Abstract
Background
Hypopharyngeal cancer is increasingly emerging as a disease that threatens global health, with poor prognosis and survival rates. However, clinical strategies and effective therapies remain limited.
Methods
The inhibitory effect of liensinine on tumor cells was detected through cell cycle, colony formation, and apoptosis assays. Changes in the expression levels of relevant proteins were detected and enrichment analysis of signaling pathways was performed through in vitro and RNA sequencing experiments. The transcription levels of relevant genes were further verified using reverse transcription polymerase chain reaction.
Results
We previously discovered that the natural compound, liensinine, is effective in treating hypopharyngeal cancer. In this study, we found through in vitro and RNA sequencing experiments that liensinine can activate the Ras homolog family member B protein, thereby inhibiting the mitogen-activated protein kinase signaling pathway. Additionally, liensinine activates the nuclear factor kappa B signaling pathway and releases downstream inflammatory factors, effectively exerting its antitumor effects.
Conclusion
Liensinine induces cell death and inhibits hypopharyngeal cancer cell growth through multiple pathways, indicating that it is a potential chemotherapeutic agent for the treatment of hypopharyngeal cancer.
Keywords: Hypopharyngeal cancer, liensinine, mitogen-activated protein kinase, nuclear factor kappa B, Ras homolog family member B
Introduction
Hypopharyngeal carcinoma, a subtype of head and neck squamous cell carcinoma (HNSCC), is characterized by its aggressive behavior and poor prognosis.1,2 Arising from the epithelial lining of the hypopharynx, this malignancy often presents at an advanced stage due to its anatomical location, which complicates early detection. 3 The advent of RNA sequencing (RNA-seq) has enabled a deeper understanding of the transcriptomic landscape of hypopharyngeal carcinoma, facilitating the identification of novel biomarkers and therapeutic vulnerabilities. 4
Liensinine is a bisbenzylisoquinoline alkaloid derived from the traditional Chinese medicinal plant Nelumbo nucifera Gaertn. 5 It has garnered considerable attention owing to its diverse pharmacological activities, particularly in the context of cancer therapy.6,7 The compound exhibits potent antiproliferative effects across various malignancies, suggesting a promising role in oncology. Moreover, it has been shown to suppress the expression of key oncogenes while upregulating tumor suppressor genes, thereby restoring cellular homeostasis and inhibiting tumorigenesis.8,9 Transcriptomic analyses utilizing RNA-seq have revealed that liensinine can modulate multiple signaling pathways critical for tumor progression, including those involved in cell cycle regulation, apoptosis induction, and angiogenesis inhibition.
Although liensinine exerts potent antitumor effect, its mechanism of action in hypopharyngeal carcinoma remains unknown. Therefore, in the present study, we investigated the mechanism of action of liensinine in hypopharyngeal cancer. In vitro experiments have revealed that liensinine inhibits the proliferation and invasion of hypopharyngeal carcinoma and blocks the G1 phase of the cell cycle, promoting the death of hypopharyngeal carcinoma cells. Meanwhile, we subjected the liensinine-treated FaDu cells to RNA-seq, which revealed that the Ras homolog family member B (RHOB) gene plays an important role in the antitumor process. RHOB is activated to inhibit the mitogen-activated protein kinase (MAPK) pathway while activating the nuclear factor kappa-B (NF-κB) pathway, resulting in increased levels of downstream inflammatory factors. This also demonstrates the antitumor effect of liensinine.
Therefore, we designed this study with the hypothesis that liensinine exerts significant therapeutic efficacy in hypopharyngeal cancer.
Materials and methods
Cell culture and methods
The FaDu (ATCC, USA, #HTB-43; RRID:CVCL_1218) and Detroit (ATCC, USA, # CCL-138; RRID:CVCL_1171) cell lines were maintained in our laboratory and cultured in Dulbecco’s modified Eagle’s minimal essential medium (DMEM; Gibco; USA; # 11965092) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin in an incubator that contained 5% carbon dioxide (CO2) at 37°C. Liensinine (≥98.0%, China, MCE, # HY-N0484) was suspended in dimethyl sulfoxide (DMSO; Solarbio, China, #D8371) and stored in the refrigerator at 4°C.
