Identification of Erwinia amylovora Genes Induced during Infection of Immature Pear Tissue

Abstract

The enterobacterium Erwinia amylovora is a devastating plant pathogen causing necrotrophic fire blight disease of apple, pear, and other rosaceous plants. In this study, we used a modified in vivo expression technology system to identify E. amylovora genes that are activated during infection of immature pear tissue, a process that requires the major pathogenicity factors of this organism. We identified 394 unique pear fruit-induced (pfi) genes on the basis of sequence similarity to known genes and separated them into nine putative function groups including host-microbe interactions (3.8%), stress response (5.3%), regulation (11.9%), cell surface (8.9%), transport (13.5%), mobile elements (1.0%), metabolism (20.3%), nutrient acquisition and synthesis (15.5%), and unknown or hypothetical proteins (19.8%). Known virulence genes, including hrp/hrc components of the type III secretion system, the major effector gene dspE, type II secretion, levansucrase (lsc), and regulators of levansucrase and amylovoran biosynthesis, were upregulated during pear tissue infection. Known virulence factors previously identified in E. (Pectobacterium) carotovora and Pseudomonas syringae were identified for the first time in E. amylovora and included HecA hemagglutinin family adhesion, Peh polygalacturonase, new effector HopPtoC_EA, and membrane-bound lytic murein transglycosylase MltE_EA. An insertional mutation within hopPtoC_EA did not result in reduced virulence; however, an mltE_EA knockout mutant was reduced in virulence and growth in immature pears. This study suggests that E. amylovora utilizes a variety of strategies during plant infection and to overcome the stressful and poor nutritional environment of its plant hosts.

Erwinia amylovora is the causative agent of fire blight, a devastating necrotic disease affecting apple, pear, and other rosaceous plants. Entry of the bacterium into plants can occur via flower blossoms or actively growing young shoots or through wounds. Upon entry, the fire blight pathogen moves through intercellular spaces towards the xylem and also the cortical parenchyma (70). Symptoms often appear as water-soaked tissue that rapidly wilts and becomes necrotic, leading to the characteristic “shepherd's crook.” As a member of the Enterobacteriaceae, E. amylovora is related to many important human and animal pathogens such as Escherichia coli, Yersinia pestis, Yersinia enterocolitica, Salmonella enterica, and Shigella flexneri.

Like many other gram-negative plant-pathogenic bacteria, E. amylovora produces a type III Hrp secretion system (TTSS) apparatus that delivers effector proteins into host plants (40). The TTSS in E. amylovora controls the ability of E. amylovora to cause disease in susceptible host plants and to elicit the hypersensitive response in resistant and nonhost plants. Most hrp genes have been found to encode proteins involved in gene regulation or in assembly of the TTSS apparatus (3, 31, 40).

The TTSS of E. amylovora secretes several virulence proteins, including HrpA, HrpN, HrpW, and disease-specific protein DspA/E (hereafter referred to as DspE) (13, 14, 28, 40, 41, 74, 75). The HrpA protein is the major structural protein of a pilus called the Hrp pilus, which is the extracellular part of the TTSS (37). DspE, HrpN, and HrpW proteins are effector proteins of the TTSS and are believed to be injected directly into host cells (13, 14).

Additional E. amylovora virulence factors that contribute to pathogenesis and plant colonization include the exopolysaccharides amylovoran and levan, iron-scavenging siderophore desferrioxamine, metalloprotease PrtA, multidrug efflux pump AcrAB, and carbohydrate metabolism genes specifically involved in the utilization of sorbitol, sucrose, and galactose (1, 15, 17, 51, 80). Transcriptional regulators of the amylovoran and levan biosynthetic operons have also been identified (11, 19, 79) and are required for the expression of the biosynthetic machinery for the exopolysaccharides (10, 22, 39, 79). E. amylovora pathogenesis is also subject to global regulation by the small regulatory RNA rsmB, which functions by titrating and countering the activity of the repressor protein RsmA; this system is reported to positively regulate exopolysaccharide production, motility, and pathogenicity (46). In addition, E. amylovora strains contain a ubiquitous nonconjugative plasmid of 28 to 30 kb designated pEA29; laboratory-derived plasmid-cured strains exhibit a reduction in virulence (49). pEA29 encodes several potential virulence genes including a thiamine-biosynthetic operon that is proposed to influence amylovoran production (49).

Genetic analysis of virulence genes in E. amylovora has been performed mostly through the production and screening of mutants. Additionally, most of the genes discovered so far have been identified from mutant screening under controlled conditions. However, it is not feasible to mimic all of the nutrient and defense conditions in vitro to characterize all the genes from E. amylovora required for infection and colonization of plants. There is a need, then, for a high-throughput method of screening for genes that are involved in virulence and growth in planta of E. amylovora.

In the last decade, many gene expression technologies including in vivo expression technology (IVET) have been developed to identify gene expression profiles of organisms during interactions with various host environments (5, 33, 47). IVET screening theoretically scans the entire genome and, through the use of appropriate environmental conditions and different strategies, can yield large numbers of potentially important genes (59). IVET screens have identified genes upregulated upon infection with enteric human and animal pathogens such as Salmonella enterica, Shigella flexneri, and Y. enterocolitica (7, 47, 55, 78). IVET systems have also been used to identify genes expressed during plant infection by Xanthomonas campestris, Erwinia chrysanthemi, Pseudomonas syringae, and Ralstonia solanacearum (12, 16, 30, 56, 57, 77); phyllosphere colonization by P. syringae (48); rhizosphere colonization by Pseudomonas putida (60); and saprophytic colonization by Pseudomonas fluorescens (58, 67).

Like many plant-pathogenic bacteria, E. amylovora can infect different host tissues at different stages of disease development. E. amylovora infects not only blossoms, leaves, and succulent shoots but also immature fruits of susceptible hosts. The bacterium also grows epiphytically on stigmas and endophytically inside plant tissue. The maintenance of large numbers of apple trees for study of E. amylovora pathogenesis is quite difficult due to the extensive greenhouse and growth chamber space required. As an alternative, many researchers have utilized immature pear fruits to study E. amylovora infection (10, 14, 29). Immature pear infection is initiated through a wound inoculation; wound colonization is a frequently utilized mechanism of E. amylovora infection in nature (70). Immature pear assays, using either intact pear fruits or pear slices, have been used successfully to analyze virulence effects of several E. amylovora genes (14, 29, 40).

Although key virulence factors contributing to fire blight have been identified, little knowledge is available on the global host-regulated genes of E. amylovora during infection. To gain a better understanding of the molecular mechanism governing E. amylovora-host plant interactions, we undertook a comprehensive genome-wide examination of gene expression patterns during host infection to uncover pathogenesis strategies of the organism. This IVET screen will also lay the groundwork for future studies examining the expression and function of critical virulence genes during infection of different host tissues and survival within the host. Several known virulence and pathogenesis factors were identified using this modified IVET screen, along with new potential virulence genes that were previously described only in other bacterial pathosystems. We also confirmed that infection of immature pear tissue by E. amylovora required the major pathogenicity factors of the bacterium.

MATERIALS AND METHODS

Bacterial strains and plasmids.

The bacterial strains and plasmids utilized in this study are listed in Table 1. Erwinia amylovora wild type (WT) and mutant strains and E. coli strains were grown in Luria-Bertani (LB) medium at 28°C and 37°C, respectively. Antibiotics were added to the culture medium at the indicated concentrations: rifampin, 100 μg/ml; kanamycin (Km), 30 μg/ml; gentamicin, 10 μg/ml; and ampicillin (Ap), 100 μg/ml. Oligonucleotide primers used for PCR and sequencing in this study are also listed in Table 1.

TABLE 1.

Bacterial strains, plasmids, and primers used in this study

Strain, plasmid, or primer	Relevant characteristic(s) or sequence(s) (5′-3′)a	Reference or source
Strains
Erwinia amylovora
Ea110	Wild type, isolated from apple	49
Ea110−	Ea110, cured of pEA29	49
Ea1189	Wild type, isolated from apple	17
CFBP1430	Wild type, isolated from Crataegus	28
M52 (Ea dspA)	CFBP1430, dspA::uidA-Km, Kmr	28
Ea110 hrpA	Ea110 ΔhrpA Kmr	37
ZYC1-3 (Ea hopPtoCEA)	hopPtoC::Km; partial deletion and Kmr insertional mutant of hopPtoCEA of Ea1189; Kmr	This study
ZYE3-11 (Ea mltEEA)	mltE::Km; partial deletion and Kmr insertional mutant of mltEEA of Ea1189; Kmr	This study
E. coli
DH10B	F−mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 endA1 araΔ139 Δ(ara leu)7697 galU galK λ−rpsL (Strr) nupG	Invitrogen
S17-1	recA pro hsdR RP4-2-Tc::Mu-Km::Tn7	76
S17-1 λ pir	λ−pir lysogen of S17-1	76
Plasmids
pBluescript II SK(+)	Apr; cloning vector	Stratagene
pGem3zf+	Apr; cloning vector	Promega
pCAM140	Smr Spr Apr; R6K origin; mTn5SSgusA40	76
pCAM140-MCSb	Apr; R6K origin; pCAM140 derivative without mini-Tn5; contains the multiple cloning site of pBluescript II SK(+)	17
pX1918GT	xylE-Gmr fusion cassette-containing plasmid flanked by inverted repeats of the pUC19 MCS	66
pBSL15	Km cassette flanked by inverted repeats of the pUC18 MCS	2
pGCM0	Gmr cassette with downstream transcriptional terminator and gusA with upstream translational stop codons in pGem3zf+	This study
pZYF2	570-bp dspE promoter in opposite orientation relative to uidA in pGCM0	This study
pZYF8	570-bp dspE promoter in correct orientation relative to uidA in pGCM0	This study
Primers
Aj1388	CCCAAGCTTGGTGCGCCAGGAGAGTTGTTG (HindIII)
Aj1389	AAAACTGCAGTGATTGATTGACGGACCAGTATTATTATC (PstI)
Aj1390	CCGGAATTCCGAATTGACATAAGCCTGTTCGG (EcoRI)
Aj1391	CGGGGTACCTGGACGCGGCCGATCACCTGGCCGTTG (KpnI)
Aj1585	GATAATAATACTGGTCCGTCAATC
Aj1565	CGGTTTACAAGCATAAAGCTGGGCAACGGCC
DspE1	TCCCCCGGGCAGTGAGGGGGGGCAGACTTTTTTTTAACC (SmaI)
DspE2	TCCCCCGGGTATCTTCGCCGCTGCCACCTTTCACCATTG (SmaI)
PtoC1	TCCCCGCGGGCGGGCTGTTGGTCTTGCTCT (SacII)
PtoC2	TGCTCTAGACTCTGGCAAAATTCAACTGA (XbaI)
PtoC3	CCGGAATTCCATGGCAGGGACCCGCAGTTTG (EcoRI)
PtoC4	CCGCTCGAGGGCTGATGGCGGGTTAGTCTGTCG (XhoI)
MltE1	TCCCCGCGGTGAATAGTGCGTGGCGTGATGTGC (SacII)
MltE2	TGCTCTAGATTAATCATTGCAATCGCCTCGTC (XbaI)
MltE3	CCGGAATTCTTACCAGCACGTGCAGACAAAACA (EcoRI)
MltE4	CCGCTCGAGCCGGATGGATCTGGTGAGGGGCGC (XhoI)
AD1	NTCGASTWTSGWGTT
AD2	NGTCGASWGANAWGAA
AD3	WGTGNAGWANCANAGA

^aKm^r, Ap^r, Gm^r, Sp^r, and Sm^r, kanamycin, ampicillin, gentamicin, spectinomycin, and streptomycin resistance, respectively. Underlined nucleotides are restriction sites added, and the restriction enzymes are indicated at the ends of primers. Mixed nucleotides: S, C + G; W, A + T; N, A + T + C + G.

^bMCS, multiple cloning site.

DNA manipulation and sequence analysis.

Plasmid DNA purification, PCR amplification of genes, isolation of fragments from agarose gels, restriction enzyme digestion, T4 DNA ligation, and Southern hybridization were performed using standard molecular procedures (63). Chromosomal DNA was isolated using a genomic DNA purification kit (QIAGEN, Valencia, CA). Thermal asymmetric interlaced PCR (TAIL-PCR) was performed using the degenerate primers AD1, AD2, and AD3 as described previously (44), and PCR products from secondary and tertiary nested PCR were used for sequencing. DNA sequencing was performed at the Genomic Technology Support Facility at Michigan State University. The oligonucleotide primer Aj1585, corresponding to the 5′ end of the uidA gene, was used for sequencing fragment inserts cloned into the pGCM0 plasmid. Sequence management and contig assembly were conducted using DNAStar software (DNAStar Inc., Madison, WI). Database searches were conducted using the BLAST programs at NCBI (www.ncbi.nlm.nih.gov/BLAST). Percent similarity was also calculated using the BLAST program (4). Amino acid alignments were done with ClustalW, v. 1.83 (European Bioinformatics Institute, Cambridge, United Kingdom).

Immature pear infection assays.

Immature pears are routinely used to examine the pathogenicity of naturally occurring isolates or bacterial mutants of E. amylovora (14). In order to confirm that infection of immature pear required major pathogenicity factors as previously reported (14), we inoculated wounded immature pear fruits with E. amylovora M52 (CFBP1430 dspE) and Ea110 hrpA mutants and monitored them for symptom development and in planta bacterial growth. Bacterial suspensions of all strains were grown overnight in LB broth, harvested by centrifugation, and resuspended in 0.5× sterile phosphate-buffered saline (PBS) with the cells adjusted to approximately 1 × 10⁴ CFU/μl (optical density at 600 nm of 0.1 and then dilution 100 times) in PBS. Immature pears (Pyrus communis L. cv. ‘Bartlett’) were surface sterilized with 10% bleach and pricked with a sterile needle as described previously (49). Wounded pears were inoculated with 2 μl of cell suspensions and incubated in a humidified chamber at 28°C. Symptoms were recorded at 2, 4, 6, and 8 days postinoculation. For bacterial population studies, the pear tissue surrounding the inoculation site was excised by using a no. 4 cork borer as described previously (14) and homogenized in 0.5 ml of 0.5× PBS. Bacterial growth within the pear tissue was monitored by dilution plating of the ground material on LB medium amended with the appropriate antibiotics. For each strain tested, fruits were assayed in triplicate, and each experiment was repeated two to three times.

Construction of the genomic library of transcriptional fusions to uidA.

We used E. amylovora Ea110⁻ (cured of the ubiquitous plasmid pEA29) as the source of chromosomal DNA for the IVET experiments. We excluded pEA29 genes from this study because an analysis of the expression of pEA29-carried genes during infection will be presented in a separate report (G. McGhee and G. Sundin, unpublished). To create a library of transcriptional fusions, chromosomal DNA from E. amylovora Ea110⁻ was partially digested with HaeIII, and fragments between 800 bp and 2 kb in length were separated by electrophoresis and gel purified. The purified fragments were ligated into pGCM0 prepared by SmaI digestion and transformed into WT E. amylovora Ea110 (containing pEA29) by electroporation. The use of WT strain Ea110 was necessary because the ubiquitous pEA29 plasmid contributes to E. amylovora virulence (49).

The 6.2-kb pGCM0 reporter vector was constructed by cloning the aacC1 gene (conferring resistance to gentamicin) into the EcoRI and KpnI sites and the promoterless uidA (β-glucuronidase [GUS]) reporter gene into PstI and HindIII sites of pGem3zf through multiple cloning steps (Fig. 1A). The aacC1 gene was amplified from plasmid pX1918GT by PCR using the primer pair Aj1390 and Aj1391, whereas the promoterless uidA gene was amplified from plasmid pCAM140 using the primer pair Aj1388 and Aj1389. A transcriptional terminator sequence, also from pX1918G, was located immediately downstream of the aacC1 gene, and we added translational termination codons in all three reading frames upstream of the uidA gene. The pGCM0 vector was first digested with SmaI, and the ends were dephosphorylated with calf intestinal alkaline phosphatase and checked for self-ligation before ligation with E. amylovora chromosomal DNA fragments. After ligation, DNA was introduced into Ea110 by electroporation, transformants growing on LB medium amended with gentamicin and ampicillin were randomly collected, and plasmids were recovered. The randomness of the inserts in the IVET collection was confirmed by checking insert size from 30 random colonies through restriction digestion and PCR (data not shown).

FIG. 1.

Overview of the IVET screen for E. amylovora genes induced during infection of immature pear disks. (A) Schematic map of the IVET vector pGCM0. The 6.2-kb pGCM0 vector was constructed by cloning the aacC1 gene (conferring resistance to gentamicin) into the EcoRI and KpnI sites and the promoterless uidA (β-glucuronidase) reporter gene into PstI and HindIII sites of pGem3zf through multiple cloning steps. The Φ symbol represents translational terminator codons in all three reading frames upstream of the uidA gene, and the symbol Ω represents a transcriptional terminator sequence immediately downstream of the aacC1 gene. The SmaI site was used for ligation of random chromosomal inserts. (B) A library (19,200 clones) of SmaI chromosomal DNA fragments (0.8 to 2 kb) from E.amylovora was constructed in pGCM0, transformed into E. amylovora Ea110, and screened individually for GUS activity on LB medium amended with X-Gluc. A 96-well microplate containing slices of pear tissue was inoculated with Ea100 containing random IVET fusion clones and incubated for 48 h at 25°C. Clones exhibiting GUS activity on pear disks but not on LB-X-Gluc medium were selected, and the plasmids were recovered for further analysis. Steps 3 to 5 were repeated.

As a control, we cloned a 570-bp fragment containing the dspE promoter into pGCM0. The fragment was amplified by PCR from strain Ea110 using the primer pair DspE1 and DspE2. The resulting 570-bp product was cleaved with SmaI and ligated into pGCM0 in both orientations. The resulting plasmids were designated pZYF2 (dspE^rev::pGCM0, dspE promoter in orientation opposite uidA) and pZYF8 (dspE^for::pGCM0, dspE promoter in correct orientation to uidA), respectively, and each plasmid was introduced into strain Ea110 by electroporation.

Screening of the E. amylovora IVET library using a GUS-based microtiter plate assay.

An in vivo microtiter plate assay was developed for screening of the E. amylovora IVET library (Fig. 1B). Briefly, approximately 19,200 transformants in strain Ea110 were randomly collected and initially screened for GUS activity on LB plates containing 5-bromo-4-chloro-3-indolyl-β-d-glucuronide (X-Gluc). After incubation at 25°C for 48 h, bacteria were transferred individually using a 48-pin colony transfer apparatus and inoculated onto immature pear disks (3 mm) in 96-well microtiter plates. Intact pears were surface sterilized using 10% bleach for 10 min and rinsed three times with sterile water. Disks were cut from pears using a no. 2 cork borer and immediately immersed into microtiter plate wells containing 25 μl 0.5× PBS buffer to avoid oxidation. The microtiter plates were then covered with AirPore tape (QIAGEN, Valencia, CA) after inoculation and incubated in a humidity chamber at 25°C for 48 h. After incubation, a qualitative GUS assay was performed as described below. Transformants showing GUS activity on pear tissue but not on LB plates were selected and rescreened on LB plates containing X-Gluc and reinoculated onto pear disks in 96-well microtiter plates. Confirmed differentially expressing transformants were again selected and stored at −70°C in glycerol stocks for further analysis. Plasmids were isolated from the consistent differentially expressed transformants and were end sequenced to identify the genes or promoter regions. Transformants showing GUS activities on both LB plates and pear tissues were assumed to contain constitutively expressed fusions and were not analyzed further in this study.

Construction of hopPtoC_EA and mltE_EA mutants.

For the construction of hopPtoC_EA and mltE_EA mutants, the sequences of the putative open reading frames defined by the corresponding clones were determined and used to design primers to amplify fragments of the gene and its upstream and downstream sequences. Primer pairs PtoC1-PtoC2 and PtoC3-PtoC4 were used to amplify 590-bp and 670-bp fragments from E. amylovora strain Ea1189 corresponding to the upstream and downstream sequences of the hopPtoC_EA gene, respectively. Primer pairs MltE1-MltE2 and MltE3-MltE4 were used to amplify 700-bp and 560-bp fragments from E. amylovora strain Ea1189 corresponding to the upstream and downstream sequences of the mltE_EA gene, respectively. The two fragments for each open reading frame were cloned into pBluescript-II SK(+) through multiple cloning steps with corresponding restriction enzyme digestion (SacII-XbaI and EcoRI-XhoI, respectively). The whole fragment was excised using SacII and XhoI, gel purified, and cloned into the suicide vector pCAM-MCS (17) digested with the same enzymes. The resulting plasmids were digested with SmaI and ligated with a 1.2-kb fragment of the aph gene (conferring kanamycin resistance) released from plasmid pBSL15. The final plasmids were designated pZYC8 and pZYE8, respectively, and introduced into E. amylovora strain Ea1189 by electroporation. Transconjugants resistant to Km were selected. To further exclude mutants resulting from single-crossover events, transformants were selected on LB plates supplemented with Km and selected onto LB plates with Ap. Km-resistant and Ap-sensitive colonies were selected, and their genotypes were confirmed by hybridization or PCR analysis.

GUS assays.

The GUS reporter gene (uidA) on pGCM0 was used to monitor promoter activity of IVET clones both in vitro and in vivo. Qualitative GUS activity of IVET clones was monitored visually by the development of a blue color within 48 h of cells on LB medium containing 1 mM X-Gluc. Qualitative GUS activity of IVET clones grown on pear slices in microtiter plates after 48 h at 25°C was also monitored visually by adding 10 μl of 20 mM X-Gluc into the wells followed by incubation for 30 min at 37°C. The development of a blue color indicated GUS activity.

To monitor the expression of IVET clones in pear tissue, quantitative GUS activity of bacteria in either culture or pear tissue was determined as described previously (14, 36) using 4-methylumbelliferyl-β-d-glucuronide as a substrate and 0.2 M Na₂CO₃ as stop buffer. Briefly, E. amylovora strains containing the IVET clones were grown on LB medium, resuspended in 0.5× PBS, and inoculated in immature pear fruits as described above. At 0, 24, and 48 h postinoculation, the pear tissue surrounding the inoculation site was excised using a no. 4 cork borer and homogenized in 0.5 ml 0.5× PBS. Forty microliters of homogenate was mixed with 160 μl of GUS extraction buffer. Reactions were stopped by Na₂CO₃ addition, and fluorescence was measured using a SAFIRE fluorometer (TECAN Boston, Medford, MA). Bacterial cell numbers in the sample were estimated by dilution plating, and GUS activity (μmol of 4-methylumbelliferone produced per min) was normalized per 10⁹ CFU (14). Three replicate fruits for each strain were tested, and the experiment was repeated.

Nucleotide sequence accession numbers.

Nucleotide sequence data reported for the hopPtoC_EA and mltE_EA genes were deposited in the GenBank database under the accession no. AY887538 and AY887539.

RESULTS

Development of an IVET system and identification of E.amylovora upregulated genes during immature pear infection.

Our immature pear infection results clearly demonstrated that infection of immature pear by E. amylovora required major pathogenicity factors (Fig. 2). At 48 h after inoculation, E.amylovora strains CFBP1430 and Ea110 produced water-soaking symptoms in pears with visible bacterial ooze (data not shown). Two different strains were used in this initial experiment because of the availability of mutants of these strains. This work also confirmed that growth and symptom development of WT strains CFBP1430 and Ea110 were similar during immature pear inoculation (Fig. 2). Four days after inoculation, inoculated immature pears showed necrotic lesions and bacterial ooze formation (Fig. 2A). After 8 days, the entire pears showed necrosis, turning black with copious ooze production at the inoculation site (Fig. 2A). In contrast, disease symptoms were not observed on immature pears inoculated with either the E. amylovora hrpA or dspE mutant (Fig. 2A). Disease symptoms caused by WT strains on immature pear were correlated with high levels of bacterial growth in pear tissue during the 4 days postinoculation (Fig. 2B); however, the CFBP1430 dspE mutant M52 grew only slightly in pears, representing an approximately 10⁵-fold reduction relative to the WT CFBP1430 strain. Populations of the hrpA mutant declined quickly after inoculation, indicating that the hrpA mutant was not able to survive in immature pear (Fig. 2B).

FIG. 2.

Symptoms and growth of Erwinia amylovora WT strains and hrpA and dspE mutants in immature pear. (A) Symptoms caused by Erwinia amylovora Ea110, CFBP1430, and corresponding hrpA and dspE mutants in immature pear. DPI, days postinoculation. (B) Growth of Erwinia amylovora WT EA110, CFBP1430, and hrpA and dspE mutants during infection of immature pears. The growth of bacterial strains was monitored at 0, 1, 2, 3, and 4 days after inoculation. Data points represent the means of three replicates ± standard errors. Similar results were obtained in a second independent experiment.

Verification that infection of immature pear required major pathogenicity factors of E. amylovora facilitated the development of a simple, high-throughput IVET system to identify E.amylovora genes induced during colonization and infection. We used cores of immature pear tissue in a microtiter plate format, a system that was conducive to handling large numbers of samples.

To develop an immature pear fruit assay, we used the β-glucuronidase gene uidA as a reporter (36) in the vector pGCM0, which was constructed as described in Materials and Methods (Fig. 1A). The vector was verified with a control construct containing the dspE promoter in both orientations (Table 1). The dspE promoter was previously reported to be strongly induced during immature pear infection (14). GUS activity was not observed after 2 days of growth in LB medium for either Ea110(pZYF8) (dspE promoter in correct orientation to uidA) or Ea110(pZYF2) (dspE promoter in opposite orientation to uidA). However, GUS activity was observed for strain Ea110(pZYF8) in qualitative assays 2 days following inoculation onto immature pear disks but not following inoculation of strain Ea110(pZYF2) (data not shown). GUS activity was not observed for the WT Ea110 strain containing the empty pGCM0 vector either on LB medium or in pear disks.

