyd. 2004. Development of additional selectable markers for the halophilic archaeon Haloferax volcanii based on the leuB and trpA genes. Appl. Environ Microbiol. 70:943-953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Anton, J., A. Oren, S. Benlloch, F. Rodriguez-Valera, R. Amann, and R. Rossello-Mora. 2002. Salinibacter ruber gen. nov., sp. nov., a novel, extremely halophilic member of the Bacteria from saltern crystallizer ponds. Int. J. Syst. Evol. Microbiol. 52:485-491. [DOI] [PubMed] [Google Scholar]
  • 4.Baliga, N. S., R. Bonneau, M. T. Facciotti, M. Pan, G. Glusman, E. W. Deutsch, P. Shannon, Y. Chiu, R. S. Weng, R. R. Gan, P. Hung, S. V. Date, E. Marcotte, L. Hood, and W. V. Ng. 2004. Genome sequence of Haloarcula marismortui: a halophilic archaeon from the Dead Sea. Genome Res. 14:2221-2234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Berks, B. C. 1996. A common export pathway for proteins binding complex redox cofactors? Mol. Microbiol. 22:393-404. [DOI] [PubMed] [Google Scholar]
  • 6.Bitan-Banin, G., R. Ortenberg, and M. Mevarech. 2003. Development of a gene knockout system for the halophilic archaeon Haloferax volcanii by use of the pyrE gene. J. Bacteriol. 185:772-778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Blaudeck, N., P. Kreutzenbeck, M. Muller, G. A. Sprenger, and R. Freudl. 2005. Isolation and characterization of bifunctional Escherichia coli TatA mutant proteins that allow efficient tat-dependent protein translocation in the absence of TatB. J. Biol. Chem. 280:3426-3432. [DOI] [PubMed] [Google Scholar]
  • 8.Blyn, L. B., B. A. Braaten, and D. A. Low. 1990. Regulation of pap pilin phase variation by a mechanism involving differential dam methylation states. EMBO J. 9:4045-4054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bolhuis, A. 2002. Protein transport in the halophilic archaeon Halobacterium sp. NRC-1: a major role for the twin-arginine translocation pathway? Microbiology 148:3335-3346. [DOI] [PubMed] [Google Scholar]
  • 10.De Keersmaeker, S., L. Van Mellaert, K. Schaerlaekens, W. Van Dessel, K. Vrancken, E. Lammertyn, J. Anne, and N. Geukens. 2005. Structural organization of the twin-arginine translocation system in Streptomyces lividans. FEBS Lett. 579:797-802. [DOI] [PubMed] [Google Scholar]
  • 11.DeLisa, M. P., D. Tullman, and G. Georgiou. 2003. Folding quality control in the export of proteins by the bacterial twin-arginine translocation pathway. Proc. Natl. Acad. Sci. USA 100:6115-6120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dilks, K., R. W. Rose, E. Hartmann, and M. Pohlschroder. 2003. Prokaryotic utilization of the twin-arginine translocation pathway: a genomic survey. J.Bacteriol. 185:1478-1483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ding, Z., and P. J. Christie. 2003. Agrobacterium tumefaciens twin-arginine-dependent translocation is important for virulence, flagellation, and chemotaxis but not type IV secretion. J. Bacteriol. 185:760-771. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dyall-Smith, M. (ed.). 2004. The halohandbook: protocols for halobacterial genetics, version 4.9. http://www.microbiol.unimelb.edu.au/people/dyallsmith/HaloHandbook.
  • 15.Holmes, M., F. Pfeifer, and M. Dyall-Smith. 1994. Improved shuttle vectors for Haloferax volcanii including a dual-resistance plasmid. Gene 146:117-121. [DOI] [PubMed] [Google Scholar]
  • 16.Jongbloed, J. D., U. Grieger, H. Antelmann, M. Hecker, R. Nijland, S. Bron, and J. M. van Dijl. 2004. Two minimal Tat translocases in Bacillus. Mol. Microbiol. 54:1319-1325. [DOI] [PubMed] [Google Scholar]
  • 17.Ng, W. V., S. P. Kennedy, G. G. Mahairas, B. Berquist, M. Pan, H. D. Shukla, S. R. Lasky, N. S. Baliga, V. Thorsson, J. Sbrogna, S. Swartzell, D. Weir, J. Hall, T. A. Dahl, R. Welti, Y. A. Goo, B. Leithauser, K. Keller, R. Cruz, M. J. Danson, D. W. Hough, D. G. Maddocks, P. E. Jablonski, M. P. Krebs, C. M. Angevine, H. Dale, T. A. Isenbarger, R. F. Peck, M. Pohlschroder, J. L. Spudich, K. W. Jung, M. Alam, T. Freitas, S. Hou, C. J. Daniels, P. P. Dennis, A. D. Omer, H. Ebhardt, T. M. Lowe, P. Liang, M. Riley, L. Hood, and S. DasSarma. 2000. Genome sequence of Halobacterium species NRC-1. Proc. Natl. Acad. Sci. USA 97:12176-12181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10:1-6. [DOI] [PubMed] [Google Scholar]
  • 19.Ochsner, U. A., A. Snyder, A. I. Vasil, and M. L. Vasil. 2002. Effects of the twin-arginine translocase on secretion of virulence factors, stress response, and pathogenesis. Proc. Natl. Acad. Sci. USA 99:8312-8317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Pfeifer, F., J. Griffig, and D. Oesterhelt. 1993. The fdx gene encoding the [2Fe-2S] ferredoxin of Halobacterium salinarium (H. halobium). Mol. Gen. Genet. 239:66-71. [DOI] [PubMed] [Google Scholar]
  • 21.Pohlschroder, M., K. Dilks, N. J. Hand, and R. Wesley Rose. 2004. Translocation of proteins across archaeal cytoplasmic membranes. FEMS Microbiol. Rev. 28:3-24. [DOI] [PubMed] [Google Scholar]
  • 22.Pop, O. I., M. Westermann, R. Volkmer-Engert, D. Schulz, C. Lemke, S. Schreiber, R. Gerlach, R. Wetzker, and J. P. Muller. 2003. Sequence-specific binding of prePhoD to soluble TatAd indicates protein-mediated targeting of the Tat export in Bacillus subtilis. J. Biol. Chem. 278:38428-38436. [DOI] [PubMed] [Google Scholar]
  • 23.Pugsley, A. P., O. Francetic, A. J. Driessen, and V. de Lorenzo. 2004. Getting out: protein traffic in prokaryotes. Mol. Microbiol. 52:3-11. [DOI] [PubMed] [Google Scholar]
  • 24.Rose, R. W., T. Bruser, J. C. Kissinger, and M. Pohlschroder. 2002. Adaptation of protein secretion to extremely high-salt conditions by extensive use of the twin-arginine translocation pathway. Mol. Microbiol. 45:943-950. [DOI] [PubMed] [Google Scholar]
  • 25.Sargent, F., E. G. Bogsch, N. R. Stanley, M. Wexler, C. Robinson, B. C. Berks, and T. Palmer. 1998. Overlapping functions of components of a bacterial Sec-independent protein export pathway. EMBO J. 17:3640-3650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sargent, F., U. Gohlke, E. De Leeuw, N. R. Stanley, T. Palmer, H. R. Saibil, and B. C. Berks. 2001. Purified components of the Escherichia coli Tat protein transport system form a double-layered ring structure. Eur. J. Biochem. 268:3361-3367. [DOI] [PubMed] [Google Scholar]
  • 27.Sargent, F., N. R. Stanley, B. C. Berks, and T. Palmer. 1999. Sec-independent protein translocation in Escherichia coli. A distinct and pivotal role for the TatB protein. J. Biol. Chem. 274:36073-36082. [DOI] [PubMed] [Google Scholar]
  • 28.Sonnhammer, E. L., G. von Heijne, and A. Krogh. 1998. A hidden Markov model for predicting transmembrane helices in protein sequences. Proc. Int. Conf. Intell. Syst. Mol. Biol. 6:175-182. [PubMed] [Google Scholar]
  • 29.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Weiner, J. H., P. T. Bilous, G. M. Shaw, S. P. Lubitz, L. Frost, G. H. Thomas, J. A. Cole, and R. J. Turner. 1998. A novel and ubiquitous system for membrane targeting and secretion of cofactor-containing proteins. Cell 93:93-101. [DOI] [PubMed] [Google Scholar]
  • 31.Wu, L. F., B. Ize, A. Chanal, Y. Quentin, and G. Fichant. 2000. Bacterial twin-arginine signal peptide-dependent protein translocation pathway: evolution and mechanism. J. Mol. Microbiol. Biotechnol. 2:179-189. [PubMed] [Google Scholar]
  • 32.Yen, M. R., Y. H. Tseng, E. H. Nguyen, L. F. Wu, and M. H. Saier, Jr. 2002. Sequence and phylogenetic analyses of the twin-arginine targeting (Tat) protein export system. Arch. Microbiol. 177:441-450. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES