Skip to main content
NCBI home page
Poultry Science logoLink to Poultry Science
. 2026 Feb 2;105(4):106571. doi: 10.1016/j.psj.2026.106571

The combination of matrine and tannic acid protects chickens against intestinal infection caused by Salmonella Typhimurium

Hu-Juan Shuai a,1, Xiu-Ping Lv a,1, Wen-Li Tang b,1, Zhi-Kun Yang b,1, Xiang-Bin Song b,1, Chao Ma a, Ying Liu c, Yong-Da Zhao a, Li-Li Guo a,⁎, Shuai-Cheng Wu a,⁎
PMCID: PMC12914421  PMID: 41666669

Abstract

The aim of this study was to investigate the effect of the combination of matrine and tannic acid on intestinal infection in chickens with Salmonella Typhimurium. A model of chicken intestinal infection with S. Typhimurium was established to confirm the protective effect of the combination of matrine and tannic acid in vivo. This combination prolonged survival time, promoted growth, and decreased the bacterial burdens of the liver and duodenum in chickens infected with S. Typhimurium, and was superior to matrine or tannic acid monotherapy. The combination of these substances alleviated the changes in organ indices and liver and spleen congestion, decreased intestinal permeability, and alleviated duodenal lesions in chickens caused by S. Typhimurium. The same combination suppressed the transcription of IL-1β and TNF-α in the intestine of chickens infected with S. Typhimurium, possibly through the downregulation of the mRNA expression of TLR-4/p50/NLRP-3/Caspase-1. Moreover, the combination of matrine and tannic acid decreased the levels of intestinal nitrate and iNOS mRNA in the duodenum of chickens infected with S. Typhimurium. Caecal microbiota analysis revealed that this combination improved gut microbiota dysbiosis in chickens infected with S. Typhimurium, as evidenced by alterations in the abundance of microbiota composition at the phylum (Firmicutes and Actinobacteria, Proteobacteria), family (Bifidobacteriaceae and Enterobacteriaceae), and genus (Lactobacillaceae, Escherichia-Shigella, and [Ruminococcus]_torques_group) levels. In conclusion, the combination of matrine and tannic acid is a viable strategy to protect chickens against S. Typhimurium infection, possibly through the suppression of the inflammatory response and the modulation of the intestinal microecology.

Keywords: Combination of matrine and tannic acid, Salmonella Typhimurium, inflammatory response, intestinal microecology

Introduction

Salmonella Typhimurium, a zoonotic pathogen that causes enteritis and sepsis, causes high economic losses in the poultry industry and affects public health. S. Typhimurium is generally orally introduced via food or water and survives in the gastric environment to reach the intestines. Despite typically causing asymptomatic carriage in adult commercial chickens, S. Typhimurium induces acute enteritis, systemic septicemia, and significant mortality in young chickens and immunocompromised chickens upon intestinal colonization(Dar, et al., 2019; Zhao, et al., 2022). The intestinal microecology of chickens is closely related to their overall health status. S. Typhimurium has developed multiple virulence strategies to interact with the epithelium and survive in the intestinal tract, such as induction of the intestinal inflammatory response (Galán, 2021) and alteration of the intestinal microecology (Gül, et al., 2024). S. Typhimurium triggers an inflammatory response to sustain its replication in the intestinal tract via the activation of multiple signalling pathways, such as the NF-κB and Toll-like receptor-4 (TLR-4) signalling pathways (Gül, et al., 2023). S. Typhimurium infection promotes intestinal nitrate-dependent anaerobic respiration by stimulating the expression of iNOS, which leads to a dysbiotic expansion (Byndloss, et al., 2017). S. Typhimurium infection also remodels the gut microbiome to support its colonization and infection (Leleiwi, et al., 2024; Yoo, et al., 2024). Moreover, S. Typhimurium can cross the intestinal epithelial barrier and lead to systemic infection, immune deficiency, and even death (Shaji, et al., 2023).

Various strategies, such as biosecurity and antibiotics, have been used to control Salmonella infection (Shaji, et al., 2023). Antibiotics are the most curative method against Salmonella infection. However, the worsening problem of antibiotic resistance prompts the need for new alternative strategies. Traditional Chinese medicine has been widely employed for the prevention and treatment of bacterial diseases (Shuai-Cheng, et al., 2019). In China, Galla chinensis and Sophora flavescens are often used for the treatment of intestinal diseases(Gao, et al., 2024; Jing, et al., 2022a). Tannic acid, isolated from Galla chinensis, exhibited anti-inflammatory, neuroprotective, antitumour, cardioprotective, and antipathogenic effects(Jing, et al., 2022b). Matrine, isolated from Sophora flavescens, exhibited anti-inflammatory, anticancer, cardioprotective, neuroprotective, and antibacterial activities (Li, et al., 2021). However, the effect of the combination of matrine and tannic acid on Salmonellosis remains unclear.

This study aimed to investigate the effect of the combination of matrine and tannic acid on chicken intestinal infection with S. Typhimurium and elucidate the underlying mechanism.

Materials and methods

Chemicals and bacterial strains

Matrine (MT, 99%) and tannic acid (TA, ≥99.5%) were obtained from Shanghai Macklin Biochemical Technology, Ltd. (Shanghai, China). Diamine oxidase (DAO) activity kits were purchased from Jiangsu Aidisheng Biological Technology Co., Ltd. (Nanjing, China). Nitrate detection kits were purchased from Qingdao Zi En Biotechnology Co., Ltd. (Qingdao, China). A FastPure Cell/Tissue Total RNA Isolation Kit V2 was purchased from Vazyme Biotech Co., Ltd. (Nanjing, China). TOROGreen® qPCR Master Mix and TOROBlue® qRT Premix with gDNA Eraser 2.0 were purchased from Shanghai Tianxue Technology Co., Ltd. (Shanghai, China). S. Typhimurium SL1344 was a kind gift from Professor Xiaodong Xia, North West Agriculture and Forestry University, China. Hy-line Brown chickens were supplied by Huayu Agricultural Science and Technology Co., Ltd. TIAN amp Soil DNA kits and Phusion High-Fidelity PCR Master Mix were supplied by Tiangen Biotech (Beijing) Co., Ltd (Beijing, China).

Experimental design

All animal experiments were approved by the Committee on the Ethics of Animal Experiments of Qingdao Agricultural University with approval number ZR2023MC129. The experimental procedures involving live animals were performed in accordance with the guidelines approved by the Institutional Animal Care and Use Committee (IACUC). One-day-old Hy-line Brown male chickens negative for Salmonella antibodies and antigens were separated randomly into the control group, SL1344 group, MT group, TA group, and MT+TA group, with each group comprising three replicate cages of 10 chickens each. The chickens in the SL1344, MT, TA, and MT+TA groups were orally infected with 1.0 × 109 CFU of SL1344 per chicken for 3 days. Concurrently, the SL1344, MT, TA, and MT+TA groups received an intragastric administration of MT (60 μmol/kg), TA (60 μmol/kg), or MT (60 μmol/kg) + TA (60 μmol/kg) dissolved in water at 1 h before the first infection, which continued once daily for 7 consecutive days. The control and SL1344 groups received 200 μL of water once daily for 7 consecutive days. Chickens were monitored twice daily for 7 days, after which their survival time and body weights were recorded. The chickens were subsequently euthanized by cervical dislocation.

Organ indices and bacterial loads

The duodenum, liver, and spleen were aseptically collected at 7 days post-infection. The liver and spleen were weighed to determine organ indices. The duodenum and liver were homogenized in PBS at 4°C and diluted serially in PBS. Afterwards, 0.1 mL of the dilutions was uniformly plated on Salmomella Shigella agar plates and cultured for 18 h at 37°C.

Intestinal permeability

Serum was collected at 7 days post-infection, and DAO activity was evaluated via assay kits according to the manufacturer's instructions.

Intestinal nitrate measurements

Duodenal tissue was aseptically collected at 7 days post-infection, and the mucus layer was gently scraped from the tissue, homogenized in 200 μL of PBS and then placed on ice. The samples were subsequently centrifuged at 4°C, after which the supernatants were filter-sterilized. Measurement of intestinal nitrate followed an adaptation of the Griess assay.

Histopathology of the duodenum

Duodenal tissues were fixed in 4% paraformaldehyde for 24 h. The fixed tissues were embedded in paraffin blocks after a series of procedures, including dehydration with gradient ethanol, clearing with xylene, and wax dipping, after which the paraffin blocks were sliced into 4-mm sections. Finally, the sections were stained with haematoxylin and eosin (HE) and examined via microscopy for histopathological changes.

Real-time fluorescent quantitative PCR

Duodenal tissues were collected 7 days post-infection, and total RNA was isolated with a FastPure Cell/Tissue Total RNA Isolation Kit V2 according to standard procedures. For each RT‒PCR, 2 µg of total RNA was used to synthesize cDNA using TOROBlue® qRT Premix with gDNA Eraser 2.0. The relative mRNA concentrations were quantified by quantitative real-time polymerase chain reaction (qRT‒PCR) technology using a 7500 Fast Real-Time PCR System (Applied Biosystems) with TOROGreen® qPCR Master Mix and 30 pmol of primers for the target sequences (Table 1). The relative change in mRNA expression was calculated using the comparative computed tomography (CT) method, and samples were normalized to the expression of the housekeeping gene GAPDH.

Table 1.

Specific primers for target genes.

Gene Primer Sequence 5′ - 3′
GAPDH GAPDH F GCTAAGGCTGTGGGGAAAGT
GAPDH R TCAGCAGCAGCCTTCACTAC
TNF-α TNF-α F GCTGTTCTATGACCGCCCAGTT
TNF-α R AACAACCAGCTATGCACCCCA
IL-1β IL-1β F GGTCAACATCGCCACCTACA
IL-1β R CATACGAGATGGAAACCAGCAA
iNOS iNOS F CCCTCCAGCTGATCAGACTATC
iNOS R GTGTGCAAGCCGGAATCTTTT
P50 P50 F GAAGGAATCGTACCGGGAACA
P50 R CTCAGAGGGCCTTGTGACAGTAA
TLR4 TLR4 F TGCCATCCCAACCCAACCACAG
TLR4 R ACACCCACTGAGCAGCACCAA
NLRP3 NLRP3 F GCTCCTTGCGTGCTCTAAGACC
NLRP3 R TTGTGCTTCCAGATGCCGTCAG
Caspase-1 Caspase-1 F GTGCTGCCGTGGAGACAACATAG
Caspase-1 R AGGAGACAGTATCAGGCGTGGAAG
Open in a new tab

Microbiome sequencing

Microbial DNA from the caecal contents was isolated with TIAN amp Soil DNA kits, and the V4 region of the bacterial 16S rRNA gene was amplified using Phusion High-Fidelity PCR Master Mix. The products were subsequently purified, and sequencing was performed using a NovaSeq 6000 platform to generate 250-bp single-end reads at Novogene Bioinformatics Technology Co., Ltd. (Beijing, China). The sequencing data were analysed using QIIME2 (version QIIME2-202202).

Statistical analyses

Statistical analyses were performed using Graph Pad Prism version 6. Statistical analysis was performed using one-way analysis of variance (ANOVA) with Duncan’s multiple-comparison test. Survival analysis was performed using the Kaplan‒Meier method. The results are presented as the means ± standard deviations (SDs). Differences were considered statistically significant at * P < 0.05 and ** P < 0.01.