To identify E. amylovora genes expressed during colonization and infection of pear disks, we constructed a library of 0.8- to 2-kb fragments of genomic DNA of Ea110⁻ (cured of pEA29) in pGCM0 and introduced the library into WT Ea110 by electroporation. In order to screen for differentially expressed promoter fusions, we developed an in planta pear disk microtiter plate assay (Fig. 1B). Strain Ea110⁻ containing library clones was first grown on LB-X-Gluc medium for 2 days, visually monitored for GUS activity, and then inoculated onto pear disks in microtiter plates (Fig. 1B). GUS activity was qualitatively detected after 2 days of incubation at 25°C. Only clones that showed high GUS activity in pear disks but no GUS activity on LB plates were recognized as pear-upregulated clones. Those differentially expressed clones were again screened on LB-X-Gluc plates and pear disks to confirm the results, and the DNA inserts from confirmed clones were subjected to further analysis. A total of 19,200 transcriptional fusion clones were screened on both LB-X-Gluc medium and pear disks, and 498 clones (2.5%) were repeatedly found to differentially express GUS activity on pear disks in this qualitative assay.

Sequence analysis of E. amylovora genes upregulated in immature pear tissue.

We determined the sequence of the inserts from the 498 clones and identified the putative genes induced following BLAST searches of the nonredundant GenBank database. Of the 498 inserts sequenced, a total of 55 genes were identified two or more times and 12 clones contained either an intragenic sequence or a sequence with the putative gene present in the incorrect orientation. Although it is possible that these 12 clones may contain cryptic promoter sequences, as has been shown in a previous study with P. fluorescens (67), we separated the clones from the others in the current study and did not subject them to further analysis. Thus, a total of 394 unique putative pear-inducible genes were identified, and these pear fruit-induced (pfi) genes could be divided into nine putative functional groups, including host-microbe interactions (3.8%), stress response (5.3%), regulation (11.9%), cell surface (8.9%), transport (13.5%), mobile elements-phage (1.0%), metabolism (20.3%), nutrient acquisition and synthesis (15.5%), and unknown or hypothetical proteins (19.8%).

The majority of the putative gene products identified as inducible during infection of pear tissue shared high amino acid similarity with proteins from Yersinia spp., Salmonella spp., E. coli, Shigella spp., and Erwinia spp. (Table 2). Genes for several known virulence factors previously reported in E.amylovora such as the TTSS genes hrpGF, hrpL, and hrpX and genes encoding known or new effector proteins DspE and HopPtoC_EA were upregulated during pear infection (Table 2). Other known E. amylovora virulence genes identified as upregulated in this study were genes for levansucrase (lsc), regulator of levansucrase (rlsA), amylovoran regulator (rcsA), and zinc-binding metalloprotease (prtA) (Table 2). In addition, genes encoding polygalacturonase (peh), hemagglutinin family adhesion (hecA), and membrane-bound lytic murein transglycosylase (mltE) were identified for the first time in E. amylovora Ea110 (Table 2). Peh and HecA are important virulence factors in E. chrysanthemi (62), and MltE plays a role in the virulence of P. syringae (12). A total of 56 upregulated genes identified were homologs of genes identified in IVET studies performed with other bacterial plant or animal pathogens (Table 2).

TABLE 2.

Selected list of Erwinia amylovora genes induced during infection of immature pear tissue^a

Function	pfi no.	Geneb	Organism	Blastx_BestHitc	GenBank accession no.	Previously reportedd
TTSS and effectors	1	dspE*	Erwinia amylovora	DspE/pathogenicity factor	AAC04850	Ech, 77
	2	hrpGF	E. amylovora	Type III secretion HrpG/F	AAB49178	Pst, 12
	3	hrpL*	E. amylovora	Type III sensor kinase HrpL	AAD24682
	4	hrpX*	E. amylovora	Type III secretion HrpX	AAD24681
	5	hopPtoC	Pseudomonas syringae pv. tomato	Type III effector HopPtoC	NP_790436	Pst, 12
GSP	6	secA*	Salmonella enterica serovar Typhimurium	Preprotein translocase SecA	NP_459141
	7	secDF*	Yersinia pestis	Protein export membrane protein SecDF	NP_406663	Apl, 47
	8	secB*	Escherichia coli	Protein export protein SecB	NP_756294	Ppu, 60
T2SS and proteins secreted by T2SS	9	yts11J	Yersinia enterocolitica	Type II secretion Yts1IJ protein	CAC83035	Rso, Ech; 16, 77
	10	lsc*	E. amylovora	Levansucrase	CAA52972
	11	peh	Pectobacterium carotovorum	Peh (polygalacturonase)	BAA74431	Pst, 12
Proteins known to be secreted by other secretion systems	12	fhaB*	Escherichia coli	Putative adhesin/hemagglutinin/hemolysin	AAQ19127	Rso, 16
	13	hecA	Erwinia chrysanthemi	Hemolysin/hemagglutinin-like protein HecA	AAN38708	Rso, 16
	14	mltE	Yersinia pestis	Membrane-bound lytic murein transglycosylase	NP_405972	Pst, 12
	15	prtA*	Erwinia amylovora	Zinc-binding metalloprotease	CAB42873
General, ion, sugar, amino acid, and nucleotide transport	16	abc	Yersinia pestis	ABC transporter ATP-binding protein (inorganic ion transport)	NP_404687	Ech, 77
	17	pstA	Yersinia pestis	Putative phosphate transport system permease	NP_406342
	18	ppx	Pantoea agglomerans	Exopolyphosphatase	AAQ14878	Sty, 55
	19	ftn	Yersinia pestis	Cytoplasmic ferritin (an iron storage protein)	NP_669829
	20	kefB	Salmonella enterica serovar Typhimurium	K+/H+ antiporter	NP_462361	Rso, 16
	21	c3774*	Escherichia coli	Ferric enterobactin transport ATP-binding protein	NP_755645
	22	btuB	Serratia marcescens	Outer membrane receptor for iron transport	AAL50647
	23	Gmet1925	Geobacter metallireducens	ABC-type nitrate/sulfonate/bicarbonate transport system	ZP_00081179
	24	exbB	Salmonella enterica	Biopolymer transport ExbB protein	NP_457552
	25	kgtP*	Salmonella enterica serovar Typhimurium	Alpha-ketoglutarate permease	NP_461589	Rso, 16
	26	ECs2608	Escherichia coli	ATP-binding component of high-affinity l-arabinose transport system	NP_310635
	27	citA	Pseudomonas aeruginosa	Citrate transporter	NP_254163
	28	rbsD	Yersinia pestis	High-affinity d-ribose permease	NP_403673
	29	gntU	Salmonella enterica serovar Typhimurium	Low-affinity gluconate permease	NP_462442
	30	mglA*	Salmonella enterica serovar Typhimurium	Methylgalactoside transport protein	NP_461134
	31	emrB	Escherichia coli	Multidrug resistance protein B	NP_755121	Rso/Eco; 16, 68
	32	mdl	Klebsiella pneumoniae	Multidrug resistance-like ATP-binding protein	CAA07091
	33	putP*	Salmonella sp.	Proline permease	AAA99282
	34	Avin4550*	Azotobacter vinelandii	Permeases of the major facilitator superfamily	ZP_00092807	Pfl, 67
	35	rbsB	Streptococcus agalactiae	Ribose ABC transporter, periplasmic d-ribose-binding protein	NP_687150
	36	livK	Yersinia pestis	High-affinity leucine-specific-binding periplasmic protein; branched-chain amino acid ABC transport system	NP_667760
	37	ECs3191	Escherichia coli	Histidine transport system membrane protein M	NP_311218
	38	lysP	Shigella flexneri	Lysine-specific permease	NP_708053
	39	YPO3257*	Yersinia pestis	Amino acid ABC transporter, periplasmic protein	NP_406727	Rso, 16
	40	metC*	E. coli	Beta-cystathionase	AAA69175
	41	lysC	Yersinia pestis	Lysine-sensitive aspartokinase III	NP_407170
	42	avtA*	Escherichia coli	Valine-pyruvate aminotransferase	NP_756255
	43	oppA	Yersinia pestis	Oligopeptide ABC transporter; periplasmic binding protein	NP_669341
	44	oppC	Yersinia pestis	Oligopeptide transport system permease protein	NP_405727
	45	tsx	Salmonella	Nucleoside-specific channel-forming protein	NP_455008
	46	hemH	Yersinia enterocolitica	Ferrochelatase	AAC60760
	47	uup	Salmonella enterica serovar Typhimurium	Putative ABC transporter ATPase component	NP_460036	Rso, 16
	48	sbmA	Salmonella enterica serovar Typhimurium	Putative ABC transporter membrane protein	NP_459371	Rso, 16
	49	y0619*	Yersinia pestis	Putative periplasmic binding transport protein	AAM84207
	50	hemT	Yersinia enterocolitica	Hemin binding protein (periplasm binding protein-hemin transport)	CAA54866
	51	yadH*	Salmonella enterica serovar Typhimurium	Putative transport protein	NP_459178
Bacterial cell surface and transmembrane	52	nlpA*	Escherichia coli	Lipoprotein 28	NP_418117	Rso, 16
	53	dacB	Yersinia pestis	d-Alanyl-d-alanine carboxypeptidase/penicillin-binding protein 4	NP_668015	Rso, 16
	54	kpsC	Escherichia coli	Capsule polysaccharide export protein	P42217	Eco, 68
	55	dinF	Salmonella enterica	DNA damage-inducible membrane protein	NP_458536	Rso, 16
	56	corB*	Salmonella enterica	Putative membrane protein	NP_457149	Ech, 77
	57	ytfK*	Salmonella enterica serovar Typhimurium	Putative cytoplasmic protein	NP_463267	Ech, 77
	58	YPO2305	Yersinia pestis	Putative exported protein	NP_405842
	59	tolA	Salmonella enterica serovar Typhimurium	Tol import system inner membrane protein	NP_459732
	60	tolR	Erwinia chrysanthemi	TolR protein inner membrane protein interacting with TolA and TolQ	CAC82707
	61	matE*	Salmonella enterica	Putative inner membrane protein	NP_456567	Rso, 16
	62	STM0278*	Salmonella enterica serovar Typhimurium	Putative periplasmic protein	NP_459276	Rso, 16
	63	ydiY	Salmonella enterica serovar Typhimurium	Putative outer membrane protein (salt inducible)	NP_460293
	64	ompC	Escherichia coli	Outer membrane protein C (porin OmpC)	Q54471
	65	ompA*	Salmonella enterica	Putative outer membrane protein (OmpA)	NP_458280
	66	Z1931*	Escherichia coli	Outer membrane protein 3b (a), protease VII	NP_287408
	67	ptrA*	Yersinia pestis	Protease III precursor	NP_404633
	68	mrdB	Escherichia coli	Rod shape-determining protein RodA	NP_752655
	69	flgN	Shigella flexneri	Flagellum synthesis protein FlgN	NP_836779
	70	fliG	Shigella flexneri	Flagellar motor switch protein FliG	NP_707824
	71	fliM	Escherichia coli	Flagellar motor switch protein FliM	NP_754254
	72	ycgB	Escherichia coli	Putative sporulation protein	NP_287427
Mobile elements-phage	73	STY4666*	Salmonella enterica	Probable phage integrase	NP_458745
	74	intD	Escherichia coli	Prophage DLP12 integrase	NP_415069
Stress response	75	mutS	Yersinia pestis	DNA mismatch repair protein MutS	NP_406817	Sen, 33
	76	recA	Yersinia pestis	RecA protein	NP_406773	Sau, 47
	77	sulA	Enterobacter aerogenes	Cell division inhibitor, SOS regulon gene	C29016
	78	dps	Serratia marcescens	DNA protection during starvation protein (Dsp)	AAO47741
	79	cstA	Salmonella enterica	Carbon starvation protein	NP_458955
	80	ycbP*	Escherichia coli	Sulfate starvation-induced protein 4/FMNe reductase	NP_753005
	81	ahpC*	Photorhabdus luminescens	Alkyl hydroperoxide reductase, small subunit (antioxidant)	NP_931108
	82	cyoB*	Escherichia coli	Cytochrome o ubiquinol oxidase subunit I	NP_286173
	83	ydiJ	Salmonella enterica serovar Typhimurium	Putative oxidase	NP_460330
	84	bacA	Salmonella enterica serovar Typhimurium	Bacitracin resistance protein	NP_462120	Ech, 77
	85	pqiB	Yersinia pestis	Paraquat-inducible protein B	NP_670048
	86	grpE	Photorhabdus luminescens	GrpE protein (HSP-70 cofactor) (heat shock protein B25.3)	NP_930590	Rso, 16
	87	y1165	Yersinia pestis	Putative cold shock protein	NP_668491
	88	pspB*	Yersinia enterocolitica	Phage shock protein B	AAG22114
	89	pspC	Yersinia enterocolitica	Phage shock protein C	AAG22115
	90	tsr*	Salmonella enterica serovar Typhimurium	Methyl-accepting chemotaxis protein I	NP_463392	Ech, 77
Regulation	91	rlsA	Erwinia amylovora	RlsA protein/LysR homolog	CAA10420
	92	rcsA*	Erwinia amylovora	Colanic acid capsular biosynthesis activation protein A	A45828
	93	grrS*	Serratia plymuthica	Putative global response regulation sensor kinase	AAL11449
	94	envZ*	Yersinia pestis	Histidine kinase/EnvZ/osmolarity sensor protein	NP_403793	Sty, 33
	95	fliZ	Yersinia pestis	Putative alternative sigma factor regulatory protein	NP_405408
	96	gntR	Salmonella enterica	Gluconate utilization operon repressor	NP_458376
	97	deoR	Salmonella enterica	DeoR/deoxyribose operon repressor	NP_455391
	98	metJ	Photorhabdus luminescens	Met repressor (Met regulon regulatory protein MetJ)/repressor of the methionine regulon	NP_931917
	99	hlfK	Shigella flexneri	Protease specific for phage lambda cII repressor	NP_710039
	100	yqhC*	Escherichia coli	Putative AraC-type regulatory protein	NP_289587
	101	ybiQ	Shigella flexneri	Transcriptional regulator MntR	NP_706694
	102	budR	Raoultella terrigena	HTH-type transcriptional regulator	P52666
	103	c5058*	Escherichia coli	Putative transcriptional regulator LysR	NP_756910	Ech, 77
	104	PSPTO3576	Pseudomonas syringae pv. tomato	TetR family transcriptional regulator	NP_793355
	105	YPO3913*	Yersinia pestis	TetR family transcriptional regulatory protein	NP_407358
	106	YPO0736	Yersinia pestis	Putative regulatory protein	NP_404367
	107	YPO0315*	Yersinia pestis	Regulatory protein (multiple antibiotic resistance)	NP_403966
	108	fnr	Escherichia coli	Fumarate and nitrate reduction regulatory protein	NP_753709
	109	glnK	Yersinia pestis	Nitrogen regulatory protein P-II	NP_406618
	110	modE	Escherichia coli	Molybdate uptake regulatory protein	NP_286482
	111	pspF	Salmonella enterica	Psp operon transcriptional activator	NP_455812
	112	hlyB	Yersinia pestis	Putative hemolysin activator protein	NP_406025
	113	rbsR*	Shigella flexneri	Regulator for rbs operon	NP_839112
	114	Psyr0512	Pseudomonas syringae	Rhs family protein	ZP_00124230
	115	STY4601*	Salmonella enterica	Putative regulator of late gene expression	NP_458684
	116	kdpE	Salmonella enterica serovar Typhimurium	Response regulator in two-component regulatory system with KdpD	AAL19646
	117	PA2177	Pseudomonas aeruginosa	Probable sensor/response regulator hybrid	NP_250867
	118	y3531*	Yersinia pestis	Putative kinase	NP_670828
	119	YPO0014	Yersinia pestis	Putative type II homoserine kinase/YihE	NP_403681
	120	Avin4532	Azotobacter vinelandii	Serine/threonine protein kinase	ZP_00092789
	121	Bcep3208	Burkholderia fungorum	Sugar kinases, ribokinase family	ZP_00030390
	122	NE2503	Nitrosomonas europaea	TonB-dependent receptor protein	NP_842492
	123	hrpA	Escherichia coli	ATP-dependent helicase HrpA	P43329	Rso, 16
	124	dbpA*	Yersinia pestis	ATP-dependent RNA helicase	NP_405343
	125	rpoN	Klebsiella pneumoniae	RNA polymerase sigma-54 factor	P06223	Rso, 16
	126	rpoD	Pantoea agglomerans	RNA polymerase sigma-70 subunit	AAL11450
Metabolism and nutrient scavenging	127	ilvI*	Yersinia pestis	Acetolactate synthase III	NP_670937	Pst, 12
	128	purF	Escherichia coli	Amidophosphoribosyltransferase	NP_288886	Rso, 16
	129	argG*	Photorhabdus luminescens	Argininosuccinate synthase	NP_931904	Rso, 16
	130	pheA	Erwinia herbicola	Chorismate mutase/prephenate dehydratase	S26053	Ech, 77
	131	hemB	Salmonella enterica	Delta-aminolevulinic acid dehydratase	NP_454967	Rso, 16
	132	glgX	Escherichia coli	Glucose-1-phosphate adenylyltransferase	NP_756082	Rso, 16
	133	murB*	Escherichia coli	Oxidoreductase/UDP-N-acetylpyruvoylglucosamine reductase	AAA24185	Rso/Pst; 16,12
	134	pksC*	Mycobacterium leprae	Polyketide synthase PksC	S73013	Rso, 16
	135	YPO2195	Yersinia pestis	Putative acyl coenzyme A thioester hydrolase	NP_405738	Pst, 12
	136	ygfZ	Salmonella enterica serovar Typhimurium	Putative aminomethyltransferase	NP_461964	Pst, 12
	137	YPO2310	Yersinia pestis	Putative carboxypeptidase	NP_405847	Pst, 12
	138	truD	Yersinia pestis	Putative hydrogenase subunit	AAM84415	Pst, 12
	139	aceE	Salmonella enterica	Pyruvate dehydrogenase E1 component	NP_454766	Pst, 12
	140	rhsD	Yersinia pestis	RhsD protein	NP_667608
	141	hemD	Salmonella enterica serovar Typhimurium	Uroporphyrinogen III synthase	NP_462823
	142	pyrG*	Salmonella enterica	CTP synthase (UTP-ammonia ligase)	NP_457342	Rso, 16
	143	dnaQ*	Escherichia coli	DNA polymerase III, epsilon chain	NP_752198	Rso, 16
	144	argA	Yersinia pestis	Amino acid acetyltransferase	NP_404636	Vch, 50
	145	pepN*	Salmonella enterica serovar Typhimurium	Aminopeptidase N	NP_460031	Rso, 16
	146	glnA*	Yersinia pestis	Glutamine synthetase	NP_671098	Rso/Eco, 16,68
	147	cheR	Yersinia pestis	Glutamate methyltransferase	NP_669155
	148	moaC*	Salmonella enterica	Molybdenum cofactor biosynthesis protein C	NP_455345	Pfl, 67
	149	moeC	Yersinia pestis	Molybdopterin biosynthesis protein	NP_669976
	150	YPO2420*	Yersinia pestis	Probable formyl transferase	NP_405953
	151	YPO2174*	Yersinia pestis	Putative nucleotide sugar dehydrogenase	NP_405718
	152	YPO1009	Yersinia pestis	Probable peptidase (PepT)	NP_286807
	153	fbp	Escherichia coli	Fructose-1,6-bisphosphatase	NP_757176
	154	gnd	Yersinia pestis	Gluconate-6-phosphate dehydrogenase	NP_669932
	155	zwf	Yersinia pestis	Glucose-6-phosphate dehydrogenase	NP_405618
	156	pckA	Salmonella enterica serovar Typhimurium	Phosphoenolpyruvate carboxykinase	NP_462403
	157	ECs0188	Escherichia coli	Lysine decarboxylase 2	NP_308215

^aHypothetical and unknown genes are not listed.

^bGene name designations were based on originally reported gene products that shared high similarity to pfi clone sequences. Asterisks after the gene name indicate that two or more clones were identified for the same gene in the experiment.

^cPredicted proteins or functions based on similar proteins identified using BlastX searches.

^dGenes identified to be induced in other bacterium plant or animal systems using a similar IVET screen or other in vivo expression systems. Rso, Ralstonia solanacearum; Ech, Erwinia chrysanthemi; Pst, Pseudomonas syringae pv. tomato; Pfl, Pseudomonas fluorescens; Ppu, Pseudomonas putida; Sen, Salmonella enterica; Sty, Salmonella enterica serovar Typhimurium; Sau, Staphylococcus aureus; Apl, Actinobacillus pleuropneumoniae; Vch, Vibrio cholerae; Eco, Escherichia coli. Numbers indicate the references.

^eFMN, flavin mononucleotide.

Type II secretion system (T2SS) genes similar to Yersinia enterocolitica yts1IJ (34), a known virulence factor and one of five major protein secretion systems in many pathogenic bacteria, were identified for the first time in E. amylovora. Yts1IJ proteins are known type 4 pilin-like proteins (pseudopilins). Interestingly, the type II secretion system is dependent on the general secretory pathway (GSP), i.e., the Sec secretion pathway (34). In our study, the major preprotein translocase SecA (ATPase), molecular chaperone SecB, and membrane proteins SecDF of the GSP were also induced during infection of pears along with the T2SS (Table 2). Furthermore, the peh gene, encoding an enzyme that is known to be secreted by the T2SS, was also upregulated (Table 2), indicating that a functional T2SS is present in E. amylovora and to a greater extent could contribute to the virulence of this pathogen.

Transport genes (pfi 16 to 51) including genes for general, ion, sugar, amino acid, peptide, and nucleotide transport proteins were induced in pear tissues (Table 2). Some of the transporters may belong to the type I secretion system that is known to be involved in secreting toxins, proteases, and lipases and are potential virulence factors in E. amylovora. Cell surface proteins including inner, periplasmic, and outer membrane proteins; lipoproteins; flagella; and polysaccharide proteins were also induced during pear tissue infection (pfi 52 to 72; Table 2). These membrane proteins may be involved in protein secretion and membrane maintenance. The sensor component (envZ, pfi 94) of a two-component regulatory system and cognate outer membrane protein genes that this system regulates, ompA (pfi 65) and ompC (pfi 64), were also differentially expressed in pears compared to LB medium.

Under unfavorable conditions such as nutritional stress or exposure to a host defense response, bacterial pathogens respond by overexpressing stress response genes. Several stress response genes (pfi 75 to 90) were identified in our screen (Table 2). These genes included DNA repair or protection (mutS, recA, and sulA), carbon starvation, heat or phage shock, and antioxidant (such as grpE and ahpC) genes. These results suggest that pear tissue at least initially is not a favorable habitat for E. amylovora growth and/or that DNA damage and the neutralization of plant-derived reactive oxygen species are involved in virulence and in planta growth.

The sensor component of a two-component regulatory system, grrS (pfi 93), was identified as upregulated in this study. GrrS is a homolog of GacS, which, along with GacA, globally regulates a network of virulence functions in Erwinia carotovora, including the production of quorum-sensing signaling molecules (23). Besides amylovoran and levansucrase regulators (rcsA and rlsA), and genes encoding the sensor component of a two-component regulatory system (grrS and envZ), our screen identified fliZ, a positive regulator of the flagellar biosynthetic operon in enterobacteria, as upregulated. Other regulatory genes (pfi 96 to 126), phage-related sequences (pfi 73 to 74), and metabolism and nutrient-scavenging genes (pfi 127 to 157) were identified in our screen and listed in Table 2. We recovered several metabolic genes that are potential precursors for the siderophore desferrioxamine biosynthesis in this study (pfi 153 to 157). It is probable that, under unfavorable conditions, the bacterium itself adjusts and overcomes nutrient and iron deficiencies.

The large number of unknown or hypothetical proteins identified in this IVET screen (78 genes, 19.8%) indicates the future possibilities of characterizing novel virulence traits in E. amylovora and assigning functions to these proteins. A complete genome sequence of E. amylovora is expected soon. When an annotated genome sequence is released, we will make a listing available upon request of the gene numbers of the unknown or hypothetical proteins identified in this study.

Quantitative expression analysis of selected pear-upregulated genes.

To verify that the pear-upregulated gene promoters identified using the qualitative IVET assay are induced in pear, quantitative GUS activity for six strains containing pfi promoter constructs and for promoter constructs containing the dspE promoter (in both directions) was monitored 24 and 48 h after infection of immature pear. The selected clones were chosen to validate the qualitative modified IVET screen and represented the major functional groups identified in the study. The positive control dspE^for promoter in pZYF8 was highly induced in pear after infection at both 24 and 48 h postinoculation (Table 3), whereas the negative control dspE^rev promoter in pZYF2 showed very low GUS expression (Table 3). Most of the pfi clones tested showed various degrees of induction of promoter activity at 24 h and 48 h after infection of immature pear (Table 3). The pfi 43 clone (oppA) was found to be highly induced at both 24 and 48 h after inoculation, whereas pfi 5 (hopPtoC_EA), pfi 9 (yts1IJ), pfi 91 (rlsA), and pfi 93 (grrS) were induced only at 48 h postinoculation. The clone containing hypothetical protein (sav2932), on the other hand, was strongly induced at 24 h postinoculation with expression tailing off at 48 h (Table 3).

TABLE 3.

Expression of IVET clones after inoculation of immature pear fruit

pfi clone or strain	Gene homolog	0 hpia	24 hpi		48 hpi
		GUS activityb	GUS activity	Fold inductionc	GUS activity	Fold induction
pZYF2	dspErevd	ULf	UL	0	UL	0
pZYF8	dspEfore	1.0 ± 2.1	282.0 ± 145.5	282.0	118.3 ± 18.4	118.3
pfi5	hopPtoC	10.8 ± 6.7	11.8 ± 4.4	1.1	90.1 ± 43.3	8.4
pfi9	yts11J	37.1 ± 2.0	74.7 ± 34.9	2.0	128.0 ± 48.8	3.5
pfi43	oppA	1.0 ± 0.9	91.4 ± 27.4	91.4	138.9 ± 25.2	138.9
pfi91	rlsA	1.0 ± 1.3	UL	0	19.2 ± 12.6	19.2
pfi93	grrS	77.7 ± 2.3	30.2 ± 7.0	0.4	106.3 ± 35.8	1.4
	sav2932g	107.4 ± 3.5	852.2 ± 380.3	7.9	86.2 ± 40.4	0.8

^aHours postinoculation (hpi).

^bGUS activity is shown in μmol of 4-methylumbelliferyl produced min⁻¹ 10⁹ CFU⁻¹. Data represent the means of three measurements ± standard errors. Similar results were obtained in a second independent experiment.

^cFold induction is shown as GUS activity at 24 or 48 hpi/GUS activity at 0 hpi.

^ddspE promoter in opposite direction from uidA gene.

^edspE promoter in correct direction toward uidA gene.

^fUL, under detection limit of vector control.

^gsav2932 encodes a hypothetical protein and is not listed in Table 2.

Construction and analysis of knockout mutants.

Although the IVET experiments were conducted in the E. amylovora Ea110⁻ background and an Ea110 hrpA mutant was available, we were unsuccessful in subsequent attempts to construct chromosomal knockout mutants in this strain. Thus, we utilized the strain Ea1189 for mutant construction. Although the similarity of genetic backgrounds of these strains is currently unknown, the virulence of the two strains is similar (data not shown) and the overall genome diversity of E. amylovora is relatively low, and therefore, we hypothesize that the expression of promoters identified as upregulated in Ea110 would be comparable to that in Ea1189. We chose the hopPtoC_EA and mltE_EA genes as candidates for insertional mutagenesis using allele marker exchange to investigate the potential roles of those genes in virulence. These genes were chosen because hopPtoC_EA was a new putative effector in E. amylovora and mltE_EA was previously demonstrated to have an effect on virulence in P. syringae. The full sequences of these genes and their corresponding upstream and downstream sequences were obtained by various methods including fully sequencing available clone inserts or recovering additional flanking DNA sequences using TAIL-PCR. Sequence analysis showed that the deduced amino acid sequence of the hopPtoC_EA gene shared 77% similarity with that of the hopPtoC_PST gene from P. syringae pv. tomato (data not shown). The deduced amino acid sequence of the E. amylovora mltE_EA gene showed 75% similarity with that of the mltE_YP gene from Yersinia pestis (data not shown). As described in Materials and Methods, we were able to generate insertional mutants for hopPtoC_EA and mltE_EA genes and tested the effect of these mutations on pathogenesis and bacterial growth in immature pear.

We conducted two experiments to evaluate the extent of symptom production in immature pears caused by the WT strain Ea1189, the hopPtoC_EA mutant ZYC1-3, and the mltE_EA knockout mutant ZYE3-11. In experiment 1, mean lesion diameters after 6 days of incubation (measured from 10 replicate pears per strain) were 2.15 cm, 1.91 cm, and 1.30 cm for Ea1189, ZYC1-3, and ZYE3-11, respectively. The mean lesion diameter for ZYE3-11 was significantly smaller (P < 0.05) than that of Ea1189 and ZYC1-3 following an analysis of variance and least significant difference test. In a second experiment utilizing 12 replicate pears per strain, mean lesion diameters (± the standard error of the mean) were 2.21 ± 0.12 cm and 1.45 ± 0.04 cm for Ea1189 and ZYE3-11, respectively, confirming a small but significant difference in symptom expression.

Quantification of bacterial growth in infected immature pears indicated that there was no difference in growth between Ea1189 and ZYE3-11 over the first 2 days after infection; however, ZYE3-11 cell counts were 3- to 10-fold less than that of Ea1189 at 3 and 4 days after inoculation (Fig. 3B). Three replicate experiments and a combined total of 9 and 12 individual pears were analyzed at each time point for Ea1189 and ZYE3-11, respectively (Fig. 3B), indicating that this small difference in growth was repeatably observed. In contrast, growth of the hopPtoC_EA mutant ZYC1-3 was indistinguishable from that of Ea1189 in immature pears over the course of these experiments (data not shown).

FIG. 3.

Symptoms and growth of Erwinia amylovora WT Ea1189 and corresponding hopPtoC_EA and mltE_EA mutants in immature pear. (A) Symptoms caused by Erwinia amylovora Ea1189 and hopPtoC_EA (ZYC1-3) and mltE_EA (ZYE3-11) mutants in immature pear. W, water control; DPI, days postinoculation. (B) Growth of Erwinia amylovora WT Ea1189 and the mltE_EA (ZYE3-11) mutant during infection of immature pears. The growth of strains was monitored at 0, 1, 2, 3, and 4 days after inoculation. Data points represent the means of three replicates ± standard errors. Similar results were obtained in two additional independent experiments.

DISCUSSION

We utilized a simplified qualitative IVET approach to scan the E. amylovora genome and recovered 394 unique chromosomal genes with increased expression during infection of pear fruit tissue. Our IVET methodology differed from most IVET systems utilized previously, which depend on the complementation of an essential gene that is expressed via promoter sequences that are induced in the habitat of interest. These systems typically screen pools of clones simultaneously, which could potentially prevent the identification of clones due to competition effects. Since our system was optimized to be conducted in a 96-well plate format, we were able to screen promoter clones individually, eliminating the competition effects of clone pools. Also, since our system did not rely on complementation of an essential gene, we may have identified promoters either expressed at low levels or delayed in expression following immature pear infection; both of these categories of promoters would likely have been missed in a complementation format. Indeed, our quantitative analysis of expression from a subset of promoters representing major functional groups identified in the study revealed interesting differences in temporal expression patterns. The differences in expression observed using this small set of promoters suggests that a comprehensive evaluation of the timing of expression of E. amylovora virulence factors would considerably add to our knowledge of the fire blight pathosystem.

As expected, this study highlighted the importance of type III secretion in E. amylovora pathogenesis with the recovery of genes encoding regulatory and structural components of the Hrp type III secretion system and effector proteins. While we did not recover all of the currently known hrp-regulated genes in E. amylovora, our results are similar to those of other IVET studies with plant-pathogenic bacteria. For example, IVET studies of E. chrysanthemi and P. syringae pv. tomato identified two and eight hrp-regulated genes, respectively (12, 77). These findings validated our approach and suggested that a detailed analysis of the genes recovered in this study would further reveal additional determinants involved in the pathogenesis of the fire blight bacterium.

The dspEF operon, encoding the major effector and pathogenicity factor DspE and its cognate chaperone DspF, was recovered multiple times in our analysis and shown by quantitative expression analysis to be highly expressed during pear infection (Table 3). The importance of DspE and its homologs to plant pathogenesis is well known in a number of pathosystems (14, 25, 45, 54, 69) although the function(s) of this large protein has not been elucidated. DspE was recently shown to contribute to the suppression of salicylic acid-mediated basal immunity (20); effector suppression of the host defense response is rapidly becoming recognized as an important strategy of bacterial plant pathogenesis (3). We identified a new putative effector, HopPtoC_EA, in this study, an ortholog of HopPtoC from P. syringae pv. tomato (65). As with many effectors from P. syringae, a knockout mutant of HopPtoC_EA in E. amylovora Ea1189 was not reduced in virulence, presumably due to functional redundancy with other effectors in the E. amylovora genome. The other known E. amylovora effectors, HrpN and HrpW, were not identified as upregulated in this study, although the roles of hrpN and hrpW in the pathogenicity of E. amylovora were reported to differ during infection of immature pear fruit (41, 75). It is tempting to speculate that additional effector proteins may exist in the genome of E. amylovora and contribute to the virulence of the bacterium.

The importance of type II secretion in E. amylovora pathogenesis was also highlighted with the identification of the upregulation of genes of the yts1IJ operon and components of the general secretion pathway. Type II secretion is a cooperative process initially dependent upon the secretion of enzymes into the periplasm by the general secretion pathway followed by targeted secretion through the type II apparatus (6, 64). In Y. enterocolitica, the Yts1 protein secretion apparatus is unique to highly pathogenic species, is important for virulence in a mouse model, and shares homology with type II secretion clusters from E. chrysanthemi and E. carotovora (9, 34). Peh (polygalacturonase), an enzyme thought to be secreted by the T2SS, was also upregulated and recovered in our IVET screen (38). While the importance of polygalacturonase to virulence in soft-rotting Erwinia spp. is well known (38), the role of cell wall-degrading enzymes in E. amylovora pathogenesis is currently still unknown. In addition, the upregulation of MltE, a specialized cell wall-degrading enzyme, was interesting in that the function of this enzyme is to generate localized openings of the bacterial peptidoglycan envelope for export of bulky materials including possibly toxins and fimbrial proteins and to allow the efficient assembly and anchoring of supramolecular transport complexes such as T2SS and TTSS in the cell envelope (21, 42). As in P. syringae (12), we found that E. amylovora MltE made a small contribution to virulence.

We identified three additional upregulated enzymes in our IVET assay that are potentially secreted from the cell including levansucrase (Lsc) and the adhesin-like protein HecA, which belongs to a class of external virulence factors that is widely distributed among plant and animal pathogens. HecA from E. chrysanthemi contributes to attachment, aggregation, and epidermal cell killing and is thought to be involved in the earliest stages of E. chrysanthemi pathogenesis (62). Levansucrase, an enzyme that directs the synthesis of levan from sucrose, has a known effect on the virulence of E. amylovora during pear seedling infection (29). The PrtA metalloprotease contributes to E. amylovora virulence in an apple leaf infection assay and is apparently dependent upon the type I Prt machinery for secretion (38, 80). These results demonstrate the importance of TTSS and T2SS and of other external virulence factors in E. amylovora infection of fruit tissue.

A total of 5.3% of the IVET genes identified were placed in the functional category of stress response including genes involved in the response to reactive oxygen species, both heat and cold shock, and carbon and sulfate starvation. E. amylovora apparently induces an initial host defense response early after infection (71, 72); the bacterium is capable of surviving this plant oxidative burst, with the initial plant cell death and nutrient leakage being thought to provide the impetus for further spreading of the pathogen within the plant. The role of individual proteins in oxidative stress survival is currently unknown in E. amylovora; however, the alkyl hydroperoxide reductase AhpC is a known virulence factor in several plant-pathogenic bacteria, contributing to protection from oxidative stress from an active plant defense response (53).

We recovered a multitude of transporters functioning in the uptake of iron, sugars, amino acids, and inorganic ions. The induction of these systems during infection indicates that E. amylovora elaborates various factors as needed to colonize host tissues. Iron availability is critical to most bacterial pathogens, and the siderophore desferrioxamine is a virulence factor in E. amylovora (24). We recovered three upregulated proteins involved in iron transport or storage. It is probable that, under unfavorable conditions, the bacterium itself adjusts and overcomes nutrient and iron deficiencies. Several upregulated transport proteins recovered were ABC transporters, which is potentially significant because ABC transporters both directly and indirectly affect virulence of bacterial pathogens (27). While most of the transporters were involved in uptake, the multidrug resistance protein EmrB (pfi 31) was also upregulated and presumably functions in the efflux of plant-derived toxins encountered during infection. The role of the AcrAB efflux pump in E. amylovora virulence and tolerance of phytoalexins including phloretin, naringenin, and quercetin was recently reported (17). Thus, it is possible that many of these ABC transporters are involved in the virulence of E. amylovora. In conjunction with the number of upregulated transporters found, a large proportion of the genes identified in this study were involved in metabolism (20.3%) and nutrient acquisition (16%). These frequencies may be associated with the host tissue (immature pear fruit) chosen for study; however, a number of genes that we identified were also identified in other IVET studies involving those of E. coli, P. fluorescens, P. syringae, R. solanacearum, and Vibrio cholerae (Table 2) (12, 16, 47, 77).

About 12% of the genes identified in this study were involved in regulation, which is a ratio similar to that identified in an IVET examination of E. chrysanthemi infection (77). Previously known E. amylovora transcription factors that were upregulated included RcsA, an activator (along with RcsB) of amylovoran production (73), and RlsA, an activator of levan production (79), along with the capsular polysaccharide export protein KpsC. This further confirms that the production of both amylovoran and levan in E. amylovora is induced during infection. Another important regulator, GrrS (global response regulator sensor in a two-component regulatory system), is a homolog of GacS, which, along with GacA, globally regulates a network that controls exoenzyme and secondary metabolite (toxin) production in Pseudomonas spp. and virulence functions in E. carotovora and also regulates the production of quorum-sensing signaling molecules (18, 23, 61). GacA/GacS-regulated networks also function by positively controlling the transcription of small regulatory RNAs, transcriptional activators, and alternative sigma factors such as HrpL (18, 32). In E. amylovora, the small regulatory RNA rsmB titrates the repressor RsmA in a system that affects exopolysaccharide production and, therefore, pathogenicity (46).

EnvZ is the sensor component of the OmpR-EnvZ two-component regulatory system that is very important in regulating various cellular components such as outer membrane proteins OmpC and OmpA, which is also upregulated in this study. In Salmonella spp., OmpR-EnvZ regulates another two-component system, SsrA-SsrB, that in turn regulates the type III secretion system produced by Salmonella pathogenicity island 2 (Spi-2) (43). EnvZ is a transmembrane sensor that predominantly responds to acidic pH conditions and subsequently phosphorylates OmpR, which functions as a transcriptional activator in the expression of the ssrAB genes (26). SsrA is a second sensor protein that is responsive to acidic pH and also detects low-osmolarity conditions and the absence of Ca²⁺ ions, all environmental conditions within macrophages where the Spi-2 type III secretion system is exclusively expressed (26). In E. amylovora, the structural components of the TTSS encoded by the Hrp regulon are regulated by the two-component system HrpX and HrpY, which direct the expression of the σ⁵⁴-dependent, enhancer-binding protein HrpS (74). Both HrpY and HrpS function in activating the expression of the alternate sigma factor HrpL, thereby regulating the various genes and operons of the Hrp regulon, which contains HrpL-dependent promoter sequences (74). The expression of HrpX and HrpS is regulated by low pH, low nutrients, and low-temperature conditions, mimicking the plant apoplast but also representing conditions that suggest that a two-component regulatory system such as OmpR-EnvZ could further regulate the hrpXY operon despite no direct evidence to support this claim. Interestingly, both hrpX and hrpL, along with the EnvZ gene, were found to be upregulated during infection of immature pear in this study (Table 2).

Among the bacterial cell surface and transmembrane-upregulated proteins, three flagellar proteins, FliG, FliM, and FlgN, were upregulated. The trait of motility is not required for E. amylovora pathogenesis; however, motility does increase blossom infectivity, particularly at lower cell concentrations (8). Furthermore, a homolog of Y. pestis FliZ, a positive regulator for the flagellar biosynthetic operon and an alternative sigma factor, was also found to be upregulated in our study. In Salmonella enterica serovar Typhimurium, FliZ upregulates HilA, which in turn activates production of several invasion proteins encoded within the Salmonella pathogenicity island 1 (35). Finally, the contribution of cell shape to virulence was also highlighted by the recovery of an E. coli RodA homolog; E. amylovora mutants with TnPhoA insertions within the rodA-pbpA operon were previously reported to be avirulent (52).

In summary, our IVET screen successfully identified a variety of genes upregulated during fruit infection by E. amylovora. We utilized a modified IVET method in this study, which is different from many other IVET studies in that we did not impose a rigorous selection step, i.e., one that necessitates rescue of an essential phenotype, in our gene identification work. The successful identification of a large number of known virulence genes of E. amylovora in this study further validated our approach. However, because of the qualitative nature of the gene identification step, through β-glucuronidase staining and visualization of gene expression on pear slices and agar medium, it is possible that this methodology may have resulted in some artifacts. Nevertheless, the main goal of this work, as in other IVET analyses, was to identify potentially important genes in the E. amylovora infection process that could be subjected to further detailed studies to clearly delineate the role of these genes in pathogenesis.

We further confirmed that the TTSS and its major effector protein DspE are essential for full virulence in E. amylovora during infection of immature pear. We also found a complete and functional T2SS and its potential secreted proteins in E. amylovora for the first time. We identified a new putative effector and external virulence factors such as HecA which were previously unknown in E. amylovora and discovered a number of putative regulatory proteins that may influence the regulation of virulence factors on a global level and eventually contribute to the virulence of the bacterium. We can now ask questions concerning the comparative regulation of critical genes identified in this study during infection of other host tissues, particularly blossoms and shoots. It is possible that E. amylovora may utilize differential virulence strategies depending upon the host tissue encountered. Of interest to us also is the expression profile of these same genes during infection of highly susceptible versus fire blight-tolerant apple varieties.