Cell counting kit-8 (CCK8) assay
CCK-8 (Beyotime, China, # C0037) assays were performed to analyze the effect of liensinine on the proliferation of FaDu and Detroit cells. Briefly, 5000 cells per well were added to 96-well plates. Then, the cells were treated with DMSO control or different concentrations of liensinine (5, 10, and 20 μM) after cell adhesion for 48 h. Alternatively, the cells were treated with 20 μM liensinine after cell adhesion for different durations (0, 24, 48, and 72 h). At each treatment concentration, the experiments were performed with three replicate wells in one plate. At each indicated time point, in total, 10 μL of CCK-8 solutions were added to each well. After incubation at 37°C for 1 h, the absorbance was measured at 450 nm using a microplate reader. The results of three independent experiments were recorded for statistical analyses.
Cell cycle and apoptosis assay
Cell cycle distribution was analyzed using propidium iodide (PI) staining and flow cytometry. We treated FaDu and Detroit cells with 0, 5, 10, and 20 μM liensinine for 48 h. Cells were then washed with phosphate buffered saline (PBS) and fixed in 75% ethanol overnight at 4°C. Cells were then centrifuged and incubated with ribonuclease (RNase, 100 mg/mL) at 37°C for 30 min. The cells were then stained with PI. Flow cytometry (RRID:SCR_012341) was used to analyze cellular DNA content and cell cycle distribution.
Apoptosis was analyzed using the PI/Annexin V-FITC kit (Beyotime, # C1062M). FaDu and Detroit cells were treated with 0, 5, 10, and 20 μM liensinine for 48 h. Cells were collected by centrifugation and resuspended in 500 μL of 1× binding buffer. Cells were then incubated with membrane-bound protein V-FITC (5 µmoL) and PI (5 µmoL) for 30 min at 37°C. Apoptosis was analyzed using flow cytometry.
Colony formation assay
FaDu and Detroit cells were trypsinized and seeded at 500 cells per 6 cm-dishes with 2 mL of the culture medium. The cells were grown with 0, 0.5, 1, and 2 μM liensinine for an additional 2 weeks at 37°C, 5% CO2, and 100% humidity without changing the medium. Then, colonies were washed with PBS, fixed with 4% paraformaldehyde, and stained with 0.05% crystal violet for 5 min. Image J software was used to quantify the number of colonies.
Transwell assay
Transwell chambers (Corning, NY, USA, #3401) were used to evaluate the migration ability of FaDu and Detroit cells. Cells were resuspended by trypsin to a density of 1.5 × 105 cells/mL. Then, 200 µL of cell suspension was seeded in the upper chamber, and 600 µL of DMEM supplemented with 10% FBS was added to the lower chamber. The next day, after the cells had adhered, we removed the medium in the upper chamber and added serum-free medium with liensinine concentrations of 0, 5, 10, and 20 μM, respectively. After incubation for 48 h, the migrated cells were fixed with 4% paraformaldehyde at room temperature for 15 min. Then, the cells were stained with 0.1% crystal violet for 15 min, and the stained cells were quantified under a microscope (DM1000; Leica Microsystems GmbH, Wetzlar, Germany).
Western blot analysis
Total protein was extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, China, #P1003K), and protein concentration was quantified using a bicinchoninic acid (BCA) protein assay kit (Beyotime, China, #3P0011). Proteins were separated using sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to polyvinylidene difluoride membranes, and blocked with 5% skim milk in Tris-buffered saline with Tween-20 (TBST) buffer (20 mM Tris, 200 mM NaCl, and 0.04% Tween 20) for 1 h at 25°C. Next, the blots were incubated with primary antibodies overnight at 4°C, followed by incubation with anti-rabbit horseradish peroxidase-conjugated secondary antibodies (diluted 1:5000) for 1 h at 25°C. Protein bands were visualized using Immobilon western blotting detection reagents (EMD Millipore, Billerica, MA, United States). Anti-beta-actin (#Ab8226) antibodies were obtained from Abcam. RHOB (#2098), extracellular signal-regulated kinases 1 and 2 (ERK1/2) (#9102), and phospho-ERK1/2 (#4370) were purchased from Cell Signaling Technology (CST).
RNA isolation and quantitative reverse transcription polymerase chain reaction (qRT–PCR)
Total RNA was isolated from FaDu cells using Trizol reagents (TaKaRa, Tokyo, Japan, #9109). cDNA was synthesized by using Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen) and reverse transcription primers Oligo (dT). PCR amplification was performed with SYBR Green Real-Time PCR Master Mixes (Thermo Fisher, Waltham, MA, USA) according to the manufacturers’ instructions on a 7900HT Fast Real-Time PCR machine (Applied Biosystems). The relative expression level of genes was normalized to the internal reference gene GAPDH. The primers sequences are detailed in Table 1.
Table 1.
The primers sequences.
| Gene | Primers | Sequence (5′–3′) |
|---|---|---|
| RHOB(H) | FORWARD | CGACATTGAGGTGGACGGCAAG |
| REVERSE | GGATGATGGGCACATTGGGACAG | |
| DDIT4(H) | FORWARD | CTCGTCGTCGTCCACCTCCTC |
| REVERSE | GGCTTACCAACTGGCTAGGCATC | |
| TXNIP(H) | FORWARD | CATGCCACCACCGACTTATACTGAG |
| REVERSE | TTGCCTGCTGACCACCTCCTAC | |
| CHAC1(H) | FORWARD | GCTCTCCTGCTTGACACTGACTTAC |
| REVERSE | CTCCTTCTCCTCATGCCCTACTATCC | |
| IFI27(H) | FORWARD | GTCTGGCTGAAGTTGAGGATCTCTTAC |
| REVERSE | CGGACATCATCTTGGCTGCTATGG | |
| PCK2(H) | FORWARD | CAGCGGCTATGGTGGCAACTC |
| REVERSE | TGGGATTGGTGGTGGCAGAGG | |
| FABP5(H) | FORWARD | ACATGAAGGAGCTAGGAGTGGGAATAG |
| REVERSE | GCTGAACCAATGCACCATCTGTAAAG | |
| KLF6(H) | FORWARD | ACAACTTAGAGACCAACAGCCTGAAC |
| REVERSE | CACACCCTTCCCATGAGCATCTG | |
| SLC7A11(H) | FORWARD | TCCGCAAGCACACTCCTCTACC |
| REVERSE | TGACGAAGCCAATCCCTGTACTAAATG | |
| IL-6(H) | FORWARD | GGCGCCTTCGGTCCAGTTGC |
| REVERSE | AACCCCATCGCCAAGCCTACCC | |
| IL-18(H) | FORWARD | GATGGCTGCTGAACCAGTAG |
| REVERSE | GCTAGTCTTCGTTTTGAACAGTG | |
| IL-32 | FORWARD | GCCTTGGCTCTTGAACTTTTG |
| REVERSE | CCGCCACTGCTGTCTCCAGGTAG | |
| GAPDH(H) | FORWARD | TGACTTCAACAGCGACACCCA |
| REVERSE | CACCCTGTTGCTGTAGCCAAA |
Library construction for RNA-seq and other sequencing procedures
FaDu cells were incubated with 2 μM liensinine for 48 h and lysed in TRIzol reagent. Total RNA quantity and purity were assessed using the Bioanalyzer 2100 and RNA 6000 Nano LabChip kit (Agilent, CA, USA, 5067-1511), and sequencing libraries were constructed using high-quality RNA samples with a RIN >7.0. After library construction, we performed 2 × 150 bp double-ended sequencing (PE150) on an Illumina Novaseq™ 6000 following the protocol recommended by the vendor.
Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses
The Database for Annotation, Visualization, and Integrated Discovery (DAVID) (https://david.ncifcrf.gov/home.jsp) was used to analyze the Gene Ontology (GO) terms and KEGG pathways. These data were transformed into log2 and median centered using the adjust data function in the R package plots. Then, hierarchical clustering using the R package average linkage was performed, and DAVID assigned these genes to relevant GO biological terms and KEGG molecular pathways. Related and significant GO biological terms were identified based on Examination of Anomalous Self-Experience (EASE) score p values <0.01, and significant KEGG molecular pathways were identified based on EASE score p values <0.05. Higher enrichment and gene counts indicated more important pathways. Finally, trees were generated for visualization with Java TreeView (Stanford University School of Medicine, Stanford, CA).
Statistical analyses
All experiments were repeated at least thrice, and the experimental data were statistically analyzed using GraphPad Prism 8.0 software. Data are presented as the mean ± standard deviation (SD) values. Unpaired t-test was used for comparing data between the two groups, and one-way analysis of variance (ANOVA) was used for comparisons between multiple groups.
Results
Liensinine promotes the death of hypopharyngeal cancer cells in vitro
Liensinine, as a natural alkaloid (Figure 1(a)), has many properties and uses that have not yet been explored. 10 To determine the effect of liensinine on the treatment of hypopharyngeal cancer, we used two cell lines, FaDu and Detroit, as experimental lines. First, the inhibition rate of liensinine on FaDu and Detroit cells was evaluated using CCK-8 assay. The response of FaDu and Detroit cells to liensinine treatment was significantly higher in a dose-dependent manner, and the effect of liensinine was significantly higher at 48 h of treatment (Figure 1(b) to (e)). Therefore, the time point of 48 h was applied in subsequent experiments.