Results

The combination of MT and TA protected chickens against S. Typhimurium

To evaluate the protective effects of the combination of MT and TA on S. Typhimurium-challenged chickens, the survival rate, body weight, and bacterial burdens of the liver and duodenum were evaluated. As shown in Fig. 1, MT, TA and their combination enhanced the survival rate of chickens challenged with S. Typhimurium during the 7-day observation period. The survival rate and body weight of the MT+TA group were significantly greater than those of the SL1344 group (P < 0.01; Fig. 1C and 1D). Compared with those in the SL1344 group, the bacterial burdens in the liver and duodenum in the MT, TA, and MT+TA groups were significantly lower (P < 0.05; Fig. 1E and 1F). Compared with those in the MT and TA groups, the bacterial burdens in the duodenum in the MT+TA group were significantly lower (Fig. 1F). Moreover, the survival rate and body weight of the MT+TA group were superior to the groups treated with MT or TA alone (Fig. 1).

Fig. 1.

Fig 1 dummy alt text

Open in a new tab

The combination of MT and TA protected chickens against S. Typhimurium infection. (A, B) Structures of TA and MT. (C) Survival rate of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination (n=10). (D) Body weight of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination (n=10). (E, F) Liver and duodenal bacterial burdens of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination (n=5). * P < 0.05 and ** P < 0.01.

The combination of MT and TA suppressed swelling and congestion in the livers and spleens of chickens infected with S. Typhimurium

To evaluate the protective effect of MT and TA on chicken system infection caused by S. Typhimurium, the organ indices and pictures of the liver and spleen were examined. As shown in Fig. 2A and 2B, the organ indices of the livers and spleens of the chickens challenged with SL1344 were significantly greater than those of the control group (P < 0.05). In addition, the organ indices of the liver and spleen in the SL1344 group were significantly greater than those in the MT, TA, and MT+TA groups (P < 0.05). As shown in Fig. 2C and 2D, the liver and spleen from the SL1344 group exhibited swelling and congestion, whereas the combination of matrine and tannic acid suppressed swelling and congestion of the liver and spleen caused by S. Typhimurium.

Fig. 2.

Fig 2 dummy alt text

Open in a new tab

The combination of MT and TA suppressed swelling and congestion in the livers and spleens of chickens infected with S. Typhimurium. Livers and spleens of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination were collected at 7 days post-infection. (A, B) Organ indices of livers and spleens of chickens infected with S. Typhimurium (n=5). (C) Pictures of livers and spleens of chickens infected with S. Typhimurium (n=5). * P < 0.05 and ** P < 0.01.

The combination of MT and TA suppressed the intestinal permeability and duodenal lesions of chickens caused by S. Typhimurium

To evaluate the protective effects of MT and TA on intestinal lesions caused by S. Typhimurium in chickens, intestinal permeability and intestinal pathological duodenum sections were evaluated. As shown in Fig. 3A, the serum DAO activity in the SL1344 group was significantly greater than that in the control group (P<0.05). Moreover, the serum DAO activity in the MT+TA, MT, and TA groups was significantly lower than that in the SL1344 group (P<0.05). As shown in Fig. 3B, the combination of MT and TA suppressed the shortening of the mucosal layer of intestinal villi, the shedding of epithelial cells, and the massive infiltration of inflammatory cells caused by S. Typhimurium.

Fig. 3.

Fig 3 dummy alt text

Open in a new tab

The combination of MT and TA suppressed intestinal permeability and duodenal lesions in chickens caused by S. Typhimurium. Serum and duodenal tissue from SL1344-infected chickens treated with MT (60 μmol/kg) or TA (60 μmol/kg) alone or in combination was collected at 7 days post-infection. (A) Serum DAO activity in chickens infected with S. Typhimurium (n=5). * P < 0.05 and ** P < 0.01. (B) Pathological changes in the duodenum of chickens infected with S. Typhimurium(n=5).Inline graphic indicates shortening of intestinal villi, Inline graphic indicates the shedding of epithelial cells, and Inline graphic indicates the massive infiltration of inflammatory cells.

The combination of MT and TA suppressed the intestinal inflammatory response of chickens infected with S. Typhimurium

To evaluate the protective effects of MT and TA on the intestinal inflammatory response of chickens caused by S. Typhimurium, the mRNA levels of intestinal cytokines and the associated signalling pathways in the duodenum were examined. As shown in Figure 4AB, the mRNA levels of IL-1β and TNF-α in the SL1344 group were significantly greater than those in the control group, and the mRNA levels of IL-1β and TNF-α in the MT+TA, MT, and TA groups were significantly lower than those in the SL1344 group (P<0.05). As shown in Fig. 4C–F, the mRNA levels of TLR-4, p50, caspase-1 and NLRP3 in the SL1344 group were significantly greater than those in the control group, and the mRNA levels of TLR-4, p50, caspase-1 and NLRP3 in the MT+TA, MT, and TA groups were significantly lower than those in the SL1344 group (P<0.05).

Fig. 4.

Fig 4 dummy alt text

Open in a new tab

The combination of MT and TA suppressed the intestinal inflammatory response caused by S. Typhimurium in chickens. The duodenal tissue of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination was collected 7 days post-infection. (A, B) The relative cytokine gene expression levels of IL-1β and TNF-α in the duodenum of chickens infected with S. Typhimurium (n=3). (C, D, E, F) The relative gene expression levels of TLR-4, p50, caspase-1 and NLRP3 in the duodenum of chickens infected with S. Typhimurium (n=3). * P < 0.05 and ** P < 0.01.

The combination of MT and TA decreased the levels of intestinal nitrate and iNOS mRNA in chickens infected with S. Typhimurium

Since S. Typhimurium relies on intestinal nitrate for expansion, the levels of intestinal nitrate and iNOS mRNA were determined. As shown in Fig. 5A, the levels of intestinal nitrate in the SL1344 group were significantly greater than those in the control group, and the levels of nitrate in the MT+TA, MT, and TA groups were significantly lower than those in the SL1344 group (P<0.05). As shown in Fig. 5B, the mRNA levels of iNOS in the SL1344 group were significantly greater than those in the control group, and the mRNA levels of iNOS in the MT+TA, MT, and TA groups were significantly lower than those in the SL1344 group (P<0.01).

Fig. 5.

Fig 5 dummy alt text

Open in a new tab

The combination of MT and TA decreased the levels of intestinal nitrate and iNOS mRNA in chickens caused by S. Typhimurium. The duodenal tissue of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination was collected 7 days post-infection. (A) The levels of intestinal nitrate in chickens infected with S. Typhimurium (n=5). (B) The mRNA levels of iNOS in the duodenum of chickens infected with S. Typhimurium (n=3). * P < 0.05 and ** P < 0.01.

The combination of MT and TA improved the caecum microbiota of chickens caused by S. Typhimurium

The effect of the combination of MT and TA on the gut microbiota of chickens infected with S. Typhimurium was investigated via 16S rDNA gene sequencing. As shown in the Venn diagram (Fig. 6A), there were 78 unique operational taxonomic units (OTUs) in the control group, 25 unique OTUs in the SL1344 group, 39 unique OTUs in the TA group, 30 unique OTUs in the MT group, and 33 unique OTUs in the TA+MT group. The data show that the intestinal microbial species of the chickens in the 5 groups differed. The principal coordinate analysis (PCoA) and nonmetric multidimensional scaling analysis (NMDS) plots presented in Fig. 6B and 6C reveal that the intestinal microbial species of the chickens in the 5 groups partially overlapped. Moreover, the intestinal microbial species in the SL1344 group were clearly partially separated from those in the other groups.

Fig. 6.

Fig 6 dummy alt text

Open in a new tab

The combination of matrine and tannic acid improved the caecal microbiota of chickens caused by S. Typhimurium. The caecal microbiota of SL1344-infected chickens treated with MT (60 μmol/kg), TA (60 μmol/kg), or their combination was analysed via 16S rRNA sequencing (n=5). (A) Venn diagram showing the operational taxonomic units (OTUs) in each group. (B) Indices representing the α diversity at the OTU level. (C) Indices representing the β diversity at the OTU level. (D) Species distribution histograms at the phylum level under different treatments. (EFG) Relative abundances of caecal microbial community members (Proteobacteria, Firmicutes, and Actinobacteriota) at the phylum level. (H) Species distribution histograms at the family level under different treatments. (IJK) The relative abundances of caecal microbial community members (Lachnospiraceae, Enterobacteriaceae, and Bifidobacteriaceae) at the family level. (L) Species distribution histograms at the family level under different treatments. (MNO) The relative abundances of caecal microbial community members (Lactobacillus, Escherichia-Shigella, and [Ruminococcus]_torques_group) at the genus level. (P) LEfSe analyses of evolutionary branching graphs of the caecal microbiota. (Q) Linear discriminant analysis (LDA) combined with effect size measurement (LEfSe) analysis of the caecal microbiota. * P < 0.05 and ** P < 0.01.

To better understand the changes in the composition of the gut microbiota, the dominant microbiota were analysed at the phylum, family, and species levels (Fig. 6). At the phylum level, Firmicutes and Bacteroidota dominated. At the phylum level, compared with those in the normal group, the abundance levels of Firmicutes and Proteobacteria in the SL1344 group significantly decreased (Fig. 6D, P<0.01). The abundance of Proteobacteria decreased in the TA, MT, and MT+TA groups compared with that in the SL1344 group (Fig. 6E, P<0.05). Compared with that in the SL1344 group, the abundance of Firmicutes in the TA, MT, and MT+TA groups increased (Fig. 6F, P<0.05). Compared with that in the SL1344 group, the abundance of Actinobacteria in the MT+TA group significantly increased (Fig. 6G, P<0.01). Moreover, the relative abundance of Actinobacteriota in the MT+TA group was significantly greater than that in the TA and MT groups (Figure 6G; P<0.05). At the family level, compared with those in the control group, the abundance levels of Lachnospiraceae and Lactobacillaceae in the SL1344 group decreased, and the abundance of Enterobacteriaceae in the SL1344 group increased (Fig. 6H). Compared with that in the SL1344 group, the relative abundance of Lachnospiraceae in the TA, MT, and MT+TA groups increased (Fig. 6I), the relative abundance of Enterobacteriaceae in the TA, MT, and MT+TA groups decreased (Fig. 6J, P<0.01), and the relative abundance of Bifidobacteriaceae in the MT+TA group significantly increased (Fig. 6K, P<0.01). Moreover, the relative abundance of Bifidobacteriaceae in the TA+MT group was significantly greater than that in the TA and MT groups (Figure 6K; P<0.05). At the genus level, compared with that in the normal group, the abundance of Lactobacillus in the SL1344 group decreased, and the abundance of Escherichia-Shigella in the SL1344 group increased (Fig. 6L). Compared with that in the SL1344 group, the relative abundance of Lactobacillus in the TA and MT+TA groups significantly increased (Fig. 6M, P<0.05), and the relative abundance of Escherichia-Shigella decreased in the TA, MT, and MT+TA groups (Fig. 6N, P<0.01), and the relative abundance of [Ruminococcus]_torques_group in the TA+MT group significantly increased (Fig. 6O, P<0.05).

Linear discriminant analysis effect size (LEfSe) was used to analyse 9 OTUs whose abundances significantly differed from the phylum level to the species level (Figure 6PQ). The OTUs whose abundance significantly differed were as follows: the SL1344 group included f_Enterobacteriaceae, o_Enterobacterales, and c_Gammaproteobacteria; the TA group included c_Bacili; the MT group included f_Rikenellaceae, o_Bacteroidales, and c_Bacteroidales; and the MT+TA group included f_Bifidobacteriaceae, o_Bifidobacteriales, c_Actinobacteria, f_Lactobacillaceae, and o_Lactobacilales. As shown in Fig. 6Q, bacterial members such as c_Gammaproteobacteria, p_Proteobacteria, o_Enterobacterales, f_Enterobacteriaceae, and g_Escherichia_Shigella were enriched in the SL1344 group. Bacterial members such as p_Firmicutes and c_Bacilli were enriched in the TA group. Bacterial members such as f_Rikenellaceae, g_Alistipes, s_Alistipes_sp_CHKCI003, c_Bacteroidales, o_Bacteroidales, p_Bacteroidota, and g_Ruminococcus_toraues_group were enriched in the MT group. The abundances of bacterial members such as o_Lactobacillales, f_Lachnospiraceae, g_Lactobacillus, g_Bifidobacterium, f_Bifidobacteriaceae, o_Bifidobacteriales, c_Actinobacteria, and p_Actinobacteriota were enriched in the MT+TA group.

Discussion

Infection with S. Typhimurium causes enteritis and sepsis in chickens and causes great economic losses in the poultry industry (Leyva-Diaz, et al., 2021). Although antibiotics are important for the treatment of Salmonellosis, the worsening problem of antibiotic resistance requires nonantibiotic strategies (Saleh, et al., 2025). Here, we provide evidence that the combination of MT and TA represents a new strategy with the potential to prevent chicken intestinal disease caused by S. Typhimurium, as demonstrated by the high survival rate and body weight of chickens and low liver and duodenum bacterial burdens. Mechanistic analysis revealed that the combination of MT and TA mitigated chicken infection with S. Typhimurium, possibly by suppressing the inflammatory response and modulating intestinal microecology.

Salmonella enteritis in poultry can result in reduced immune function, a decreased growth rate, and increased mortality (Liu, et al., 2024). Studies have shown that TA can be used as an antibacterial agent against S. Typhimurium infection in broilers (Choi, et al., 2023). In this study, compared with monotherapy, the combination of MT and TA provided superior protection against S. Typhimurium intestinal infection in chickens. This was evidenced by improved survival rates, increased body weight gain, and reduced pathological lesions in the intestine, liver and spleen (Fig. 1, Fig. 2, Fig. 3). Intestinal epithelial cells form a critical barrier against pathogen invasion. In this study, the combination of MT and TA inhibited the invasion of S. Typhimurium into the intestine, as evidenced by low duodenal bacterial burdens (Fig. 1). Interestingly, although the combination of MT and TA showed an indifference antibacterial effect activity in vitro (1<FICI<4, Figure S1), it demonstrated superior efficacy in protecting against intestinal invasion by Salmonella in vivo. This discrepancy indicates that the protective mechanism of the combination may not rely solely on antimicrobial action. S. Typhimurium colonizes and invades the intestinal epithelium to impair the intestinal barrier. The combination of MT and TA decreased intestinal permeability, promoted intestinal Occludin protein expression, and reduced intestinal damage in chickens infected with S. Typhimurium (Figs. 3 and S3). S. Typhimurium is a gram-negative pathogen that causes diseases ranging from gastroenteritis to systemic infection and sepsis, as evidenced by pathological change of the liver and spleen (Shakir, et al., 2021). Interestingly, the combination of MT and TA suppressed the swelling and congestion of the liver and spleen in chickens caused by S. Typhimurium (Fig. 2). Additionally, Salmonella infection led to impaired immune function in chickens, as indicated by the low organ indices of the bursa of Fabricius and the thymus (Figure S2). The combination of MT and TA also improved the immune function of chickens infected with S. Typhimurium, as evidenced by the high organ index of the bursa of Fabricius and thymus (Figure S2).

Controlling the intestinal inflammatory response is important for treating Salmonellosis. Studies have shown that matrine and tannic acid exhibit anti-inflammatory activity (Jing, et al., 2022b; Li, et al., 2021). The combination of MT and TA suppressed the intestinal inflammatory response, as evidenced by low mRNA levels of TNF-α and IL-1β (Fig. 4). S. Typhimurium infection induces an enteric inflammatory response via the activation of multiple signalling pathways, including TLR4, NF-κB, and NLRP3. TLR4 recognizes the lipopolysaccharide of S. Typhimurium and triggers the expression of inflammatory factors via NF-κB. Studies have shown that S. Typhimurium induces the activation of the inflammasome effector caspase-1 via NLRP3 inflammasome and the consequent maturation and secretion of the cytokine IL-1β during intestinal infection (Crowley, et al., 2020; Jing, et al., 2022b). The combination of MT and TA not only inhibited intestinal protein levels of TLR-4 and NF-κB, but also downregulated the transcription of TLR-4/P50/NLRP3/caspase-1 in chickens infected with S. Typhimurium (Figure S3 and 4). This study revealed that the combination of MT and TA inhibited the intestinal inflammatory response, possibly through interference with TLR-4/NF-κB/NLRP3/caspase-1 signalling pathways in chickens infected with S. Typhimurium.

