Protocol to identify the signaling network of nucleotide second messengers in Shigella sonnei

Summary

Here, we present a protocol to detect the signaling network composed of cyclic AMP (cAMP) and cyclic di-GMP (c-di-GMP) signaling systems in Shigella sonnei. Technical assays include microscale thermophoresis (MST), quantitative reverse-transcription PCR (RT-qPCR), ultra-high-performance liquid chromatography-mass spectrometry (LC-MS), electrophoretic mobility shift assay (EMSA), bacterial adenylate cyclase two-hybrid (BACTH) assay, and molecular docking.

For complete details on the use and execution of this protocol, please refer to Wang et al.¹

Graphical abstract

Highlights

• •Instructions for identifying the receptor of cAMP signal
• •Procedures for determining the regulatory effect of cAMP on c-di-GMP
• •Steps to reveal interactions between the receptor CRP and the synthase YdeH

Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics.

Here, we present a protocol to detect the signaling network composed of cyclic AMP (cAMP) and cyclic di-GMP (c-di-GMP) signaling systems in Shigella sonnei. Technical assays include microscale thermophoresis (MST), quantitative reverse-transcription PCR (RT-qPCR), ultra-high-performance liquid chromatography-mass spectrometry (LC-MS), electrophoretic mobility shift assay (EMSA), bacterial adenylate cyclase two-hybrid (BACTH) assay, and molecular docking.

Before you begin

Bacterial nucleotide second messengers, such as cAMP and c-di-GMP, are intracellular signaling molecules that help bacteria sense and adapt to environmental changes by modulating diverse cellular processes. Acting as molecular “switches,” they control specific pathways and coordinate responses including motility, biofilm formation, and virulence.^2,3,4,5 Shigella sonnei, which infects the human intestine, is exposed to bile salts during gut colonization and adapts by leveraging complex signaling pathways.⁶ Our recent research showed that the two-component system EvgS/EvgA in S. sonnei transmits extracellular bile salt signals to intracellular cAMP and c-di-GMP pathways, thereby regulating the colonization and cytotoxicity.¹ To explore how the cAMP signaling system regulates c-di-GMP biosynthesis, we developed experimental protocols using the S. sonnei strain CMCC51592 as a model. CRP (cAMP receptor protein) is a global transcriptional regulator that, upon binding cAMP, forms an active complex capable of recognizing promoter DNA and regulating numerous genes. In our previous study,¹ the cAMP–CRP complex serves as a key link between cAMP signaling and c-di-GMP metabolism, highlighting its central role in the regulatory crosstalk that shapes bacterial physiology under changing environmental conditions. We first confirmed that the cAMP–CRP complex activates ydeH transcription, a gene encoding c-di-GMP synthase, through MST, RT–qPCR, and EMSA. We then quantified intracellular c-di-GMP in the wild-type, cAMP-deficient, and CRP-deficient strains by LC–MS to assess the impact of cAMP signaling on c-di-GMP accumulation. Finally, the direct binding between CRP and YdeH was identified by using the bacterial adenylate cyclase two-hybrid (BACTH) assay, which is based on the reconstitution of cAMP production in Escherichia coli BTH101 upon protein interaction. Mutational analyses further validated this interaction and revealed that it enhances both CRP’s regulatory function and YdeH’s enzymatic activity. Collectively, our results showed that CRP not only binds to the ydeH promoter to increase transcription but also interacts with YdeH protein to increase the regulatory ability of CRP and promotes the enzymatic activity of YdeH, thereby increasing the intracellular c-di-GMP concentration. This multilevel regulation forms a hierarchical cascade that links cAMP signaling to c-di-GMP metabolism and signaling in S. sonnei. The entire protocol can be completed within approximately 2–3 months.

Innovation

This protocol employs a three-tiered experimental strategy to elucidate the regulatory influence of cAMP on c-di-GMP signaling. At the transcriptional level, MST, RT–qPCR, and EMSA are used to demonstrate the modulation of the cAMP–CRP complex on the expression of the c-di-GMP synthase YdeH. At the protein–protein interaction level, MST, BACTH, and molecular docking confirm the direct binding between CRP and YdeH, and identify key amino acid residues at the interaction interface, revealing potential structural consequences of this association. At the enzymatic activity level, biochemical assays quantify the effect of CRP binding on YdeH catalytic activity, thereby linking molecular interaction to functional output. The innovation of this workflow lies in its hierarchical integration of transcriptional regulation, structural interaction mapping, and enzymatic activity assessment within a single coherent framework. This multi-layered approach enables systematic dissection of the cAMP–c-di-GMP regulatory cascade, bridging gene expression changes to molecular binding events and catalytic outcomes. While optimized for S. sonnei, the strategy is broadly applicable to diverse bacterial second messenger networks, offering a versatile and conceptually novel platform for comprehensive analysis of nucleotide-based signaling systems.