Figure 1.
Liensinine promotes death of hypopharyngeal cancer cells in vitro. (a) Chemical molecular structure of liensinine. (b) FaDu cell viability determined using the CCK-8 assay after treatment with different concentrations of liensinine for 48 h. (c) FaDu cell viability determined using the CCK-8 assay after treatment with 20 μM liensinine for different durations. (d) Detroit cell viability determined using the CCK-8 assay after treatment with different concentrations of liensinine for 48 h. (e) Detroit cell viability determined using the CCK-8 assay after treatment with 20 μM liensinine for different durations. Data are presented as mean ± SD values, N = 3. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (f and g) Percentage of cells undergoing apoptosis detected by flow cytometry using PI/Annexin V-FITC double staining after treatment of FaDu and Detroit cells with liensinine for 48 h. Data are presented as mean ± SD values, N = 3. *p < 0.05, **p < 0.01, ***p < 0.0001. ***p < 0.0001. CCK-8: Cell counting kit-8.
For a detailed comparative analysis of apoptosis, FaDu and Detroit cells were stained with Annexin V-AlexaFluor™488 in combination with PI assay and flow cytometry to identify apoptotic cells. Flow cytometry Annexin V/PI analysis data showed a dose-dependent increase in apoptosis in the control, 5 μM, 10 μM, and 20 μM liensinine groups (Figure 1(f) and (g)). Taken together, liensinine significantly promoted apoptosis in FaDu and Detroit cells.
Liensinine inhibits cell proliferation and invasion by arresting the cell cycle in the G1 phase of hypopharyngeal cancer cells
FaDu and Detroit cells were cocultured with medium and liensinine (0, 5, 10, 20 μM) alone for 48 h. Flow cytometry analysis of cell cycle distribution showed a dose-dependent increase in the proportion of FaDu and Detroit cells in the G1 phase after liensinine treatment (Figure 2(a) and (b)). The results of clone formation experiments showed that the number of clones formed by FaDu and Detroit cells decreased significantly with increasing liensinine concentration (Figure 2(c) and (d)). Liensinine mainly inhibited the G1 phase of FaDu and Detroit cells to arrest and inhibit cell proliferation. As tumor metastasis is an important cause of poor prognosis in patients with head and neck tumors, we performed Transwell experiments to confirm the effect of 0, 5, 10 and 20 μM liensinine on the invasive and migratory behavior of FaDu and Detroit cells after 48 h. The results of these experiments are shown in Table 1. The results showed that the invasiveness of liensinine-treated cells was significantly reduced compared with that of control cells, an effect that exhibited a dose-dependent increase (Figure 2(e) and (f)). This finding supports the idea that liensinine inhibits the invasive ability of FaDu and Detroit cells. Thus, our evidence suggests a role of liensinine in inhibiting the in vivo proliferation and invasion of hypopharyngeal cancer cells.
Figure 2.
Liensinine inhibits cell proliferation and invasion by arresting the cell cycle in the G1 phase of hypopharyngeal cancer cells. (a and b) Cell cycle distribution examined using flow cytometry after treating FaDu and Detroit cells for 48 h with different concentrations of liensinine. (c and d) Clone formation assays determined to verify the effect of liensinine on the proliferation of FaDu and Detroit cells. Cells were stained with crystal violet. Quantitative analyses of the colonies were based on three independent experiments. Data are presented as mean ± SD values. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. (e and f) Effect of liensinine on FaDu and Detroit cell invasion. FaDu and Detroit cells exposed to different concentrations of liensinine for 48 h; the degree of invasion was determined using Transwell assay. Cells were stained with crystal violet. Quantitative analyses of the colonies were based on three independent experiments. Data are presented as mean ± SD values. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Scale bar: 50 μm.
Liensinine-induced changes in gene expression
To investigate the mechanism of action of liensinine’s antitumor therapy, we used FaDu cells for the experiments in this section. FaDu cells were treated with liensinine for 48 h, and the samples were analyzed using RNA-seq. Hierarchical cluster analysis revealed the overall changes in gene expression in the samples (Figure 3(a) and Supplementary Figure 1A). After preliminary screening, a total of 744 genes were identified as being differentially expressed. Compared with the control group, 606 genes were upregulated and 138 genes were downregulated in the liensinine group (Figure 3(b) and (c)). Among them, RHOB, DDIT4, and TXNIP played important roles in antitumor therapy. TXNIP and SLC7A11 were associated with iron death (Figure 3(d) and Supplementary Figure 1B). This further confirmed the inhibitory effect of liensinine on hypopharyngeal cancer cells.
Figure 3.
Liensinine-induced changes in gene expression. (a) PCA of the transcriptome with and without liensinine treatment represented in two-dimensional space. (b) Volcano plot showing differentially expressed genes between liensinine-treated and untreated FaDu cells. (c) Differentially expressed genes MA plot showing differentially expressed genes between liensinine-treated and untreated FaDu cells. (d) Heatmaps showing highly enriched associated differentially expressed genes and (e) Interaction and co-expression networks of up- and down-regulated genes. PCA: principal component analysis; MA: minus-versus-add.
To further investigate the role of liensinine in hypopharyngeal cancer cells, we performed co-expression network analysis to understand the interactions of differentially expressed genes in FaDu cells after liensinine action. Each node represented a set of highly correlated proteins. Red color indicated upregulation with other proteins; blue color indicated downregulation with other proteins. The folding change of each protein determined the color of the circle. The larger the circle, the stronger the correlation. To predict protein interactions between up- and down-regulated genes, the protein–protein interaction network was analyzed and generated using the STRING plug-in application (Figure 3(e)).
Validation of the potential target genes of liensinine
Considering the key role of liensinine in regulating cancer development and the results of the bioinformatics analyses, we decided to focus on nine predicted genes that could be involved in tumor-associated signaling pathways and show the greatest fold change (Figure 3(f)), including the upregulated genes RHOB, DDIT4, TXNIP, CHAC1, IFI27, PCK2, KLF6, and SLC7A11. The downregulated gene was FABP5. We further verified the expression changes using qRT–PCR. Among the nine genes, RHOB, DDIT4, TXNIP, CHAC1, IFI27, and SLC7A11 were significantly upregulated in liensinine-treated FaDu cells, while FABP5 was downregulated, consistent with the results of mRNA sequencing (mRNA-seq) (Figure 4(a) to (g)). PCK2 showed a contrary trend to that expected, and KLF6 showed no significant change (Figure 4(h) and (i)). These results suggest that RHOB, DDIT4, TXNIP, CHAC1, IFI27, SLC7A11, and FABP5 are the target genes of liensinine and are involved in tumor-related biological processes and signaling pathways.
Figure 4.
Validation of the potential target genes of liensinine. (a–i) qRT–PCR detection of eight upregulated genes and one downregulated gene in FaDu cell lines treated and untreated with liensinine. Data are presented as mean ± SD values, N = 3. Ns: not significant. *p < 0.05, **p < 0.01, ***p < 0.001. qRT–PCR: quantitative reverse transcription polymerase chain reaction.
Liensinine exerts antitumor effects by activating RHOB to inhibit the MAPK signaling pathway
To further explore the aggregation of differentially expressed genes in tumor-related biological processes and signaling pathways, we performed GO and KEGG enrichment analysis. KEGG analysis showed that liensinine regulates the MAPK signaling, TNF signaling, interleukin (IL)-17 signaling, and NF-κB signaling pathways. Among them, the MAPK signaling pathway was highly enriched (Figure 5(a) and (b)). Then, FaDu cells were treated with 2 μM liensinine for 48 h followed by subsequent protein and RNA level verification. Western blotting assay revealed that RHOB protein expression increased with the liensinine dose; however, the level of ERK protein phosphorylation in the MAPK signaling pathway decreased in a dose-dependent manner (Figure 6(a)). This suggests that liensinine exerts antitumor effects by activating RHOB and inhibiting the downstream MAPK signaling pathway. In contrast, KEGG analysis showed that the NF-κB signaling pathway was activated (Figure 5(a) and (b)). The NF-κB signaling pathway can activate downstream inflammatory factors. 11 We further validated this using qRT–PCR and found elevated levels of the inflammatory factor, IL-18 (Figure 6(b)).
Figure 5.
The antitumor effects of liensinine are associated with the MAPK signaling and NF-κB signaling pathways. (a and b) KEGG analysis of significantly different genes after liensinine treatment of FaDu cells.
MAPK: mitogen-activated protein kinase; NF-κB: nuclear factor kappa-light-chain-enhancer of activated B cells; KEGG: Kyoto Encyclopedia of Genes and Genomes.
Figure 6.
Liensinine exerts antitumor effects by activating RHOB to inhibit the MAPK signaling pathway. (a) Western blot detection of protein expression of RHOB and p-ERK in liensinine-treated FaDu cells followed by quantitative analysis. Data are presented as mean ± SD values, N = 3. ***p < 0.001, ****p < 0.0001 and (b) qRT–PCR to detect transcript expression levels of IL-18. Data are presented as mean ± SD values. **p < 0.01. MAPK: mitogen-activated protein kinase; qRT–PCR: quantitative reverse transcription polymerase chain reaction; p-ERK: phospho-extracellular signal-regulated kinase.
Taken together, we believe that liensinine activates RHOB and inhibits the downstream MAPK signaling pathway. At the same time, it activates the NF-κB signaling pathway to increase the level of downstream inflammatory factors and exerts a significant antitumor effect.
Discussion
Hypopharyngeal carcinoma is a subtype of HNSCC, a particularly aggressive cancer that originates in the hypopharynx (lower part of the throat). Although this cancer is relatively more rare than other cancers, it poses a significant public health challenge due to its poor prognosis and the complexity of its treatment.12,13 Global incidence and mortality rates for hypopharyngeal cancer vary widely across regions, reflecting differences in risk factors, health-care services, and early detection strategies. 14 It is characterized by a low 5-year survival rate and high rates of recurrence and metastasis. 15 It is critical to explore strategies to inhibit metastasis and improve the prognosis of patients with these cancers. In the current study, we identified a potential anticancer small molecule, liensinine. Treatment of hypopharyngeal cancer cells with liensinine showed that liensinine could effectively inhibit the growth of tumor cells and promote apoptosis. The results of RNA-seq showed that liensinine can activate RHOB and thus inhibit the MAPK signaling pathway, thereby playing an antitumor role.
Previous studies have documented liensinine in antitumor studies; however, the mechanism of action in hypopharyngeal cancer has not yet been demonstrated.9,16,17 Our study confirms that liensinine exerts the same antitumor effect in hypopharyngeal cancer. Liensinine inhibits tumor cell growth in a time-dependent and dose-dependent manner and promotes tumor cell apoptosis. Additionally, liensinine affects the proliferation and invasion of tumor cells by inhibiting the G1 phase of the cell cycle. This is consistent with the known anticancer potential of liensinine and previous findings on the role of liensinine in many types of tumors. 18
The mechanisms by which liensinine inhibits hypopharyngeal cancer are complex. In order to identify differentially expressed genes, transcriptome analysis using RNA-seq to analyze gene expression is becoming a more popular method for identifying new molecular biomarkers and underlying mechanisms. 19 In this context, RNA-seq is able to generate more novel and valuable information than microarrays at the transcriptome level and is therefore particularly useful in characterizing the harmful effects of chemicals. 20 In this study, gene expression patterns of liensinine-treated and control FaDu cells were analyzed via transcriptome sequencing, and 606 upregulated and 138 downregulated genes were identified. Among them, RHOB is highly enriched as a plausible gene. RhoB is a member of the Rho GTPase family, which has been implicated in the malignant progression of various cancer types. 21 Despite a high degree of sequence homology with RhoA and RhoC, RhoB is primarily associated with tumor suppressor functions, whereas RhoA and RhoC support oncogenic transformation of most malignant tumors. 22 Compared with those of all identified up-and down-regulated genes, the expression levels of RHOB, DDIT4, TXNIP, CHAC1, IFI27, and SLC7A11 were substantially increased, as shown by the transcriptome analysis based on RNA-seq. Our study is consistent with the fact that RHOB gene expression levels increased dose-dependently with liensinine. This suggests that liensinine suppresses tumor function by activating RHOB.
KEGG pathway enrichment analysis showed that the increase in RHOB in the liensinine group was mainly related to the MAPK signaling pathway. The MAPK pathway is involved in the proliferation and migration of multiple tumor types.23,24 ERK is a core component and key downstream effector molecule of the MAPK signaling pathway, and is associated with tumor cell invasion and metastasis. 25 We found that ERK protein phosphorylation levels were dose-dependently reduced with liensinine using western blot assay. This further demonstrates that liensinine’s antitumor effects are associated with the MAPK signaling pathway. In addition, we found that the NF-κB pathway was activated after liensinine treatment of tumor cells, which could lead to increased levels of intracellular inflammation. 11 qRT–PCR testing also confirmed this.
Despite the promising findings from our study, certain limitations should be acknowledged. Peng et al. found that the concentration of liensinine in rat plasma ranged from 5 to 700 ng/mL. 26 This plasma concentration is much lower than that we used in vitro, which may be due to liensinine’s rapid clearance and low bioavailability. There is currently no human data available; however, based on its physicochemical properties, human exposure is expected to be limited. This is a limitation of our study. Further investigation is needed to determine its clinical applicability, including its pharmacokinetics, bioavailability, and potential toxicity in humans. However, the findings of this research provide a foundation for future strategies such as nano-delivery, structural modification, and local administration (e.g. intratumoral injection).
Thus, this study comprehensively investigated the alterations in gene expression in FaDu cells after liensinine exposure, described the anticancer effects of liensinine in hypopharyngeal carcinoma, laid the foundation for further research on the molecular mechanisms of liensinine-mediated inhibition of tumorigenesis, and provided a possible basis for targeting oncogenic molecules and pathways such as the MAPK signaling pathway. Due to financial constraints, we did not delve into the changes in the immune microenvironment in humans induced by liensinine in this study. This aspect will be a key focus of our subsequent research.
Acknowledgments
We extend our gratitude to Zhejiang University School of Medicine and The Sir Run Run Shaw Hospital, Affiliated to Zhejiang University School of Medicine, for their support.
Author contributions: Chen Qin and Hong Pan primarily conceptualized the project, conducted data curation, performed formal analysis, carried out investigations, developed the methodology, managed the project, created visualizations, and wrote the original draft. Dan Zhang and Yinzhe Gai were mainly responsible for data curation and formal analysis. Mang Xiao contributed to the conceptualization as well as the review and editing of the manuscript.
The authors declare no conflicts of interest.
Funding: None.
ORCID iD: Mang Xiao https://orcid.org/0009-0009-2946-6772
Data availability
All data generated or analyzed during this study are included in this article. Further enquiries can be directed at the corresponding author.
Ethics statement
Since this research was not on human tissue/samples, we did not need ethics/review board approval. We have checked this with our review board and received their exemption.
Supplemental material
Supplemental material for this article is available online.
References
- 1.Gonçalves MWA, De Lima-Souza RA, Ribeiro-de-Assis MCF, et al. Prognostic implications across histological subtypes of head and neck squamous cell carcinoma: an update. J Stomatol Oral Maxillofac Surg 2025; 126: 102149. [DOI] [PubMed] [Google Scholar]
- 2.Schiappacassi M, Spizzo R, Polesel J, et al. Molecular profiling of head and neck squamous cell carcinomas in North-eastern Italy identifies possible tumour cell vulnerabilities. Transl Oncol 2025; 51: 102221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Mores AL, Bonfim-Alves CG, López RVM, et al. Prognostic factors in head and neck cancer: a retrospective cohort study of 3052 patients in Brazil. Oral Dis 2025; 31: 1133–1139. [DOI] [PubMed] [Google Scholar]
- 4.Nadal A, Cardesa A, Agaimy A, et al. Massive parallel sequencing of head and neck conventional squamous cell carcinomas: a comprehensive review. Virchows Arch 2024; 485: 965–976. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wu MC, Gao YH, Zhang C, et al. Liensinine and neferine exert neuroprotective effects via the autophagy pathway in transgenic Caenorhabditis elegans. BMC Complement Med Ther 2023; 23: 386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Jiang H, Zhu S, Wu B, et al. CDK2 and CDK4 targeted liensinine inhibits the growth of bladder cancer T24 cells. Chem Biol Interact 2023; 382: 110624. [DOI] [PubMed] [Google Scholar]
- 7.Wang C, Zou K, Diao Y, et al. Liensinine alleviates LPS-induced acute lung injury by blocking autophagic flux via PI3K/AKT/mTOR signaling pathway. Biomed Pharmacother 2023; 168: 115813. [DOI] [PubMed] [Google Scholar]
- 8.Jia P, Chen D, Zhu Y, et al. Liensinine improves AngII-induced vascular remodeling via MAPK/TGF-β1/Smad2/3 signaling. J Ethnopharmacol 2023; 317: 116768. [DOI] [PubMed] [Google Scholar]
- 9.Lin X, Lin T, Liu M, et al. Liensinine diperchlorate and artemisitene synergistically attenuate breast cancer progression through suppressing PI3K-AKT signaling and their efficiency in breast cancer patient-derived organoids. Biomed Pharmacother 2024; 176: 116871. [DOI] [PubMed] [Google Scholar]
- 10.Sharma BR, Gautam LN, Adhikari D, et al. A comprehensive review on chemical profiling of Nelumbo nucifera: potential for drug development. Phytother Res 2017; 31: 3–26. [DOI] [PubMed] [Google Scholar]
- 11.Huang Y, Li X, Xu S, et al. Polyvinyl chloride nanoplastics suppress homology-directed repair and promote oxidative stress to induce esophageal epithelial cellular senescence and cGAS-STING-mediated inflammation. Free Radic Biol Med 2025; 226: 288–301. [DOI] [PubMed] [Google Scholar]
- 12.Tie CW, Zhu JQ, Yu Z, et al. Revealing molecular and cellular heterogeneity in hypopharyngeal carcinogenesis through single-cell RNA and TCR/BCR sequencing. Front Immunol 2024; 15: 1310376. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Hu Y, He Z, Han B, et al. miR-107 Targets NSG1 to regulate hypopharyngeal squamous cell carcinoma progression through ERK pathway. Int J Mol Sci 2024; 25: 5961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Parsaei M, Sanjari Moghaddam H, Mazaheri P. The clinical utility of diffusion-weighted imaging in diagnosing and predicting treatment response of laryngeal and hypopharyngeal carcinoma: a systematic review and meta-analysis. Eur J Radiol 2024; 177: 111550. [DOI] [PubMed] [Google Scholar]
- 15.Katano A, Yamashita H, Saito Y, et al. The role of upfront neck dissection in definitive radiotherapy for locally advanced hypopharyngeal squamous cell carcinoma: a single-center retrospective analysis. Head Neck 2024; 46: 2815–2823. [DOI] [PubMed] [Google Scholar]
- 16.Zhu X, Bao W, Xie X, et al. Liensinine inhibits progression of intrahepatic cholangiocarcinoma by regulating TGF-β1/P-smad3 signaling through HIF-1a. Mol Carcinog 2024; 63: 772–784. [DOI] [PubMed] [Google Scholar]
- 17.Ma B, Shi S, Guo W, et al. Liensinine, a novel and food-derived compound, exerts potent antihepatoma efficacy via inhibiting the Kv10.1 channel. J Agric Food Chem 2024; 72: 4689–4702. [DOI] [PubMed] [Google Scholar]
- 18.Jia F, Liu Y, Dou X, et al. Liensinine inhibits osteosarcoma growth by ROS-mediated suppression of the JAK2/STAT3 signaling pathway. Oxid Med Cell Longev 2022; 2022: 8245614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Chen H, Li Q, Cheng P, et al. Identification and analysis of major latex protein (MLP) family genes in Rosa chinensis responsive to Botrytis cinerea infection by RNA-seq approaches. Front Plant Sci 2024; 15: 1511597. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.He H, Huang Y, Lu Y, et al. Effect of benzo[a]pyrene on proliferation and metastasis of oral squamous cell carcinoma cells: a transcriptome analysis based on RNA-seq. Environ Toxicol 2022; 37: 2589–2604. [DOI] [PubMed] [Google Scholar]
- 21.Akgun N, Halici Z, Cadirci E. Advances in understanding how RhoB regulates Akt inhibition efficacy in NSCLC. Curr Cancer Drug Targets 2025. [DOI] [PubMed] [Google Scholar]
- 22.Zaoui K, Duhamel S. RhoB as a tumor suppressor: it’s all about localization. Eur J Cell Biol 2023; 102: 151313. [DOI] [PubMed] [Google Scholar]
- 23.Dai Q, Yao X, Zhang Y, et al. CTSG is a prognostic marker involved in immune infiltration and inhibits tumor progression though the MAPK signaling pathway in non-small cell lung cancer. J Cancer Res Clin Oncol 2024; 151: 21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Basheer I, Wang H, Li G, et al. β-caryophyllene sensitizes hepatocellular carcinoma cells to chemotherapeutics and inhibits cell malignancy through targeting MAPK signaling pathway. Front Pharmacol 2024; 15: 1492670. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Guo Z, Yu P, Yu L, et al. Exon 13 skipping mediated by HNRNPL facilitates truncated SLK-induced metastasis in hepatocellular carcinoma. Biochem Pharmacol 2025; 242: 117390. [DOI] [PubMed] [Google Scholar]
- 26.Peng LS, Jiang XY, Li ZX, et al. A simple U-HPLC-MS/MS method for the determination of liensinine and isoliensinine in rat plasma. J Chromatogr B Analyt Technol Biomed Life Sci 2015; 991: 29–33. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All data generated or analyzed during this study are included in this article. Further enquiries can be directed at the corresponding author.