The intestinal health of chickens is closely related to their overall health status, as the intestine serves as the first line of defence against enteric pathogens through maintaining barrier integrity, ensuring microbiota homeostasis, and mounting effective immune responses(Zhang, et al., 2024). S. Typhimurium infection alters the intestinal microecology for intestinal colonization, invasion and expansion (Bescucci, et al., 2020; Fattinger, et al., 2020). S. Typhimurium uses host-derived nitrate in the intestinal tract for expansion by stimulating the expression of iNOS. Studies have shown that the microbiota or inhibitors of iNOS synthesis inhibit the expansion of dysbiotic Enterobacteriaceae (Faber, et al., 2016). The combination of matrine and tannic acid suppressed the production of intestinal nitrate and the transcription of iNOS, contributing to the protective effect of the combination of matrine and tannic acid against intestinal infection with S. Typhimurium in chickens (Fig. 5). The intestinal microbiota play a vital role in maintaining gut health and influences the overall performance of chickens (Khan, et al., 2020). Salmonella modulates the intestinal microbiota to facilitate colonization (Robinson, et al., 2022). Salmonella infection led to an increase in the abundance of Proteobacteria at the phylum level and Enterobacteriaceae at the family level and a decrease in the abundance of Firmicutes at the phylum level and Lachnospiraceae and Lactobacillaceae at the family level (Fig. 6), which may make it easier for Salmonella to colonize the gut, as is consistent with previous reports (Wang, et al., 2023c; Zhang, et al., 2021). Previous reports have shown that MT and TA increase growth performance and modulate the intestinal microbiota of chickens(Mao, et al., 2025; Xu, et al., 2025). The combination of MT and TA balanced the intestinal microbiota, as evidenced by improvements in the intestinal microbiota at the phylum, family and genus levels in chickens infected with S. Typhimurium (Fig. 6). Pathogens such as Salmonella are gram-negative bacteria of the family Enterobacteriaceae and belong to the phylum Proteobacteria. Both MT and TA alone and in combination decreased the abundance of Proteobacteria at the phylum level and Enterobacteriaceae at the family level in chickens infected with S. Typhimurium, which is consistent with the low bacterial burden of SL1344 in the duodenum (Fig. 1). Studies have shown that probiotics are bacteria from the families Lactobacillaceae and Lachnospiraceae (Filidou, et al., 2024). Both MT and TA alone and in combination increased the abundance of Lachnospiraceae in chickens infected with S. Typhimurium. Studies have shown that Lactobacillus displays probiotic potential and protects against Salmonella pullorum infection in chickens (Wang, et al., 2023a; Wang, et al., 2023b). The combination of MT and TA also increased the abundance of Lactobacillus in chickens infected with S. Typhimurium, which contributed to the protective effect of matrine and tannic acid. Interestingly, the combination of matrine and tannic acid also increased the abundance of Actinobacteriota, Bifidobacteriaceae, and [Ruminococcus]_torques_group in chickens infected with S. Typhimurium, which may also contribute to the protective effect of matrine and tannic acid against S. Typhimurium (Wang, et al., 2022). Compared with monotherapies, the superior combined effect of TA and MT was associated with a notably increased abundance of Actinobacteriota at the phylum level, and Bifidobacteriaceae at the family level. This specific microbial shift suggests that these taxa may play a functionally important role in the mechanistic basis for the combination's enhanced effect. These results demonstrate that the combination of MT and TA can improve the intestinal microecology in chickens infected with S. Typhimurium, as evidenced by alterations in the gut microbiota and intestinal nitrate concentration (Figs. 5, 6).

Conclusion

In summary, this study demonstrated that the combination of MT and TA had a protective effect on S. Typhimurium infection in chickens. Mechanistically, the combination of MT and TA suppressed the intestinal inflammatory response in chickens infected with S. Typhimurium, possibly through interference with TLR4/NF-κB/NLRP3/caspase-1 signalling pathways. Moreover, the combination of MT and TA enhanced the intestinal epithelial barrier, suppressed the production of intestinal nitrate via the downregulation of iNOS mRNA, and modulated the intestinal microbiota in chickens infected with S. Typhimurium. Moreover, our results support the combination of MT and TA as a strategy to reduce bacterial intestinal infectious diseases, including those caused by S. Typhimurium.

Acknowledgements

This work was supported by Project ZR2023MC129 supported by the Shandong Provincial Natural Science Foundation, the Key R&D Program of Shandong Province (2022CXPT010), the National Natural Science Foundation of China (No. 32503094, 31702280), Qingdao Science and Technology for the People Demonstration Special (25-1-5-xdny-30-nsh, 24-1-8-xdny-4-nsh), and the High-level Talents Scientific Research Foundation of Qingdao Agricultural University (6651120047).

CRediT authorship contribution statement

Hu-Juan Shuai: Writing – review & editing, Data curation, Formal analysis, Investigation. Xiu-Ping Lv: Investigation, Data curation. Wen-Li Tang: Writing – review & editing, Project administration, Methodology. Zhi-Kun Yang: Project administration, Funding acquisition. Xiang-Bin Song: Project administration, Methodology. Chao Ma: Investigation, Formal analysis, Methodology, Validation. Ying Liu: Writing – review & editing, Funding acquisition, Data curation. Yong-Da Zhao: Writing – review & editing, Funding acquisition. Li-Li Guo: Writing – review & editing, Funding acquisition, Methodology. Shuai-Cheng Wu: Conceptualization, Writing – original draft, Funding acquisition, Methodology, Supervision.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Footnotes

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2026.106571.

Contributor Information

Li-Li Guo, Email: guolili_house@126.com.

Shuai-Cheng Wu, Email: wushuaicheng10@163.com.

Appendix. Supplementary materials

mmc1.doc (1.3MB, doc)

References

  1. Bescucci D.M., Moote P.E., Polo R.O., Uwiera R.R.E., Inglis G.D. Salmonella serovar typhimurium temporally modulates the enteric microbiota and host responses to overcome colonization resistance in Swine. Appl. Environ. Microb. 2020;86 doi: 10.1128/AEM.01569-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Byndloss M.X., Olsan E.E., Rivera-Chávez F., Tiffany C.R., Cevallos S.A., Lokken K.L., Torres T.P., Byndloss A.J., Faber F., Gao Y., Litvak Y., Lopez C.A., Xu G., Napoli E., Giulivi C., Tsolis R.M., Revzin A., Lebrilla C.B., Bäumler A.J. Microbiota-activated PPAR-γ signaling inhibits dysbiotic Enterobacteriaceae expansion. Science (New York, N.Y.) 2017;357:570–575. doi: 10.1126/science.aam9949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Choi J., Yadav S., Vaddu S., Thippareddi H., Kim W.K. In vitro and in vivo evaluation of tannic acid as an antibacterial agent in broilers infected with Salmonella Typhimurium. Poultry Sci. 2023;102 doi: 10.1016/j.psj.2023.102987. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Crowley S.M., Han X., Allaire J.M., Stahl M., Rauch I., Knodler L.A., Vallance B.A. Intestinal restriction of Salmonella Typhimurium requires caspase-1 and caspase-11 epithelial intrinsic inflammasomes. PLoS. Pathog. 2020;16 doi: 10.1371/journal.ppat.1008498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dar M.A., Urwat U., Ahmad S.M., Ahmad R., Kashoo Z.A., Dar T.A., Bhat S.A., Mumtaz P.T., Shabir N., Shah R.A., Heidari M. Gene expression and antibody response in chicken against Salmonella Typhimurium challenge. Poultry Sci. 2019;98:2008–2013. doi: 10.3382/ps/pey560. [DOI] [PubMed] [Google Scholar]
  6. Faber F., Tran L., Byndloss M.X., Lopez C.A., Velazquez E.M., Kerrinnes T., Nuccio S.P., Wangdi T., Fiehn O., Tsolis R.M., Baumler A.J. Host-mediated sugar oxidation promotes post-antibiotic pathogen expansion. Nature. 2016;534:697–699. doi: 10.1038/nature18597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Fattinger S.A., Böck D., Di Martino M.L., Deuring S., Ventayol P.S., Ek V., Furter M., Kreibich S., Bosia F., Müller-Hauser A.A., Nguyen B.D., Rohde M., Pilhofer M., Hardt W.D., Sellin M.E. Salmonella Typhimurium discreet-invasion of the murine gut absorptive epithelium. PLoS. Pathog. 2020;16 doi: 10.1371/journal.ppat.1008503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Filidou E., Kandilogiannakis L., Shrewsbury A., Kolios G., Kotzampassi K. Probiotics: shaping the gut immunological responses. World J. Gastroentero. 2024;30 doi: 10.3748/wjg.v30.i15.2096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Galán J.E. Salmonella Typhimurium and inflammation: a pathogen-centric affair. Nat. Rev. Microbiol. 2021;19:716–725. doi: 10.1038/s41579-021-00561-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Gao B.B., Wang L., Li L.Z., Fei Z.Q., Wang Y.Y., Zou X.M., Huang M.C., Lei S.S., Li B. Beneficial effects of oxymatrine from Sophora flavescens on alleviating Ulcerative colitis by improving inflammation and ferroptosis. J. Ethnopharmacol. 2024;332 doi: 10.1016/j.jep.2024.118385. [DOI] [PubMed] [Google Scholar]
  11. Gül E., Enz U., Maurer L., Younes A.Abi, Fattinger S.A., Nguyen B.D., Hausmann A., Furter M., Barthel M., Sellin M.E., Hardt W.D. Intraluminal neutrophils limit epithelium damage by reducing pathogen assault on intestinal epithelial cells during Salmonella gut infection. PLoS. Pathog. 2023;19 doi: 10.1371/journal.ppat.1011235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gül E., Huuskonen J., Younes A.Abi, Maurer L., Enz U., Zimmermann J., Sellin M.E., Bakkeren E., Hardt W.D. Salmonella T3SS-2 virulence enhances gut-luminal colonization by enabling chemotaxis-dependent exploitation of intestinal inflammation. Cell Rep. 2024;43 doi: 10.1016/j.celrep.2024.113925. [DOI] [PubMed] [Google Scholar]
  13. Jing C.W., Niu J.X., Liu Y., Jiao N., Huang L.B., Jiang S.Z., Yan L., Yang W.R., Li Y. Tannic acid extracted from galla chinensis supplementation in the diet improves intestinal development through suppressing inflammatory responses via blockage of NF-κB in broiler chickens. Animals-Basel. 2022;12 doi: 10.3390/ani12182397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jing W., Xiaolan C., Yu C., Feng Q., Haifeng Y. Pharmacological effects and mechanisms of tannic acid. Biomed. PharmacOther. 2022;154 doi: 10.1016/j.biopha.2022.113561. [DOI] [PubMed] [Google Scholar]
  15. Khan S., Moore R.J., Stanley D., Chousalkar K.K. The gut microbiota of laying hens and its manipulation with prebiotics and probiotics to enhance gut health and food safety. Appl. Environ. Microb. 2020;86 doi: 10.1128/AEM.00600-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Leleiwi I., Kokkinias K., Kim Y., Baniasad M., Shaffer M., Sabag-Daigle A., Daly R.A., Flynn R.M., Wysocki V.H., Ahmer B.M.M., Borton M.A., Wrighton K.C. Gut microbiota carbon and sulfur metabolisms support Salmonella infections. ISMe J. 2024;18 doi: 10.1093/ismejo/wrae187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Leyva-Diaz A.A., Hernandez-Patlan D., Solis-Cruz B., Adhikari B., Kwon Y.M., Latorre J.D., Hernandez-Velasco X., Fuente-Martinez B., Hargis B.M., Lopez-Arellano R., Tellez-Isaias G. Evaluation of curcumin and copper acetate against Salmonella Typhimurium infection, intestinal permeability, and cecal microbiota composition in broiler chickens. J. Anim. Sci. Biotechno. 2021;12 doi: 10.1186/s40104-021-00545-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Li X., Tang Z., Wen L., Jiang C., Feng Q. Matrine: A review of its pharmacology, pharmacokinetics, toxicity, clinical application and preparation researches. J. Ethnopharmacol. 2021;269 doi: 10.1016/j.jep.2020.113682. [DOI] [PubMed] [Google Scholar]