Key resources table

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Bacterial strains
Shigella sonnei CMCC51592	Lab collection	N/A
Δcrp	(Wang et al,1 2025)	N/A
Δcrp(crp)	(Wang et al,1 2025)	N/A
Subcloning Efficiency™ E. coli DH5α	Thermo Scientific	Cat#18265017
One Shot™ E. coli BL21 (DE3)	Thermo Scientific	Cat#EC0114
Chemicals, peptides, and recombinant proteins
Tryptone	Oxoid	Cat#LP0042B
Yeast extract	Oxoid	Cat#PL0021
NaCl	Macklin	Cat#S805275
Agar	Macklin	Cat#A800728
KCl	Macklin	Cat#P816348
MgCl2	Macklin	Cat#M813763
Ampicillin	Macklin	Cat# A830931
Kanamycin	Macklin	Cat#K885955
X-gal	Solarbio	Cat#X8050
2 × T5 Super PCR Mix	Tsinekg	Cat#TSE005
1.1 × S4 Fidelity PCR Mix	Genesand	Cat#SF212
HisTrap affinity columns	Smart-lifesciences	Cat#SA035010
TEV protease	Beyotime	Cat#P2307
BSA protein	Solarbio	Cat#PC001
50 × TAE buffer	Solarbio	Cat#T1060
10 × TE buffer	HARVEYBIO	Cat#SR5326
PBS buffer	Macklin	Cat#917808
Tris-HCl buffer(pH 8.0)	PERFEMIKER	Cat#PM12638
5 × TBE buffer	Solarbio	Cat#T1050
Triton X-100	Sigma	Cat#MFCD00128254
Formaldehyde	Sigma	Cat#252549
Bacterial Lysis buffer	Sangon	Cat#C500003
Glycine	Macklin	Cat#810676
Complete proteinase inhibitor cocktail	Roche	Cat#4693116001
SDS	Lablead	Cat#L5751
EDTA	Solarbio	Cat#E8040
TRIzol	Thermo	Cat#15596018
Mini-protease inhibitor cocktail	Roche	Cat#11836170001
Proteinase K	Macklin	Cat#39450-01-6
IPTG	Macklin	Cat#I811719
Glucose	Sigma-Aldrich	Cat#G6152
30% Bis-acrylamide	PPLYGEN	Cat#B1000
10% Ammonium persulfate	HZBIO	Cat#HZ-53009
Glycerol	Macklin	Cat#G810575
5′-GTP disodium salt	MCE	Cat# HY-W010737
cAMP	MedChemExpress	Cat#HY-B1511
c-di-GMP	InvivoGen	Cat# tlrl-nacdg
DMSO	Sigma-Aldrich	Cat#D5879
Critical commercial assays
ClonExpress II One Step Cloning Kit	Vazyme	Cat#C112-02
Plasmid mini kit	OMEGA	Cat#D6945
Genomic DNA extraction kit	OMEGA	Cat#D3350-01
E.Z.N.A® Gel Extraction Kit	OMEGA	Cat#D2500
LightShift Chemiluminescent EMSA Kit	Thermo Fisher	Cat#20148
Monolith NT.115 Protein Labeling Kit	Nano Temper	Cat#MO-L018
Biotin 3′ End DNA Labeling Kit	KeyGEN BioTECH	Cat#KGS132
Oligonucleotides
ydeH-EMSA-F: AAATAAATTAGCCTGATGGCC	(Wang et al,1 2025)	N/A
ydeH-EMSA-R: AAATAAATTAGCCTGATGGCC	(Wang et al,1 2025)	N/A
crp-P28-F: CAGCAAATGGGTCGC GGATCCATGGTGCTTGGCAAACCGC	(Wang et al1 2025)	N/A
crp-P28-R: TTGTCGACGGAGCTC GAATTCTTAACGAGAGCCGTAAACGACG	(Wang et al,1 2025)	N/A
ydeH-RT-qPCR-F: GGATA TTGACCGATTTAAATTGG	(Wang et al,1 2025)	N/A
ydeH-RT-qPCR-R: CATTA GCCGCTTTAACAATAA	(Wang et al,1 2025)	N/A
T25-ydeH-F: GCTGCAGGGTCGACTCTA ATGATCAAGAAGACAACGGAA	(Wang et al,1 2025)	N/A
T25-ydeH-R: CTTAGGTACCCGGGGA TCTTAAACTCGGTTAATCACATTTTGTT	(Wang et al,1 2025)	N/A
ydeH-T25-F: CAGGTCGACTCTAGAGGATC CCATGATCAAGAAGACAACGGAA	(Wang et al,1 2025)	N/A
ydeH-T25-R: TGCTGCATGGTCATTGAATTC GAAACTCGGTTAATCACATTTTGTT	(Wang et al,1 2025)	N/A
crp-KO-F: CTGGCTCTGGAGAAAGCTT ATAACAGAGGATAACCGCGCGTGTA GGCTGGAGCTGCTTC	(Wang et al,1 2025)	N/A
crp-KO-R: AAATGGCGCGCT ACCAGGTAACGCGCCACTC CGACGGGAATGGGAATTAGCCATGGTCC	(Wang et al,1 2025)	N/A
crp-pUC-F: ATGATTACGAATTC GATGGTGCTTGGCAAACCGC	(Wang et al,1 2025)	N/A
crp-pUC-R: GACTCTAGAGGATCCT TAACGAGAGCCGTAAACGACG	(Wang et al,1 2025)	N/A
Single-point mutation primers
ydeHK17A-T25-F: AATCTCAATGC AGCTATCGATGCCCACTAC	(Wang et al,1 2025)	N/A
ydeHK17A-T25-R: ATCGATAGCTGC ATTGAGATTTAACAAGAT	(Wang et al,1 2025)	N/A
ydeHQ24A-T25-F: CACTACGCATGG CTGGTGAGTATGTTTCAC	(Wang et al,1 2025)	N/A
ydeHQ24A-T25-R: GCTATCGATGCC CACTACGCATGGCTGGTG	(Wang et al,1 2025)	N/A
ydeHF54A-T25-F: CTGTGCCAGGC GGGTCGGTGGATTGATCAT	(Wang et al,1 2025)	N/A
ydeHF54A-T25-RCCACCGACCC GCCTGGCACAGTCCATAAGA	(Wang et al,1 2025)	N/A
ydeHP70A-T25-F: GATGAATTAGCA TACGTTCGGCTAATGGAT	(Wang et al,1 2025)	N/A
ydeHP70A-T25-R: CCGAACGTATG CTAATTCATCGTTATCGAG	(Wang et al,1 2025)	N/A
ydeHH83A-T25-F: CAACATATGGC AAACTGTGGTCGGGAATTA	(Wang et al,1 2025)	N/A
ydeHH83A-T25-R: ACCACAGTTTGC CATATGTTGATGGGCAGA	(Wang et al,1 2025)	N/A
ydeHD100A-T25-F: CACTGGCAGGC AGCGCATTTCGACGCCTTT	(Wang et al,1 2025)	N/A
ydeHD100A-T25-R: GAAATGCGCTGC CTGCCAGTGATTTTCAAC	(Wang et al,1 2025)	N/A
ydeHL134A-T25-F: ATGGATGTTGCA ACGGGATTGCCGGGGCGT	(Wang et al,1 2025)	N/A
ydeHL134A-T25-R: CAATCCCGTTGC AACATCCATATTGCTACG	(Wang et al,1 2025)	N/A
ydeHV183A-T25-F: ATCGGCGATGCA GTATTACGCACCCTGGCA	(Wang et al,1 2025)	N/A
ydeHV183A-T25-R: GCGTAATACTGC ATCGCCGATTAAATGCCC	(Wang et al,1 2025)	N/A
ydeHE208A-T25-F: TACGGGGGCGC AGAATTTATCATTATTGTT	(Wang et al,1 2025)	N/A
ydeHE208A-T25-R: GATAAATTCTG CGCCCCCGTAGCGATAAAC	(Wang et al,1 2025)	N/A
ydeHD234A-T25-F: CAGTTAGTCGCA AACCATGCCATCACACAT	(Wang et al,1 2025)	N/A
ydeHD234A-T25-R: GATGGCATG GTTTGCGACTAACTGGCAAAT	(Wang et al,1 2025)	N/A
Recombinant DNA
Plasmids: see Table S3 (Wang et al,1 2025)	(Wang et al,1 2025)	N/A
Software and algorithms
AutoDock	AutoDock Tools	https://autodock.scripps.edu/
PyMOL	PyMOL 3.0	https://pymol.org/
ImageJ	ImageJ	https://imagej.net/ij/
ClusPro	ClusPro	https://cluspro.org/tut_dock.php
Other
PCR instrument	BIO-RAD	T100
Real-time fluorescence quantitative PCR instrument	ThermoFisher Scientific	QuantStudio 5
Electroporation instrument	BIO-RAD	Gene Pulser Xcell
Electrophoresis apparatus	BIO-RAD	Mini-PROTEAN Tetra
UHPLC–MS/MS	Shimadzu	LCMS-8060
Chromatographic column	Waters	ACQUITY UPLC® HSS T3 1.8 μm column
UV Crosslinker	Ybscience	YB120931
Chemiluminescence Imager	UVITEC	Alliance Q9
Monolith NT.115 Premium Capillaries	NanoTemper	MO-K025
MST Trac Measurement machine	NanoTemper	Monolith NT.115

Materials and equipment

LB medium

Reagent	Final concentration	Amount
Tryptone	N/A	10.0 g
Yeast extract	N/A	5.0 g
NaCl	N/A	10.0 g
Agar	N/A	15.0 g
Total	N/A	1000 mL

Note: Dissolve in 1 L ddH₂O and adjust the pH to 7.2. Add 15 g/L agar for solidified medium and autoclave. Prepare before use.

5% Polyacrylamide gel

Component	Final concentration	Amount
ddH2O	N/A	6.73 mL
5 × TBE buffer	N/A	1 mL
30% Bis-acrylamide	N/A	1.7 mL
10% Ammonium persulfate	N/A	0.07 mL
Glycerol	N/A	0.5 mL
TEMED	N/A	0.005 mL

Note: Store at 4 °C. Stable for 1 week.

Step-by-step method details

Identification of cAMP receptor proteins in S. sonnei

Timing: 1 week

BLAST-P analysis revealed that SSON_RS19255 is a CRP that shares 100% similarity with the CRP of E. coli K12. To investigate whether SSON_RS19255 binds to the cAMP signal, the following steps describe an MST analysis approach: fluorescently labelling soluble proteins and measuring fluorescence intensity to study protein–ligand interactions (Figure 1).

• 1.
  MST assay.

  • a.
    Label the target protein by following the protocol outlined in the Monolith MO-L018 Protein Labelling Kit user manual.

    Note: The protocols for the expression and purification of the SSON_RS19255(CRP) protein adhere to the methodologies outlined in our previous publication.⁷ Primers: crp-P28-F and crp-P28-R.

  • b.
    Dilute the unlabelled cAMP signal ligand to a stock concentration in binding buffer.

    Note: Binding buffers such as PBS or Tris-HCl can be selected.

  • c.
    Conduct a two-fold serial dilution of the cAMP ligand stock solution, prepared in binding buffer, using the labelled target protein at a concentration of 200 nM.
  • d.
    Dilute the prepared stock solution using the binding buffer to achieve the desired concentrations. Carefully aliquot the diluted solution into a total of 16 tubes, ensuring accurate measurement and consistent handling.

    Note: Record the concentration of the dye in each tube meticulously at every dilution step for precise documentation and reproducibility.

  • e.
    Mix the samples thoroughly by pipetting up and down several times to ensure homogeneity. Spin down the samples for 30 s using a tabletop centrifuge to remove any air bubbles or ensure proper settling.
  • f.
    Insert the capillary into the tube and carefully load the samples into MST capillaries by holding them at a 45° angle to avoid spillage or contamination.
  • g.
    Place the capillaries into the MST instrument and perform a capillary scan to determine the baseline fluorescence levels of the capillaries.
  • h.
    Inspect the fluorescence peaks using the MST instrument to confirm that they exhibit a uniform shape and consistent height, as specified in the guidelines provided in the MST instrument manual.
  • i.
    Ensure that any deviations are addressed before proceeding with further analysis.

Figure 1.

Graphical depiction confirming the interaction between cAMP and CRP

Dilution series of cAMP mixed with an equal amount of fluorescently labelled protein (CRP) in 0.2 mL Eppendorf tubes. The mixed samples from the tubes were transferred to the capillaries for analysis using MST. In this experimental procedure, a portion of the sample within each capillary is exposed to an infrared laser, and the subsequent molecular movement is monitored using fluorescence detection. The figure is reprinted with permission from Wang et al., 2025.¹ Created with BioRender.

Generation of mutant and complement strains

Timing: 3 weeks

Timing: 2 weeks (for step 2)

Timing: 1 week (for step 3)

This section outlines the construction of markerless gene deletion mutants in S. sonnei using the λ Red recombination system (Figure 2), followed by the generation of complement strains via plasmid-based expression.

• 2.
  Construction of markerless gene deletion mutants.

  • a.
    Prepare electrocompetent wild-type S. sonnei cells by growing to OD₆₀₀ = 0.4–0.6, washing with ice-cold 10% glycerol, and aliquoting for storage at −80 °C.
  • b.
    Introduce the pKD46 plasmid into competent cells by electroporation, recover at 30 °C for 2 h, and select on LB + ampicillin (100 μg/mL) agar medium at 30 °C. Confirm transformation by PCR to generate the ss-pKD46 strain.
  • c.
    Prepare recombination-ready competent cells by growing ss-pKD46 cells to OD₆₀₀ = 0.4–0.6 in the presence of 10 mM L-arabinose, then wash and concentrate the cells as described in step a.
  • d.
    Generate the targeting fragment by amplifying the chloramphenicol or kanamycin resistance gene from pKD3 or pKD4 using primers with 39–59 bp homology arms specific to crp, followed by gel purification.
  • e.
    Electroporate the targeting fragment into induced competent cells, plate on LB containing the respective antibiotic (chloramphenicol or kanamycin at 50 μg/mL), and incubate at 37 °C for 12 h.

    Note: Screen colonies by PCR and sequencing to confirm gene replacement.

  • f.
    Cure the pKD46 plasmid by streaking mutants on LB without antibiotics and incubating at 42 °C for 12 h.
  • g.
    Identify cured clones by ampicillin sensitivity and the absence of pKD46 via PCR.
  • h.
    Eliminate the antibiotic resistance marker by introducing pCP20 into cured mutants, selecting on ampicillin at 30 °C, then streaking colonies at 42 °C on antibiotic-free LB.
  • i.
    Verify markerless deletion using an antibiotic sensitivity assay and PCR.
• 3.
  Construction of complement strains.

  • a.
    Amplify the coding sequence of crp from wild-type genomic DNA and clone it into the pUC18 shuttle vector.
  • b.
    Electroporate the resulting complementation plasmid into the corresponding deletion mutant and select on LB + ampicillin (100 μg/mL) agar medium.
  • c.
    Confirm complementation by detecting restored gene expression using RT–qPCR.

Note: Strains carrying pKD46 or pCP20 must be maintained at 30 °C, whereas plasmid curing requires incubation at 42 °C. All mutant and complement strains should be validated via PCR and/or sequencing before use.

Figure 2.

Overview of the pKD46-Red-mediated scarless deletion of the target gene in S. sonnei

① The pKD46 plasmid (encoding Red recombinase) is pre-transformed into S. sonnei and cells are grown at 30 °C to competence. ② A PCR product containing antibiotic-resistance marker flanked by two FRT sites is amplified from pKD3/pKD4. ③ The targeting fragment is introduced by electroporation; Red-driven homologous recombination and antibiotic selection yield primary recombinants. ④ Cultivation at 42 °C cures the temperature-sensitive pKD46. ⑤ Introduction of the CP20 plasmid (encoding FLP recombinase) excises the resistance cassette between the FRT sites; a second 42 °C heat step eliminates CP20, leaving a clean, marker-free deletion mutant. H1/H2, homology extensions; P1/P2, primer sites; FRT, FLP recognition target. The figure is reprinted with permission from Wang et al., 2025.¹ Created with BioRender.

Confirmation of the transcriptional regulation on ydeH by cAMP signaling

Timing: 1 week

Timing: 2–3 days (for step 4)

Timing: 1–2 days (for step 5)

Timing: 2 days (for step 6)

Both cAMP and c-di-GMP can synergistically control the physiological functions of bacteria.⁸ The results of the above study revealed that the intracellular levels of c-di-GMP in the cAMP signaling system deletion mutants were lower than those in the wild-type strain.¹ The subsequent steps will investigate the specific regulatory mechanisms by which the cAMP signaling system modulates the c-di-GMP signaling pathway (Figure 3).

• 4.
  RNA isolation and purification.

  • a.
    Incubate the S. sonnei CMCC51592 cells in LB medium at 37 °C to an OD₆₀₀ of 0.8. Transfer 1 mL of culture to a microcentrifuge tube, centrifuge at 14,000 × g for 10 min, and discard the supernatant.
  • b.
    Add 100 μL of freshly prepared TE buffer containing 4 mg/mL lysozyme to the bacterial pellet at 25 °C for 5 min.
  • c.
    Add 1 mL TRIzol and vortex. Add 0.2 mL chloroform, pipette until clear, incubate for 5 min, then centrifuge at 10,000 × g for 10 min at 4 °C.

    Note: The sample separates into three layers: a clear aqueous phase (top), an intermediate layer, and a pink organic phase (bottom). RNA is concentrated in the aqueous phase, which is roughly 50% of the volume of the TRIzol reagent used.

  • d.
    Transfer the aqueous phase to a new tube, add 0.5 mL isopropyl alcohol per 1 mL TRIzol, mix, incubate for 10 min, centrifuge at 10,000 × g for 10 min at 4 °C, and discard the supernatant. A gel-like precipitate will form.
  • e.
    Add 1 mL of 75% ethanol (prepared with DEPC-treated water) per 1 mL of TRIzol used and vortex thoroughly.
  • f.
    Centrifuge at 7500 × g for 5 min at 4 °C, discard the supernatant to remove excess salt, and air-dry the precipitate at 25 °C for about 10 min.

    Note: Do not overdry.

  • g.
    Dissolve the precipitate in 50–100 μL of nuclease-free ddH₂O. Incubate at 55–60 °C for 10 min and store the sample at −80 °C for long-term use.
  • h.
    Determine the quality and integrity of each sample using a NanoDrop spectrophotometer (Thermo Scientific).
• 5.
  RT–qPCR.

  • a.
    Perform the reverse transcription reaction using HiScript III RT SuperMix (Vazyme Biotech Co., Ltd.).
  • b.
    Prepare the following mixture in an RNase-free centrifuge tube:

    4× gDNA wiper mix	4 μL
    Total RNA	1 μg
    RNase-free ddH2O	to 16 μL

    Mix thoroughly by pipetting. Perform PCR at 42 °C for 2 min.
  • c.
    Add 4 μL of 5 × HiScript III qRT SuperMix directly to the reaction tube from the previous step. Gently mix by pipetting up and down.
  • d.
    Perform reverse transcription under the following conditions: 37 °C for 15 min, followed by 85 °C for 5 sec.

    Note: The product is ready for immediate qPCR use or can be stored at −20 °C for 6 months. For extended storage, aliquot and store at −80 °C. cDNA samples should be protected from repeated freeze-thawing.

  • e.
    Perform RT–qPCR using ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme Biotech Co., Ltd.).
  • f.
    Prepare the following mixture in qPCR tubes:

    Reagent	Final concentration	Amount
    2× ChamQ Universal SYBR qPCR Master Mix	N/A	10.0 μL
    Primer: ydeH-RT-qPCR-F (10 μM)	0.2 μM	0.4 μL
    Primer: ydeH-RT-qPCR-R (10 μM)	0.2 μM	0.4 μL
    Template DNA/Cdna (200 ng/μL)	12 ng/μL	1.2 μL
    ddH2O	N/A	8.0 μL
    Total	N/A	20 μL

  • g.
    Perform qPCR according to the following conditions.

Stage 1	Predenaturation	Reps: 1	95 °C	30 s
Stage 2	Circular reaction	Reps: 40	95 °C	10 s
			60 °C	30 s
Stage 3	Dissociation Curve	Reps: 1	95 °C	15 s
			60 °C	60 s
			95 °C	15 s

Figure 3.

Graphical depiction illustrating regulation on the transcription of a c-di-GMP synthase encoding gene by the cAMP signaling system

(Top) The S. sonnei CMCC51592 wild-type and crp mutant strains were incubated in LB medium at 37 °C until the OD₆₀₀ was 0.8. Then, 1.0 mL of the cultured bacterial suspension was transferred into a new 1.5 mL microcentrifuge tube. Total RNA was extracted, and cDNA was synthesized via reverse transcription. Primers were designed based on genes encoding key c-di-GMP metabolic enzymes, and RT–qPCR was performed to determine the effect of crp deletion on the expression of these genes. (Bottom) Biotin was used as a marker to label the purified promoter DNA fragment at its 3′ end to create a probe sample. DNA–protein (with or without cAMP) binding reactions were prepared by coincubating biotin-labelled probes with proteins. The DNA–protein complexes were separated from the unbound probes using a 5% polyacrylamide gel. Biotin-labelled probes with different mobilities were detected on the membrane. Figure reprinted with permission from Wang et al., 2025.¹ Created with BioRender.

• 6.
  Electrophoretic Mobility Shift Assay.

  • a.
    Prepare the 5% polymerization gel as described in materials and equipment.
  • b.
    Carefully remove the comb from the gel and insert the gel into the vertical electrophoresis apparatus.

    Note: Ensure that the running buffer (0.5 × TBE buffer) is added to fully fill both the upper and lower buffer reservoirs before proceeding.

  • c.
    Begin pre-electrophoresis at a voltage of approximately 80 V.

    Note: If noticeable heating of the gel occurs, lower the voltage or place the apparatus in an ice bath to prevent overheating.

  • d.
    Use S. sonnei CMCC51592 genomic DNA as the template. Perform PCR to amplify the promoter fragment of ydeH using primers ydeH-EMSA-F and ydeH-EMSA-R.
  • e.
    Recover and purify the PCR products using an appropriate purification method.

    CRITICAL: Once purified, proceed with sequencing to verify the accuracy of the amplified fragments.

  • f.
    Label the PCR products at the 3′ end with biotin according to the instructions provided by the manufacturer.

    Note: Ensure all steps are performed accurately to achieve effective labeling.

  • g.
    Use the Thermo Fisher LightShift Chemiluminescent EMSA Kit (20148) to assess protein binding to the promoter region of the target gene.

    CRITICAL: To ensure a final DNA concentration of 10 ng/μL, add 2 μL of biotin-labeled double-stranded DNA to each group. The final volume of each reaction is 10 μL. The experimental setup should consist of two negative controls (one without added protein and another with 50 μM BSA), three to four experimental sample groups, and one group containing a cold competition probe.

    Note: Supplement the experimental groups with 5 μM or 10 μM of the test protein. Add cAMP at concentrations of 0, 1, 10, or 100 μM to the reaction system. For the cold competition probe group, include 10 μM of the test protein along with a 50-fold excess of unlabeled DNA fragments. Mix all components with binding buffer and ddH₂O, and incubate the reaction mixture at 25 °C for 20 min.

  • h.
    Add 5 μL of loading buffer to each sample and load them into the designated wells of a 5% nondenaturing gel. Run the gel in 0.5 × TBE buffer at 110 V for 1.5 h.
  • i.
    Transfer the 5% nondenaturing gel onto a positively charged nylon membrane using the semidry transfer method at 300 mA for 0.5 h.
  • j.
    Immediately proceed with UV crosslinking at an energy intensity of 120 mJ/cm² for 45–60 s to immobilize the samples onto the membrane.
  • k.
    Use a biotin-luminescence detection kit to identify the biotin-labeled probe on the membrane, following the protocol outlined in the instruction manual. Then, visualize the bands using a chemiluminescence imaging system.

Effect of cAMP signaling on intracellular c-di-GMP levels

Timing: 1 week

Timing: 2 days (for step 7)

Timing: 3–4 days (for step 8)

This procedure evaluates how the deletion of crp affects the intracellular c-di-GMP concentration in S. sonnei using ethanol extraction followed by UPLC–MS/MS quantification.

• 7.
  Extraction of intracellular c-di-GMP.

  • a.
    Grow S. sonnei strains in 1 L LB medium at 37 °C to OD₆₀₀= 2.0.
  • b.
    Collect cells by centrifugation (3,000 × g, 5 min, 4 °C). Discard the supernatant and wash the pellet twice with ice-cold PBS.
  • c.
    Resuspend cells in minimal prechilled PBS and lyse by boiling for 5 min.
  • d.
    Add ice-cold ethanol to 65% final concentration, vortex vigorously, and centrifuge at 12,000 × g for 2 min at 4 °C.
  • e.
    Repeat extraction three times and combine supernatants.
  • f.
    Dry the pooled extract using a rotary evaporator under reduced pressure and store at −80 °C until analysis.
• 8.
  Quantitative analysis of c-di-GMP.

  • a.
    Dissolve the dried extract in chromatographic-grade methanol, filter through a 0.22 μm organic membrane, and collect the filtrate for injection.
  • b.
    Perform the quantitative analyses on a Shimadzu LCMS-8060 instrument.
  • c.
    Use an Waters ACQUITY UPLC® HSS T3 1.8 μm column maintained at 40 °C with a flow rate of 0.4 mL/min, employ mobile phase A (0.01% formic acid in water) and mobile phase B (0.01% formic acid in methanol) with the following gradient program: 0–10 min: 35% to 100% B; 10–13 min: 100% B; 13–13.1 min: 100% to 35% B; and 13.1–15 min: 35% B (re-equilibration). Use an injection volume of 1 μL.
  • d.
    Perform electrospray ionization (ESI) in negative-ion mode. Capillary voltage: 2.0 kV; ion source temperature: 120 °C; desolvation temperature: 350 °C; nebulizing gas (N₂) flow rate: 50 L/h; desolvation gas flow rate: 600 L/h. Monitor the transition m/z 691 → 152 specific to c-di-GMP.
  • e.
    Dissolve purified extracts in deuterated methanol and filter through a 0.22 μm organic membrane.
  • f.
    Purchase an authentic c-di-GMP standard and analyse it under identical conditions to construct a calibration curve for absolute quantification.

Note: A high-purity c-di-GMP standard was purchased and analyzed under the same UHPLC–MS/MS conditions as the samples. The signal peak area (Y) corresponding to each standard concentration (X, μM) was recorded. A plot of peak area (Y) versus standard concentration (X) was generated, and linear regression was performed to obtain the calibration curve, which was subsequently used for absolute quantification of c-di-GMP in the samples.

Interactions between CRP and YdeH identified by the BACTH system and enzyme activity assay

Timing: 2 weeks

Timing: 2–4 days (for step 9)

Timing: 2–4 days (for step 10)

Timing: 2 days (for step 11)

Timing: 3–5 days (for step 12)

The BACTH system is a powerful genetic technique for detecting protein–protein interactions in vivo. In this system, two proteins of interest are fused to two complementary, nonfunctional fragments (T25 and T18) of an adenylate cyclase. If the proteins interact, they bring the T25 and T18 fragments into proximity, reconstituting enzyme activity. This results in the production of cAMP, which triggers the expression of a reporter gene like lacZ, making the interaction visible through a colorimetric phenotype like blue colonies on indicator plates, which activates the expression of a reporter gene such as lacZ, allowing the interaction to be visualized by a colorimetric phenotype, such as blue colonies on indicator plates⁹ (Figure 4).

• 9.
  Construction of fusion plasmids.

  • a.
    Design appropriate primers to amplify the full open reading frame (ORF) of crp and ydeH from the genomic DNA of S. sonnei.

    • i.
      For C-terminal fusions (e.g., Protein-T25), the reverse primer was designed to omit the native stop codon of the target gene, allowing in-frame fusion with the downstream T25 coding sequence. The reference primers are ydeH-T25-F and ydeH-T25-R.
    • ii.
      For N-terminal fusions (e.g., T25-Protein), the reverse primer retained the native stop codon, ensuring proper termination of translation after the target protein. The reference primers are T25-ydeH-F and T25-ydeH-R.
  • b.
    Amplify the target genes (crp and ydeH) using a high-fidelity DNA polymerase to minimize PCR-induced mutations.
  • c.
    Digest the PCR products and the corresponding vectors (e.g., pKNT25, pUT18C) with the chosen restriction enzymes or prepare them for ligation-independent cloning. Ligate the inserts into the linearized vectors.
  • d.
    Transform the ligation products into the cloning strain E. coli DH5α via heat shock.
  • e.
    Place the transformed cells on LB agar plates that with the proper antibiotic (kanamycin for the pKNT25 backbone; ampicillin for the pUT18C backbone).
  • f.
    Use colony PCR to screen for positive clones and confirm the correct insertion and reading frame by Sanger sequencing.
  • g.
    Prepare high-quality plasmid DNA from sequence-verified clones. Quantify the DNA concentration and store aliquots at −20 °C.
  • h.
    Co-transform the plasmids YdeH-T25 and T18-CRP into electrocompetent BTH101 cells via electroporation. After transformation, immediately add LB medium to the transformants.
  • i.
    Incubate the culture at 30 °C for 1.5–2 h with shaking at 110 rpm to allow for the expression of antibiotic resistance genes.

    Note: Incubation at 30 °C promotes the proper folding of many fusion proteins and reduces the likelihood of aggregation, thereby minimizing false positives and negatives.

  • j.
    Plate 50–100 μL of the recovered culture onto LB agar plates containing both selective antibiotics (e.g., 50 μg/mL kanamycin and 100 μg/mL ampicillin).
  • k.
    Incubate the plates at 30 °C for 24–48 h until colonies are visible.
  • l.
    Pick at least three independent colonies for each plasmid pair. Confirm the presence of both plasmids by colony PCR using vector-specific primers or by plasmid miniprep followed by restriction digest.

    Note: Essential Controls for Co-transformation:

    • i.
      Positive Control: Co-transform T25-zip + T18-zip plasmids.
    • ii.
      Negative Controls: Co-transform each fusion plasmid with its corresponding empty vector partner (T25-YdeH + pUT18C; pKNT25 + T18-CRP; pKNT25 + pUT18C).
• 10.
  Qualitative screening on indicator plates.

  • a.
    Prepare LB agar medium and autoclave it. Cool the medium to approximately 50–55 °C.
  • b.
    Add the selective antibiotics (kanamycin and ampicillin), IPTG (final concentration of 0.5 mM), and X-Gal (final concentration of 40 μg/mL).
  • c.
    Pour the plates and allow them to solidify in a sterile environment.
  • d.
    Inoculate single colonies of each co-transformant (test pairs and controls) into 2 mL of LB medium containing both antibiotics. Grow with shaking at 220 rpm and 30 °C for 12h.
  • e.
    Spot 1–2 μL of each culture onto the indicator plates in a clearly labelled grid pattern.
  • f.
    Incubate the plates at 30 °C for 24–72 h. Monitor for colour development at regular intervals (e.g., 24 h, 48 h, and 72 h).
  • g.
    Photograph the plates at each time point using consistent lighting and a white background.
• 11.
  Validation of the interaction interface by site-directed mutagenesis.

  • a.
    Obtain the crystal structures of the interacting proteins (YdeH: PDB: 4H54; CRP: PDB: 1HW5) from the Protein Data Bank (PDB).
  • b.
    Use PyMOL to prepare the structures for docking by extracting the relevant monomeric chains and removing all non-protein atoms (e.g., water, ligands) unless they are known to be critical for the interaction (Figure 5).
  • c.
    Submit the prepared structures to the protein–protein docking server ClusPro. Designate YdeH as the “receptor” and CRP as the “ligand”.
  • d.
    Download and analyse the top 10-scoring docking models.
  • e.
    For each model, identify interfacial residues, defined as residues where any atom is within a certain cut-off distance (e.g., 4.5–5.0 Å) of an atom in the partner protein.
  • f.
    Based on analysis, residues K17, Q24, F54, P70, H83, D100, L134, V183, E208, and D234 of YdeH were identified as potential key interactors with CRP.

Note: Identify “hot-spot” residues by looking for those that frequently appear at the interface across multiple high-scoring models. Prioritize residues that are surface exposed, evolutionarily conserved, and predicted to form key interactions such as hydrogen bonds or salt bridges.

• 12.
  Site-directed mutagenesis and functional assay.

  • a.
    For each target residue, design a pair of complementary mutagenic primers (25–40 bp) containing the desired codon change (e.g., to alanine) at the centre.

    Note: Primers should have an appropriately melting temperature (Tm) and lack significant secondary structures.

  • b.
    Use the wild-type fusion plasmid (e.g., pKNT25-YdeH) as the template in a PCR with single-point mutation primers and a high-fidelity polymerase. Follow a standard whole-plasmid amplification protocol.
  • c.
    Digest the PCR product with the DpnI enzyme to specifically degrade the methylated parental template DNA, enriching for the newly synthesized mutant plasmid.
  • d.
    Transform the DpnI-treated product into a cloning strain (E. coli DH5α).
  • e.
    Sequence the full ORF to confirm the existence of the intended mutation and the absence of any off-target mutations after isolating plasmid DNA from multiple resultant colonies.
  • f.
    Co-transform the validated mutant plasmid with its wild-type partner plasmid (pUT18C-CRP) into E. coli BTH101.
  • g.
    Perform both qualitative (X-Gal plates) and quantitative (Miller assay) BACTH assays as described in Step 10 and Step 14. A significant reduction or complete loss of β-galactosidase activity compared with that of the wild-type pair indicates that the mutated residue is critical for the interaction.

Figure 4.

Identification of the interaction between CRP and YdeH using the BACTH system

Both crp and ydeH were cloned and inserted into the pUT18C and pKNT25 vectors, respectively, and co-transformed into the BTH101 strain by electroporation. The positive clones were spotted together with the negative control and positive control on the colour plate. Finally, the colour development of the plate was checked. Figure reprinted with permission from Wang et al., 2025.¹ Created with BioRender.

Figure 5.

Identification of the critical amino acid residues required for YdeH-CRP binding

The crystal structures of YdeH (PDB: 4H54) and CRP (PDB: 1HW5) were obtained from the Protein Data Bank (PDB), and the PyMOL was used to generate the respective monomer structures (chain A), which was then uploaded to the ClusPro server (https://cluspro.org). Docking was conducted using default parameters, with CRP set as the ligand and YdeH as the receptor. The amino acid residues with potential interactions of predicted CRP–YdeH complexes were manually analysed using PyMOL. Finally, point mutants of YdeH were constructed, and the BATCH system was used to detect interactions with CRP. Figure reprinted with permission from Wang et al., 2025.¹ Created with BioRender.

Identification and functional analysis of interacting proteins

Timing: 1 week

Timing: 2–3 days (for step 13)

Timing: 3 days (for step 14)

Timing: 1 day (for step 15)

This step aims to determine whether the cAMP receptor protein CRP directly interacts with the c-di-GMP synthase YdeH and to elucidate how such an interaction modulates YdeH catalytic activity. By combining in vitro enzymatic assays with β-galactosidase activity measurements, we systematically dissect the molecular architecture of the CRP–YdeH binding interface and its functional consequences, providing both biochemical and genetic evidence for the molecular mechanism by which cAMP regulates c-di-GMP production.

• 13.
  In vitro analysis of the effect of the CRP-YdeH interaction on YdeH enzymatic activity.

  • a.
    Clone the ydeH gene and insert it into pET28(a)+, transform the plasmid into E. coli DH5α for amplification, with sequencing of the extracted plasmid performed to ensure mutation-free sequence and proper reading frame.
  • b.
    Transform the verified plasmid into E. coli BL21(DE3) competent cells, plate the cells on LB containing 100 μg/mL kanamycin, and incubate the plates at 37 °C for 12 h.
  • c.
    A single colony was inoculated into 10 mL of LB medium containing kanamycin and cultured at 37 °C for 12 h to serve as the seed culture.
  • d.
    Dilute the seed culture 1:100 into 1 L of LB with kanamycin. Grow the culture at 37 °C to OD₆₀₀ 0.4–0.6, induce expression with 0.5 mM IPTG, and express the protein at 16 °C for 16–18 h.
  • e.
    Following centrifugation at 6,000 × g for 15 min at 4°C, the cells were harvested and subsequently resuspended in 40 mL of ice-cold buffer A (50 mM Tris-HCl (pH 7.4), 300 mM NaCl, and 1 mM PMSF).
  • f.
    Sonicate the suspension on ice (200 W, 3 s on, 7 s off, 20 min total) and then centrifuge the lysate at 12,000 × g and 4 °C for 20 min.
  • g.
    Load the clarified lysate onto a preequilibrated Ni-NTA column (5 mL bed) at 1 mL/min and wash with 10 column volumes of buffer A.
  • h.
    Proteins were eluted using a 0–300 mM linear imidazole gradient. Fractions (8 mL) were collected subsequently and analyzed by SDS–PAGE. The fractions exhibiting high purity were combined.
  • i.
    Perform a buffer exchange of the pooled fractions into reaction buffer (50 mM Tris-HCl (pH 8.0), 10 mM MgCl₂, and 1 mM DTT) using 10 kDa cut-off ultrafiltration.
  • j.
    Quantify the proteins by BCA, snap-freeze the fractions in liquid nitrogen, and store them at −80 °C.
  • k.
    Express and purify His-CRP as described above.
  • l.
    Perform buffer exchange into the same reaction buffer and adjust the concentration to 100 μM for subsequent assays.
  • m.
    Prepare a 50 μL reaction mixture containing 10 μM YdeH, ± 5 μM CRP, and GTP (0, 6.25, 12.5, 25, 50, and 100 μM) in reaction buffer in 1.5 mL tubes.
  • n.
    Samples were preincubated at 37 °C for 5 min, after which the reactions were commenced by GTP addition and terminated after 2 h through a 10-min boiling step.
  • o.
    Remove the denatured proteins by centrifugation at 12,000 × g for 10 min. Filter the supernatants through 0.22 μm aqueous filters into HPLC vials.
  • p.
    UPLC conditions: Waters ACQUITY UPLC® HSS T3 1.8 μm column; mobile phase 50 mM KH₂PO₄ + 5% methanol, pH 5.9; flow rate 1 mL/min; column temperature 40 °C; UV detection at 254 nm.
  • q.
    Construct a c-di-GMP standard curve (0.5–50 μM) with R²>0.999. Test each GTP concentration in triplicate.
  • r.
    Fit the data to the Michaelis–Menten equation using GraphPad Prism 9 to obtain Vmax and km values. Assess significance between ± CRP conditions using a two-tailed t test.
  • s.
    Lyophilize the remaining reaction mixtures, reconstitute them in 100 μL of water, and analyse them by LC–MS/MS to confirm peak identity and quantification accuracy.
• 14.
  β-Galactosidase activity assay to identify key YdeH residues that interact with CRP.

  • a.
    Co-transform the two compatible plasmids carrying the T18-CRP and YdeH-T25 (or its mutant) fusion proteins into competent BTH101 cells.

    Note: For selection, transformants were plated on LB agar containing the appropriate antibiotics (e.g., 100 μg/mL ampicillin and 50 μg/mL kanamycin), followed by a 48 h incubation at 30 °C.

  • b.
    Pick multiple colonies from the transformation plates and inoculate them into LB liquid medium supplemented with the same antibiotics and 0.5 mM IPTG.
  • c.
    Incubate the cultures at 30 °C for 12 h with shaking at 220 rpm to induce hybrid protein expression and allow potential interactions to occur.
  • d.
    Transfer an aliquot of the culture (200 μL) to a new tube to measure the OD₆₀₀.
  • e.
    Centrifuge the remaining culture to pellet the cells. After discarding the supernatant, resuspend the cell pellet in 800 μL of Z buffer (60 mM Na₂HPO₄, 40 mM NaH₂PO₄, 10 mM KCl, and 1 mM MgSO₄, pH 7.0).
  • f.
    Add one drop of 0.01% SDS and two drops of chloroform, followed by vortexing for 10 seconds to permeabilize the cells. Allow the mixture to stand to allow the chloroform to settle.
  • h.
    Add 50 μL of the permeabilized cell suspension to 150 μL of Z buffer. Initiate the enzymatic reaction by rapidly adding 40 μL of 4 mg/mL ONPG solution (prepared in Z buffer).
  • i.
    Incubate the reaction mixture at 28 °C, and monitor the absorbance at 420 nm every 2 min for 15–20 min using a microplate reader. Select the linear phase of the reaction for calculation.

    Note: Calculate the β-galactosidase activity units using the formula: Units = [(OD₄₂₀(t₂) - OD₄₂₀(t₁))/(t₂ - t₁)]/OD₆₀₀, where t₁ and t₂ are time points (in minutes) within the linear range, and OD₆₀₀ represents the cell density at the start of the reaction.

  • j.
    Assay each experimental condition in at least three biological replicates, and present the results as the mean ± standard deviation.
• 15.
  YdeH enzyme activity assay.

  • a.
    Prepare reaction buffer containing 50 mM Tris-HCl (pH 8.0), 10 mM MgCl₂, and 1 mM GTP.
  • b.
    Add purified protein to a final concentration of 10 μM in a total reaction volume of 50 μL.

    Note: For kinetic parameter determination, prepare reaction mixtures containing YdeH and CRP with GTP at serial concentrations (6.25, 12.5, 25, 50, and 100 μM) in 50 μL reaction buffer.

  • c.
    Preincubate the reaction mixture at 37 °C for 15 min. Stop the reaction by heating at 100 °C for 10 min.
  • d.
    Analyze reaction products using an HPLC system equipped with a UV/Vis detector set to 254 nm.
  • e.
    Fit data to Michaelis–Menten curves using GraphPad Prism 9 to determine Vmax and Km values.

Expected outcomes

This protocol provides a comprehensive framework to elucidate the regulatory mechanism of the cAMP signaling system on c-di-GMP biosynthesis in S. sonnei. By integrating transcriptional, biochemical, and interaction-based assays, this protocol enables the systematic identification and validation of each component within this signaling cascade. EMSAs and RT–qPCR can be performed to confirm that the cAMP–CRP complex directly binds to the ydeH promoter and activates its transcription. LC–MS/MS quantification will show that deletion of the cAMP signaling system reduces intracellular c-di-GMP levels, demonstrating that the cAMP signaling positively influences c-di-GMP accumulation. BACTH analysis will verify the in vivo interaction between CRP and YdeH, while mutational and docking analyses will identify key residues involving in this association. Functional assays are expected to show that the CRP–YdeH interaction enhances YdeH enzymatic activity, further increasing the intracellular c-di-GMP concentration. Overall, this workflow establishes the hierarchical regulatory link between the cAMP and c-di-GMP signaling systems in S. sonnei.

Limitations

Although this protocol can identify the signaling network of nucleotide second messengers in bacteria, it has several limitations. First, this protocol is applicable for studying the downstream regulatory mechanisms of transcriptional regulatory protein-type receptors in nucleotide second messenger signaling but may not be suitable for research on other types of receptor proteins, such as enzymes and ribosome-like proteins. Second, the analysis of signal receptor binding conformations depends on computer-simulated molecular docking, which may deviate from the actual three-dimensional structure of the receptor protein, potentially influencing the analysis outcome.

Troubleshooting

Problem 1

MST curves display an atypical biphasic pattern or poor fitting. (1. MST assay, Steps e–i).

Potential solution

Check the stability of the ligand and protein: Use SDS–PAGE or mass spectrometry to confirm that neither the protein nor the ligand is degraded under the assay conditions.

Evaluate nonspecific binding: Run blank controls (dye ± carrier) and non-relevant protein controls using the same concentration range, or add moderate salt or low concentrations of detergents to suppress nonspecific interactions.

Narrow the concentration range and increase dilution points: If precipitation or nonlinearity occurs at high concentrations, reduce the maximum ligand concentration and add more mid-to-low concentration points to improve curve fitting.

Adjust buffer system and pH: Some interactions are sensitive to pH or ionic strength; test one or two alternative buffer conditions (e.g., PBS or Tris-HCl) to validate robustness.

Repeat the experiment and increase technical replicates to determine whether the abnormal curve is a one-time artifact.

Problem 2

Low homologous recombination efficiency. (2. Construction of markerless gene deletion mutants, Steps a–i).

Potential solution

Insufficient expression of λ Red recombinase or suboptimal quality of the targeting fragment can lead to low recombination efficiency. To enhance successful gene replacement, we recommend the following optimization strategies: Verify L-arabinose induction by preparing a fresh 10% stock solution and ensuring that induction starts at OD₆₀₀ = 0.1–0.2; improve targeting fragment purity through double gel purification to remove nonspecific amplification products; increase the homologous arm length to 50–500 bp for enhanced recombination frequency; and validate the primer specificity by sequencing the amplified resistance cassette with homologous arms.

Problem 3

High background noise or smeared bands in EMSA (6. EMSA, Steps g–k).

Potential solution

Optimize gel concentration and electrophoresis conditions: If band smearing occurs, try increasing the polyacrylamide percentage (e.g., from 5% to 6%–8%) or reducing the running voltage (e.g., from 110 V to 80 V) to minimize heat-induced diffusion.

Improve membrane transfer and crosslinking steps: Carefully monitor current and transfer time to avoid over-transfer. Ensure the DNA is evenly distributed before UV crosslinking. If chemical crosslinking efficiency is low, slightly extend the crosslinking duration.

Check sample loading amount and loading buffer quality: Avoid overloading DNA, which can cause lane saturation or tailing. Ensure the loading buffer is fresh and free of contaminants such as salt crystals or SDS.

Problem 4

False-positive and false-negative results. (9. BACTH, Steps a–l).

Potential solution

To mitigate potential steric hindrance and avoid false positives and false negatives, it is essential to construct and test all four fusion combinations.

• •T25-Protein A + T18-Protein B.
• •T25-Protein A + Protein B-T18.
• •Protein A-T25 + T18-Protein B.
• •Protein A-T25 + Protein B-T18.

Problem 5

Mutant protein stability. (12. Site-Directed Mutagenesis, Steps a–g).

Potential solution

It is crucial to verify that the mutant proteins are expressed and stable. A loss of the interaction signal could be due to protein misfolding or degradation rather than a disrupted interface. Check protein expression via SDS–PAGE if a loss of signal is observed.

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Prof. Yinyue Deng (dengyle@mail.sysu.edu.cn).

Technical contact

Technical questions on executing this protocol should be directed to and will be answered by the technical contact, Dr. Binbin Cui (cuibb@alumni.sysu.edu.cn).

Materials availability

All unique/stable reagents generated in this study are available from the lead contact with a completed materials transfer agreement. All data needed to evaluate the conclusions in the paper are present in the paper and the supplemental materials. All the raw and analyzed data generated during the study are available from the corresponding authors on reasonable request.

Data and code availability

This study did not generate/analyze datasets and codes.

Acknowledgments

This work was financially supported by the National Key Research and Development Program of China (2024YFA0920101 to Y.D.), the Shenzhen Medical Research Fund (B2403002 to Y.D.), the National Natural Science Foundation of China (32570048 to Y.D. and 32400017 to M.W.), the Basic Public Welfare Science and Technology Project of Zhejiang Province (ZCLQN26C0101 to B.C.), and Ningbo Natural Science Foundation (2025J053 to B.C.).

Author contributions

Conceptualization, Y.D.; investigation, B.C., X.C., M.W., and Y.D.; writing – original draft, B.C., X.C., M.W., and Y.D.; writing – review and editing, Y.D.; funding acquisition, M.W., B.C., and Y.D.; supervision, Y.D.

Declaration of interests

The authors declare no competing interests.