  19. Liu Z., Du J., Wang Y.H., Song H.Y., Lu L.G., Wu R., Jin C.H. The NLRP3 molecule is responsible for mediating the pyroptosis of intestinal mucosa cells and plays a crucial role in Salmonellosis enteritis in chicks. Mol. Immunol. 2024;168:47–50. doi: 10.1016/j.molimm.2024.02.009. [DOI] [PubMed] [Google Scholar]
  20. Mao N.N., Yu Y.M., Cui J.Q., He J., Yang Y., Wang D.Y. Effect of Matrine on growth performance, gut health, and gut microbiota in chickens infected with avian pathogenic Escherichia coli. Poultry Sci. 2025;104 doi: 10.1016/j.psj.2024.104520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Robinson K., Assumpcao A.L.F., Arsi K., Erf G.F., Donoghue A., Jesudhasan P.R.R. Effect of Salmonella Typhimurium colonization on microbiota maturation and blood leukocyte populations in broiler chickens. Animals-Basel. 2022;12 doi: 10.3390/ani12202867. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Saleh M., Verma A., Shaaban K.A., Helmy Y.A. Antibiotic alternatives and next-generation therapeutics for salmonella control: a one health approach to combating antimicrobial resistance. Antibiotics-Basel. 2025;14 doi: 10.3390/antibiotics14101054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Shaji S., Selvaraj R.K., Shanmugasundaram R. Salmonella infection in poultry: a review on the pathogen and control strategies. Microorganisms. 2023;11 doi: 10.3390/microorganisms11112814. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Shakir M.Z., Rizvi F., Javed M.T., Arshad M.I. Seroprevalence and pathological studies of Salmonella infection in commercial white layer birds. Microb. Pathogenesis. 2021;159 doi: 10.1016/j.micpath.2021.105146. [DOI] [PubMed] [Google Scholar]
  25. Shuai-Cheng W., Xiu-Ling C., Jian-Qing S., Zong-Mei W., Zhen-Jiang Y., Lian-Tao L. Saikosaponin A protects chickens against pullorum disease via modulation of cholesterol. Poult. Sci. 2019;98:3539–3547. doi: 10.3382/ps/pez197. [DOI] [PubMed] [Google Scholar]
  26. Wang J.Y., Yao L., Su J., Fan R.R., Zheng J.Q., Han Y.Z. Effects of Lactobacillus plantarum and its fermentation products on growth performance, immune function, intestinal pH, and cecal microorganisms of Lingnan yellow chicken. Poultry Sci. 2023;102 doi: 10.1016/j.psj.2023.102610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wang M., Hu J., Yu H., Li W.H., He G.Y., Dong J.S., Liu Y.N., Shi S.Q. Lactobacillus fermentum 1.2133 display probiotic potential in vitro and protect against Salmonella pullorum in chicken of infection. Lett. Appl. Microbiol. 2023;76 doi: 10.1093/lambio/ovac041. [DOI] [PubMed] [Google Scholar]
  28. Wang W.W., Ou J.S., Ye H., Cao Q.Y., Zhang C.M., Dong Z.M., Feng D.Y., Zuo J.N. Supplemental N-acyl homoserine lactonase alleviates intestinal disruption and improves gut microbiota in broilers challenged by Salmonella Typhimurium. J. Anim. Sci. Biotechno. 2023;14 doi: 10.1186/s40104-022-00801-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Wang X., Wu X.J., Cong X.Y., Ren J.R., Li J.T., Zhu J.S., Dai M.X., Hrabchenko N., Du Y.J., Qi J. The functional role of fecal microbiota transplantation on Salmonella Enteritidis infection in chicks. Vet. Microbiol. 2022;269 doi: 10.1016/j.vetmic.2022.109449. [DOI] [PubMed] [Google Scholar]
  30. Xu H.P., Gong L., Zhang X.D., Li Z.Y., Fu J.Y., Lv Z.P., Guo Y.M. Effects of tannic acid on growth performance, intestinal health, and tolerance in broiler chickens. Poultry Sci. 2025;104 doi: 10.1016/j.psj.2024.104676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Yoo W., Shealy N.G., Zieba J.K., Torres T.P., Baltagulov M., Thomas J.D., Shelton C.D., McGovern A.G., Foegeding N.J., Olsan E.E., Byndloss M.X. Salmonella Typhimurium expansion in the inflamed murine gut is dependent on aspartate derived from ROS-mediated microbiota lysis. Cell Host. Microbe. 2024;32 doi: 10.1016/j.chom.2024.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Zhang C.Z., Yao D.W., Su Z.A., Chen H., Hao P., Liao Y., Guo Y.W., Yang D.J. Copper/Zinc-modified palygorskite protects against Salmonella Typhimurium infection and modulates the intestinal microbiota in chickens. Front. Microbiol. 2021;12 doi: 10.3389/fmicb.2021.739348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Zhang K.Y., Repnik U., Diab N., Friske D., Pütz A., Bachmann A.Z., Gubbi N.M.K.P., Hensel M., Förstner K.U., Westermann A.J., Dupont A., Hornef M.W. Non-professional efferocytosis of Salmonella-infected intestinal epithelial cells in the neonatal host. J. Exp. Med. 2024;221 doi: 10.1084/jem.20231237. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Zhao X., Zheng S.M., Wei S.M., Tian Q.M., Tao Y., Bo R.N., Liu M.J., Li J.G. The protective effect and potential mechanisms of eugenol against Salmonella in vivo and in vitro. Poultry Sci. 2022;101 doi: 10.1016/j.psj.2022.101801. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

mmc1.doc (1.3MB, doc)

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES