microRNA-422a promotes HIV replication and innate immune evasion by targeting MECP2

Abstract

Understanding the mechanisms underlying interferon-alpha (IFNα) anti-human immunodeficiency virus type I (HIV-1) effects and HIV-1 innate immune evasion is critical to developing improved antiviral strategies. We previously reported that the microRNA (miRNA) miR-422a was the sole miRNA downregulated by IFNα treatment in vivo in people living with HIV (PLWH), and the extent of miR-422a reduction was correlated with viral load reduction. Here, we investigated the molecular basis of this relationship by examining the role of miR-422a in HIV replication and innate immune evasion. We observed that HIV-1 infection induces miR-422a expression in primary CD4+ T cells via the viral Nef accessory protein. miR-422a enhanced HIV-1 replication in CD4+ T cells by directly targeting the host factor methyl CpG binding protein 2 (MECP2). Transcriptomic analysis revealed that miR-422a depletion mimicked IFNα exposure, inducing the expression of several IFN-stimulated genes (ISGs) that restrict HIV-1 replication. Finally, we demonstrated that miR-422a overexpression or CRISPR-Cas9-mediated MECP2 knockout counteracts IFNα antiviral capacity and rescues HIV-1 replication. Together, our findings reveal that miR-422a is a key host factor induced by HIV-1 infection that supports viral replication and subverts type I IFN-mediated antiviral responses via targeting of MECP2. Virologic control in PLWH may be achieved by pharmacologic manipulation of the Nef-miR-422a-IFNα axis.

Graphical abstract

In this study, Du and colleagues describe microRNA-422a (miR-422a) as a novel host factor and potential therapeutic target that supports HIV-1 replication and immune evasion. The HIV-1 accessory protein Nef induces miR-422a, which suppresses methyl CpG binding protein 2 (MECP2), thereby inhibiting the interferon antiviral response.

Introduction

Human immunodeficiency virus type I (HIV-1), the causative agent of acquired immunodeficiency syndrome (AIDS), remains a global health challenge. Cure of HIV infection has been elusive due to the persistence of latent viral reservoirs that fuel viral rebound upon antiretroviral therapy (ART) interruption.^1,2 Robust early innate responses are observed in elite controllers, people living with HIV (PLWH) who control HIV to undetectable levels in the absence of ART, providing a template for how innate immune-based therapies may be implemented to achieve a functional cure.^3,4,5

Type 1 interferons (IFN-I) are among the earliest innate responses to infection and play an essential role in antiviral activity.⁶ During acute HIV-1 infection, robust concentrations of IFN-I are produced rapidly, which then activate signal transduction pathways by interacting with the IFN-α/β receptor (IFNAR).⁷ Activated IFN-I signaling pathways, comprising hundreds of IFN-stimulated genes (ISGs), are known to control HIV-1 replication at multiple life cycle stages in vitro.⁸ For example, APOBEC3G suppresses HIV-1 replication by converting cytidines to uridines in the minus-strand DNA during reverse transcription, leading to lethal hypermutation of the virus genome.⁹ The ISG MX2 inhibits nuclear import of subviral complexes to restrict HIV-1 replication.¹⁰ Consistent with the anti-HIV-1 activity of IFN-I in vitro, IFN-I treatment, especially IFNα2 treatment, was developed as a therapy to treat HIV-1 infection prior to the development of small-molecule antiretroviral inhibitors.^11,12 Following the development of ART, clinical trials have demonstrated that pegylated IFNα2 administration decreases levels of cell-associated integrated HIV DNA and extends the period of virologic control after ART interruption.¹² Importantly, HIV-1 has evolved diverse strategies to counteract IFNα-mediated antiviral effects.¹³ HIV-1 disrupts innate viral sensing and type I IFN-induced restriction factors through its Vif, Vpu, and Nef accessory proteins and shows heightened resistance to IFN-I at transmission.^14,15,16 The dynamic interplay between IFN-I and HIV-1 represents a critical balance that influences the progression and persistence of HIV-1 infection.^17,18,19 Therefore, a deeper understanding of the mechanisms underlying IFNα anti-HIV-1 effects and HIV-1 innate immune evasion is critical to developing improved therapeutic and curative strategies.

MicroRNAs (miRNAs) are a class of small (approximately 22-nucleotide) non-coding RNAs that regulate gene expression by degrading messenger RNAs (mRNAs) or inhibiting mRNA translation through complementary pairing with specific target mRNAs.²⁰ miRNAs regulate a wide range of biological processes, such as development, differentiation, and immune responses, acting as key modulators of cellular homeostasis and disease progression.^21,22 In the context of HIV-1 infection, miRNAs play crucial roles in the biological crosstalk between the virus and host cellular machinery.^23,24,25,26 Several studies have shown that miRNAs directly or indirectly inhibit HIV-1 replication. For instance, miR-28, miR-125b, miR-150, miR-223, and miR-382 directly target the HIV-1 3′ untranslated region (UTR) to inhibit HIV-1 production.²⁷ miR-198 and miR-27b target the supportive host factor cyclin T1 (cycT1) to indirectly suppress HIV-1 transcription.^28,29 Conversely, HIV-1 can reprogram the host via manipulation of miRNA expression to promote viral replication and persistence. miR-132 is upregulated by HIV-1 infection and facilitates HIV-1 replication by suppressing the host factor methyl CpG binding protein 2 (MECP2).³⁰ To specifically evaluate the role of miRNAs in the suppression of HIV-1 mediated by IFNα, we previously profiled 754 miRNAs in longitudinal clinical specimens from IFNα/ribavirin (RBV)-treated, ART-naive HIV/hepatitis C virus (HCV)-coinfected individuals.³¹ Our study revealed that miR-422a was the sole miRNA downregulated by IFN-α treatment in HIV-infected individuals in vivo, and the extent of miR-422a reduction significantly correlated with viral load reduction.³¹ However, the mechanisms underlying this relationship remained to be elucidated.

In this study, we employed a systems approach to investigate the molecular mechanisms linking IFNα signaling, miR-422a activity, and HIV-1 replication. Our data reveal that miR-422a is a critical host dependency factor (HDF) induced by HIV-1 infection that promotes viral replication and impairs the IFNα-mediated antiviral response by targeting the MECP2 transcriptional regulator. Our study highlights miR-422a as a promising target for therapeutic strategies aimed at enhancing HIV-1 suppression and overcoming viral immune evasion.

Results

IFNα downregulates miR-422a in CD4+ T cells through the JAK-STAT signaling pathway

Our previous studies demonstrated that miR-422a expression is significantly modulated by IFNα/RBV combination treatment in peripheral blood mononuclear cells (PBMCs).³¹ We first sought to determine whether IFNα treatment alone is capable of suppressing the expression of miR-422a in CD4+ T cells ex vivo using recombinant IFN-α2a. To confirm the relevant bioactivity of IFN-α2a, we assessed its impact on ISG expression and HIV-1 infection in CD4+ T cells. Jurkat and primary CD4+ T cells were pretreated with IFNα and subsequently infected with replication-competent CXCR4-tropic virus (HIV-1_NL4-3). HIV-1 infection was measured by flow cytometry for intracellular Gag expression and ELISA for p24 protein levels in culture supernatants. Consistent with expected IFNα-mediated effects, ISG15 expression was upregulated in a dose-dependent manner (p < 0.05), and HIV-1 infection was suppressed in CD4+ T cells (p < 0.01) (Figure S1).

Next, we pretreated Jurkat cells with varying doses of recombinant IFNα and analyzed miR-422a expression. Consistent with our prior in vivo findings,³¹ our results showed that miR-422a expression was decreased in a dose-dependent manner following IFNα treatment in Jurkat cells (p < 0.05) (Figure 1A). Additionally, we treated primary CD4+ T cells, both resting (unstimulated) and activated via CD3/CD28 stimulation (stimulated), with 1000 units of IFNα to evaluate miR-422a levels. Our results revealed that miR-422a expression was significantly inhibited by IFNα in both unstimulated (p < 0.05) and stimulated primary CD4+ T cells (p < 0.05) (Figure 1B). Furthermore, miR-422a expression was markedly upregulated upon CD3/CD28 stimulation (p < 0.05) (Figure 1B) in a time-dependent manner (p < 0.01) (Figure 1C).

Figure 1.

IFNα downregulates miR-422a in unstimulated and stimulated CD4+ T cells

(A) Jurkat cells were treated with the indicated concentrations of IFNα for 72 h, after which the cells were harvested and analyzed by RT-qPCR to detect miRNA expression. (B) Unstimulated and stimulated (treatment with anti-CD3/CD28 beads for 3 days) primary CD4+ T cells were treated with IFNα for 72 h, after which the cells were harvested and analyzed by RT-qPCR to detect miR-422a expression. (C) Primary CD4+ T cells were stimulated with anti-CD3/CD28 beads, then miR-422a expression was determined by RT-qPCR at each time point. (D) Stimulated CD4+ T cells were pretreated with baricitinib for 24 h, then the cells were incubated with IFNα for 72 h, and miR-422a were detected by RT-qPCR. Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by unpaired or paired student t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

IFNα triggers Janus kinase-signal transducers and activators of transcription (JAK-STAT) signaling pathways upon binding to its receptor, which has two distinct subunits, IFNα receptor 1 and 2.³² To confirm that the observed effects on miR-422a expression were mediated through JAK-STAT signaling, we administered the JAK1/JAK2 inhibitor baricitinib to IFNα-treated cells. As expected, suppression of miR-422a was fully abrogated in the presence of baricitinib (p < 0.01) (Figure 1D). Taken together, our data demonstrate that IFNα potently suppresses miR-422a in CD4+ T cells, mirroring our previous in vivo observations.³¹

HIV-1 infection induces miR-422a expression in primary CD4+ T cells via expression of Nef

Our previous findings also indicated a significant correlation between the reduction of miR-422a and the suppression of HIV-1 viral load following IFNα treatment.³¹ Given that both HIV-1 infection and miR-422a expression are modulated by IFNα, we sought to determine whether HIV-1 infection could directly regulate miR-422a expression. To address this, we performed a time course experiment to measure miR-422a levels in primary CD4+ T cells infected with HIV-1_NL4-3. Supernatant p24 antigen production was measured in primary CD4+ T cell cultures over the course of 12 days (Figure 2A). In addition to monitoring levels of the mature, fully processed, and bioactive version of miR-422a, we measured levels of the primary miR-422a (pri-miR-422a). Our results showed that both the primary and mature miR-422a versions were significantly increased postinfection in a time-dependent manner (p < 0.05) (Figures 2B and 2C), indicating that miR-422a is upregulated by HIV-1 replication. To further confirm that HIV-1 infection directly induces miR-422a expression, we infected primary CD4+ T cells with a single-cycle HIV-EGFP reporter virus (HIV_NL4-3 ΔEnv EGFP reporter with vesicular stomatitis virus G protein [VSV-G] envelope). After infection, EGFP-positive and EGFP-negative cells were isolated by fluorescence-activated cell sorting (FACS), and miR-422a expression was measured. miR-422a levels were significantly higher in EGFP-positive cells compared to EGFP-negative cells (p < 0.0001) (Figure 2D), demonstrating that HIV-1 specifically induces miR-422a in infected target cells.

Figure 2.

HIV infection induces miR-422a in CD4+ T cells via expression of Nef

(A) Primary CD4+ T cells were stimulated with anti-CD3/CD28 beads for 3 days, then infected with HIV-1_NL4-3. The spreading infection was measured by evaluating supernatant p24 concentrations by ELISA at each time point. (B and C) The primary (B) and mature miR-422a expression levels (C) were measured by RT-qPCR after infection with HIV-1 in primary CD4+ T cells, as described in (A). (D) Stimulated primary CD4+ T cells were infected with an HIV-1 single-round reporter virus (VSVG-pseudotyped HIV_NL4-3 ΔEnv EGFP reporter virus) for 3 days. Cells were then sorted based on EGFP expression using the Sony MA900 multi-application cell sorter and harvested for RNA isolation. miR-422a expression was measured by RT-qPCR. (E) Stimulated primary CD4+ T cells were infected with HIV-1 single-round reporter virus (VSVG-pseudotyped HIV_NL4-3 ΔEnv ΔNef GFP reporter virus) for 3 days. Cells were then sorted based on GFP expression for RNA isolation. miR-422a expression was measured by RT-qPCR. (F) Nef was nucleofected into stimulated primary CD4+ T cells for 48 h. Cells were then collected to evaluate miR-422a expression by RT-qPCR. G. Nef was nucleofected into stimulated primary CD4+ T cells for 48 h. Cells were then stained with anti-CD25 and anti-69 antibodies to detect CD25 and CD69 expression by flow cytometry. Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by unpaired or paired student t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

Numerous reports demonstrate that the HIV-1 Nef accessory protein is a multifunctional protein that modulates the virus-host immune interface to enhance viral replication.^{33,34,35,36,37,38} We sought to determine whether the presence of the viral Nef protein impacts miR-422a expression in infected cells. In contrast to results observed when infecting with a Nef-expressing EGFP reporter virus, infection with a single-cycle HIV-GFP reporter virus lacking Nef (HIV_NL4-3 ΔEnv ΔNef GFP with VSV-G capsid) showed no difference in miR-422a expression between GFP-positive and GFP-negative cells (Figure 2E), suggesting that Nef is involved in miR-422a regulation during HIV-1 infection. To further investigate the role of Nef in miR-422a expression, we overexpressed HIV-1 Nef in primary CD4+ T cells using electroporation of a Nef-encoding plasmid. Our data showed that Nef induced miR-422a expression in a dose-dependent manner in primary CD4+ T cells (p < 0.01) (Figure 2F). Based on controversial reports that Nef directly induces CD4+ T cell activation,³⁹ we examined the relationship between Nef expression in our model and the expression of the CD25 and CD69 activation markers. Our data showed that Nef had no effect on CD25 and CD69 expression (Figure 2G), suggesting that HIV-1 infection induces miR-422a expression in primary CD4+ T cells through an activity of Nef that is unlinked to T cell activation.

miR-422a facilitates HIV-1 replication by directly targeting MECP2

To investigate the impact of miR-422a on HIV-1 replication, we first used lentiviral delivery of CRISPR-Cas9 machinery to knockout (KO) miR-422a in Jurkat cells. Our data demonstrate that miR-422a KO significantly inhibited HIV-1 replication compared to viral growth in scramble-transduced control cells (p < 0.05) (Figure S2). We next conducted HIV-1 infection assays using primary CD4+ T cells transfected with either miR-422a mimics or miR-422a antagomir. As expected, miR-422a expression was elevated following transfection with miR-422a mimics and in response to HIV-1 infection (p < 0.01) (Figure 3A), while the miR-422a antagomir effectively reduced its expression (p < 0.05) (Figure 3B). HIV-1 replication was assessed by measuring tat-rev mRNA levels, p24 concentrations in cell culture supernatants, and Gag expression using flow cytometry. Our results revealed that miR-422a mimics significantly enhanced tat-rev expression and p24 levels after 6 days of infection (p < 0.05), whereas the miR-422a antagomir had the opposite effect, suppressing viral replication (p < 0.05) (Figures 3C–3E). Additionally, flow cytometric analysis showed a time-dependent increase in the percentage of Gag-positive cells with miR-422a mimics (p < 0.05) and a corresponding decrease with the miR-422a antagomir (p < 0.05) (Figures 3F and 3G). Notably, in unstimulated CD4+ T cells, miR-422a mimics enhanced (p < 0.01), whereas the miR-422a antagomir suppressed, HIV-1 replication (p < 0.05) (Figure 3H). Together, these findings demonstrate that miR-422a promotes HIV-1 replication in CD4+ T cells, even in typically refractory cells that have not been stimulated through the T cell receptor (TCR).

Figure 3.

miR-422a facilitates HIV replication in CD4+ T cells

(A) Stimulated primary CD4+ T cells were transfected with miR-422a mimic or mimic negative control (NC) for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). 6 days after infection, cells were collected for RNA isolation. miR-422a expression was detected by RT-qPCR. (B) Stimulated primary CD4+ T cells were transfected with miR-422a antagomir or antagomir negative control (NCi) for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). 6 days after infection, cells were collected for RNA isolation. miR-422a expression was detected by RT-qPCR. (C–E) Stimulated primary CD4+ T cells were transfected with miR-422a mimic or miR-422a antagomir for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). 6 days after infection, cells were collected for RNA isolation. HIV-1 tat-rev expression was detected by RT-qPCR (C and D). Supernatants were harvested to measure p24 concentration by ELISA (E). (F) Representative plot describing the protein levels of Gag in HIV-1_NL4-3-infected cells. Stimulated primary CD4+ T cells were transfected with miR-422a mimic or miR-422a antagomir for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). 9 days after infection, cells were fixed and permeabilized, then stained with RD-fluorescent Gag antibody to detect Gag expression by flow cytometry. (G) The percentage of Gag-positive cells was determined by flow cytometry at each time point post-HIV-1_NL4-3 infection. Treatment was as described in (F). (H). Unstimulated cells were transfected with miR-422a mimic or miR-422a antagomir for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). 6 days after infection, cells were fixed and permeabilized, then stained with rhodamine dye (RD)-fluorescent Gag antibody to detect Gag expression by flow cytometry. The percentage of Gag-positive cells was determined by flow cytometry. Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by paired t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

Next, to investigate the mechanisms underlying miR-422a-mediated enhancement of HIV-1 infection, we performed miR-422a target prediction based on complementarity between the miRNA seed sequence and the 3′ UTR of target genes and mined functional annotations using the miRDB database. By integrating the predicted target list with known HIV-1 restriction factors,^30,40 we identified MECP2 as a potential target of miR-422a, with two conserved binding sites in the 3′UTR region across mammals (Figure 4A). To verify whether MECP2 is a direct target of miR-422a, we cloned part of the MECP2 3′UTR, including the two predicted target sites, into a firefly luciferase reporter vector (3′UTR). We also constructed three mutant vectors (3′UTR SITE1 MUTANT, 3′UTR SITE2 MUTANT, 3′UTR SITE1&2 MUTANT) with mutations of nucleotides in the seed regions (Figure 4A). HEK-293T cells were co-transfected with these vectors and miR-422a mimics for 24 h, followed by luciferase activity analysis. The results showed that the miR-422a mimic significantly reduced the luciferase activity of the MECP2 3′UTR, as well as the SITE1 and SITE2 mutants, compared to the negative control. However, luciferase activity was not affected in the 3′UTR SITE1&2 MUTANT, confirming that both seed regions are direct binding sites for miR-422a (p < 0.05) (Figure 4B). To further validate that MECP2 is the target of miR-422a, we measured MECP2 mRNA and protein expression after miR-422a transfection in unstimulated and stimulated primary CD4+ T cells. As expected, MECP2 mRNA levels were decreased when miR-422a mimics were transfected in both unstimulated (p < 0.01) and stimulated primary CD4+ T cells (p < 0.05) (Figure 4C). MECP2 protein expression was also suppressed by the miR-422a mimic in a dose-dependent manner (p < 0.01) (Figures 4D and 4E). These results demonstrate that MECP2 is a direct target of miR-422a in primary CD4+ T cells.

Figure 4.

miR-422a directly targets MECP2

(A) Schematic diagram showing the predicted miR-422a target sites within the MECP2 3′UTR. The predicted target seed sites and their corresponding mutated sequences are highlighted in red. (B) HEK-293T cells were cotransfected with MECP2 3′UTR luciferase reporter vector (wild-type or mutant versions), pRL-TK, and miR-422a mimic or negative control (NC) for 24 h. Cells were then harvested for luciferase analysis. Relative luciferase activity is shown. (C) Unstimulated or stimulated primary CD4+ T cells were transfected with miR-422a mimic or NC for 72 h. Cells were then collected to detect MECP2 mRNA levels by RT-qPCR. (D) Stimulated primary CD4+ T cells were transfected with the indicated concentrations of miR-422a mimic or NC for 72 h. Cells were then collected to detect MECP2 protein levels by western blot. β-actin was used as the endogenous control. (E) Relative quantification of MECP2 protein from the western blot in (D). (F) MECP2 protein expression was analyzed by western blot following the establishment of stable cell lines. (G) MECP2 KO-Jurkat or scramble-Jurkat cells were infected with HIV-1_NL4-3. The percentage of Gag-positive cells was detected by flow cytometry at the indicated time point. (H and I) Stimulated primary CD4+ T cells were nucleofected with Cas9-RNP targeting MECP2 for 24 h, then infected with HIV-1_NL4-3 for 6 days. Cells and supernatants were collected for Gag detection and p24 measurements by flow cytometry (H) and ELISA (I), respectively. (J) MECP2 KO-Jurkat or scramble-Jurkat cells were transfected with miR-422a mimic or its NC for 24 h, then infected with HIV-1_NL4-3 (or left uninfected). Six days after infection, cells were collected, fixed, and permeabilized, then stained with RD-fluorescent Gag antibody to detect Gag expression by flow cytometry. The percentage of Gag-positive cells was determined by flow cytometry. Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by unpaired or paired student t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

To further confirm the role of MECP2 in HIV-1 replication, we established a MECP2-depleted model in Jurkat cells by stably transfecting the cells with CRISPR-Cas9 and single-guide RNA (sgRNA) targeting MECP2. As shown in Figure 4F, MECP2 expression was significantly depleted in MECP2 KO-Jurkat cells compared with scramble-Jurkat cells. Scramble-Jurkat and MECP2 KO-Jurkat cells were infected with HIV-1_NL4-3, and the efficiency of viral infection and replication was assessed by measuring the Gag protein at 2 and 5 days postinfection. The intracellular level of HIV-1 Gag protein expression measured by flow cytometry was found to be increased in a time-dependent manner in infected MECP2-KO Jurkat cells (p < 0.001) (Figure 4G). To validate these findings in primary CD4+ T cells, we introduced MECP2-specific sgRNA into primary CD4+ T cells using the CRISPR ribonucleoprotein (RNP) transfection method. MECP2-depleted primary CD4+ T cells showed significantly higher percentages of Gag-positive cells (p < 0.01) (Figure 4H) and elevated p24 levels (p < 0.05) (Figure 4I) in culture supernatants after 6 days of infection, consistent with the pro-viral effect observed in Jurkat cells. To rigorously demonstrate that the effect of miR-422a on HIV replication is mediated by MECP2, we transfected miR-422a mimic or negative control (NC) into scramble-Jurkat and MECP2 KO-Jurkat cells. As shown in Figure 4J, miR-422a mimic transfection significantly enhanced HIV replication in scramble cells compared to the NC (p < 0.05). However, miR-422a mimic transfection did not further enhance replication relative to the NC in MECP2 KO-Jurkat cells (p > 0.05). Taken together, these results demonstrate that miR-422a enhances HIV-1 replication in primary CD4+ T cells by negatively regulating MECP2.

miR-422a inhibition induces ISG expression in primary CD4+ T cells

To further investigate the pathways modulated by miR-422a, we profiled the transcriptomes of primary CD4+ T cells from three different healthy donors transfected with either miR-422a mimic or miR-422a antagomir. Cells transfected with NC or NCi were used as negative controls and references for miR-422a mimic or miR-422a antagomir treatment, respectively. Differentially-expressed gene (DEG) analysis was conducted with a false discovery rate (FDR) cutoff of 0.05. Sixty-seven genes were significantly modulated by miR-422a mimic transfection (Figure 5A; Table S1). miR-422a antagomir-transfected cells exhibited a dramatic impact on the host transcriptome, with 932 DEGs identified (Figures 5B; Table S2). Interestingly, we cross-referenced the antagomir-associated DEGs with the HIV-1 Human Interaction Database⁴¹ and found that several of the induced DEG products are recognized inhibitors of HIV-1 replication (Table S3). Moreover, multiple ISGs were upregulated in response to miR-422a antagomir transfection (Table S4). To further investigate potential overlap between IFNα treatment and miR-422a manipulation, we also profiled the transcriptomes of primary CD4+ T cells treated with IFNα for 3 days, revealing that 232 genes were significantly modulated by IFNα exposure (Figures 5C; Table S5). When we specifically evaluated the activation Z scores of upstream regulators (URs) associated with IFN-signaling pathway genes using Ingenuity Pathway Analysis (IPA), we found that miR-422a antagomir transfection and IFNα exposure exerted highly concordant effects on the predicted regulatory activity (Spearman R = 0.5398, p < 0.0001) (Figure 5D). Using IPA (Figure 5E) and GeneMANIA database (Figures S3A and S3B), we leveraged the DEG lists to identify gene expression pathways modulated by miR-422a manipulation. Our data showed that the transcriptomic changes induced by miR-422a antagomir in primary CD4+ T cells are enriched for genes associated with antiviral activity and immune response, aligning with our finding that miR-422a antagomir promotes IFNα signaling and suppresses HIV-1 replication.

Figure 5.

miR-422a and IFNα potently modulate the CD4+ T cell transcriptome

(A–C) Volcano plots showing the proportion of differentially expressed genes (DEGs) in the setting of miR-422a mimic transfection (A), miR-422a antagomir transfection (B), and IFNα treatment (C) in stimulated primary CD4+ T cells. DEGs (FDR <0.05) with log2 (fold change) > 0 are indicated in red. DEGs (FDR < 0.05) with log2 (fold change) < 0 are indicated in blue. Nonsignificant DEGs are indicated in gray. (D) A simple linear regression analysis comparing the activation Z scores of IFN signaling upstream regulators predicted by IPA after treatment with miR-422a antagomir versus IFNα. Each point represents an upstream regulator, with its activation Z score after IFNα treatment on the x axis and after miR-422a treatment on the y axis. The linear trend line indicates a positive correlation between the effects of the two treatments on URs. URA, upstream regulator analysis. (E) Canonical pathways identified using ingenuity pathway analysis (IPA) after miR-422a antagomir treatment in stimulated primary CD4+ T cells.

miR-422a and MECP2 counteract IFNα suppression of HIV-1 replication

Building on these transcriptome signatures, we next assessed whether miR-422a could modulate the effect of IFNα on HIV-1 replication. Primary CD4+ T cells transfected with miR-422a mimic or antagomir were treated with IFNα and subsequently infected with HIV-1_NL4-3. Cells were harvested to detect intracellular Gag expression by flow cytometry at 3, 6, and 9 days postinfection. As expected, IFNα treatment markedly suppressed HIV-1 replication (p < 0.05) (Figures 6A–6D). Transfection with the miR-422a mimic significantly attenuated the inhibitory effect of IFNα on HIV-1 replication in primary CD4+ T cells (p < 0.05) (Figures 6A and 6B). In contrast, transfection with the miR-422a antagomir enhanced the IFNα-mediated suppression of HIV-1 replication (p < 0.05) (Figures 6C and 6D). To further investigate the effect of miR-422a on counteracting IFNα suppression of HIV-1 replication, we established a stable miR-422a-overexpressing Jurkat cell line (miR-422a-Jurkat), alongside a NC cell line (NC-Jurkat). These cells were treated with IFNα and subsequently infected with HIV-1_NL4-3. Consistent with prior observations, miR-422a overexpression enhanced HIV-1 replication in the absence of IFNα (p < 0.05) (Figure S4A). Quantitative analysis of the area under the curve describing viral replication kinetics showed that IFNα exerted greater suppressive efficacy in NC-Jurkat cells compared with miR-422a mimic-Jurkat cells (p < 0.0001) (Figures S4B and S4C). These results indicate that miR-422a functions as a host factor that promotes HIV-1 replication by partially antagonizing the IFN signaling pathway.

Figure 6.

miR-422a counteracts IFNα inhibition of HIV replication

(A) Representative plot describing the protein levels of Gag in HIV-1_NL4-3-infected cells. Stimulated primary CD4+ T cells were transfected with miR-422a mimic or NC for 24 h, then infected with HIV-1_NL4-3 and inoculated with IFNα at the same time. 9 days after infection, cells were fixed and permeabilized, then stained with RD-fluorescent Gag antibody to detect Gag expression by flow cytometry. (B) The percentage of Gag-positive cells was determined by flow cytometry at each time point post HIV-1_NL4-3 infection. Treatment was as described in (A). (C) Representative plot describing the protein levels of Gag in HIV-1_NL4-3-infected cells. Stimulated primary CD4+ T cells were transfected with miR-422a antagomir or NCi for 24 h, then infected with HIV-1_NL4-3 and inoculated with IFNα at the same time. 9 days after infection, cells were fixed and permeabilized, then stained with RD-fluorescent Gag antibody to detect Gag expression by flow cytometry. (D) The percentage of Gag-positive cells was determined by flow cytometry at each time point post-HIV-1_NL4-3 infection. Treatment was as described in (C). Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by paired t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

Since our study identified MECP2 as a target of miR-422a and a previous report demonstrated that MECP2 deficiency inhibits STAT1- and STAT3-dependent signaling pathways downstream of IFN-I signaling in mouse CD4+ T cells,⁴² we next sought to determine whether MECP2 reduction would counteract IFNα signaling and the IFNα-mediated inhibition of HIV-1 replication. As shown in Figure 7A, IFNα treatment induced STAT3 phosphorylation. Loss of MECP2 in Jurkat cells significantly reduced IFNα-mediated STAT3 phosphorylation and IFIT1 expression (p < 0.01) (Figures 7A–7C) and reversed IFNα-mediated suppression of HIV-1 replication (p < 0.0001) (Figures 7D; S5A). Further quantification analysis of the area under the curve describing viral replication kinetics demonstrated that IFNα exerted stronger suppressive effects in scramble-Jurkat cells relative to MECP2 KO-Jurkat cells (p < 0.0001) (Figure S5). Similarly, in primary CD4+ T cells, MECP2 depletion diminished IFNα-induced ISG15 expression (p < 0.01) (Figure 7E) and abrogated the inhibitory effect of IFNα on HIV-1 replication (p < 0.05) (Figure 7F), suggesting that downregulation of MECP2 counteracts the IFNα-induced antiviral signaling pathway.

Figure 7.

MECP2 counteracts IFNα activity

(A) Wild-type Jurkat cells (Jurkat), MECP2 KO-Jurkat cells, or scramble-Jurkat cells were treated with or without IFNα for 6 h. Cells were collected to detect MECP2, phosphorylation of STAT3, and STAT3 protein levels by western blot. GAPDH was used as the endogenous control. (B) Relative quantification of MECP2, phosphorylated STAT3, and total STAT3 protein from western blot (A). (C) MECP2 KO-Jurkat or scramble-Jurkat cells were treated with or without IFNα for 72 h. Cells were collected to detect IFIT1 expression by RT-qPCR. (D) MECP2 KO-Jurkat or scramble-Jurkat cells were treated with or without IFNα for 24 h, then infected with HIV-1_NL4-3 and treated again with IFNα at the same time. The percentage of Gag-positive cells was determined by flow cytometry at each time point post HIV-1_NL4-3 infection. (E) Stimulated primary CD4+ T cells were nucleofected with Cas9 RNP targeting MECP2 for 24 h, then treated with IFNα for 72 h. Cells were collected to detect ISG15 expression by RT-qPCR. (F) Stimulated primary CD4+ T cells were nucleofected with Cas9 RNP targeting MECP2 for 24 h, then infected with HIV-1_NL4-3 and treated with IFNα at the same time. The percentage of Gag-positive cells was determined by flow cytometry after 6 days of HIV-1 infection. Each dot represents data from one donor. Data are representative of the results of three independent experiments (n = 3 biologically independent samples, mean ± SEM). Statistical significance was analyzed by unpaired or paired student t tests. p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗].

Discussion

The complex interplay between type I IFNs (IFN-I) and HIV-1 plays a critical role in determining the progression and persistence of HIV-1 infection.^18,19,43 Understanding the mechanisms that govern IFN-I-mediated antiviral responses, along with the viral strategies that subvert these defenses, is critical for identifying pharmacologic targets that may contribute to an HIV-1 cure. Our previous findings identified miR-422a as the only miRNA significantly downregulated by IFNα treatment in HIV-infected individuals, with its reduction closely correlating with viral load suppression.³¹ In this study, we identified miR-422a as a critical HDF supporting HIV replication that counteracts IFN-mediated innate antiviral defense mechanisms. These results suggest that pharmacologic inhibition or gene therapy targeting of miR-422a could offer a strategy to enhance HIV control or prevent HIV acquisition in vivo.

We have established that miR-422a promotes HIV-1 infection based on the following observations: 1) miR-422a enhances HIV-1 replication and 2) miR-422a counteracts IFNα suppression of HIV-1 replication. Our experimental results, including measurements of HIV-1 tat-rev transcripts, Gag protein expression, and virion release, demonstrate that miR-422a promotes HIV-1 replication in primary CD4+ T cells. Mechanistically, miR-422a increases HIV-1 replication by directly targeting the 3′UTR of MECP2, reducing MECP2 mRNA and protein levels. Loss of MECP2 abrogated the ability of miR-422a to enhance HIV replication. Our data describing miR-422a regulation of MECP2 align with a recent study reporting that miR-422a targets MECP2 to promote adipogenesis in human bone marrow mesenchymal stem cells.⁴⁴ Loss-of-function studies in both Jurkat and primary CD4+ T cells confirmed that MECP2 KO facilitated HIV-1 infection, consistent with previous reports showing that MECP2 restricts HIV-1 replication.³⁰ Although the underlying mechanism remains to be fully elucidated, we hypothesize that MECP2 may regulate HIV-1 integration, as previous research has demonstrated its interaction with lens epithelium-derived growth factor (LEDGF), a critical factor for HIV-1 integration.^45,46,47 Supporting this notion, MECP2+/− KO cells treated with various DNA-damaging agents exhibit increased accumulation of DNA damage, a condition known to facilitate HIV-1 integration.^48,49,50,51 Interestingly, miR-422a has been shown to target MLH1 which can identify and repair DNA damage,^52,53 suggesting a deeper connection between miR-422a signaling and the DNA damage repair network.

In parallel, our findings demonstrate that miR-422a overexpression and MECP2 downregulation counteract innate antiviral immunity. RNA sequencing (RNA-seq) analysis revealed highly concordant gene expression patterns induced by miR-422a depletion (antagomir treatment) and IFNα administration. Gene pathway analysis predicted a common UR for both gene expression datasets and further revealed that miR-422a depletion was associated with activation of the “immune response of cells” and “antiviral response” pathways. Collectively, these analyses suggest that miR-422a blocks the IFNα-mediated innate immune response against HIV-1. We then validated these bioinformatic analyses with functional experiments. Transfection with a miR-422a mimic in IFNα-treated cells reversed IFNα-mediated suppression of HIV-1 infection, while transfection with the miR-422a antagomir reinforced the antiviral effect of IFNα by regulating the expression of MECP2. Moreover, IFNα exerted greater suppressive activity against HIV-1 in NC cells compared with miR-422a-overexpressing cells. Building on these findings, we further demonstrated that MECP2 KO attenuates IFNα-induced STAT3 phosphorylation and ISG expression, reinforcing the importance of the miR-422a-MECP2 axis as a key regulator of the IFN pathway. This is consistent with a previous report showing that silencing of MECP2 significantly inhibited the phosphorylation of STAT1 and STAT3 in response to IFN-γ, suggesting a broader antagonistic role in IFN signaling.⁴²

Our data revealed that HIV-1 induces miR-422a expression through the viral Nef protein. Nef is a highly multifunctional accessory protein known for modulating immune responses and promoting viral persistence.^33,34,35,37 Previous studies have demonstrated that Nef disrupts the IFNα-stimulated JAK/STAT signaling pathway.⁵⁴ However, the precise mechanisms underlying Nef-mediated impairment of this pathway remain unclear. Our findings linking Nef to miR-422a-mediated subversion of IFN immunity provides insights into this regulatory axis, showing that both miR-422a and MECP2 play pivotal roles in modulating the IFN-I pathway. Interestingly, we also observed that miR-422a expression was inhibited by IFNα treatment, highlighting a complex regulatory feedback loop. This finding suggests a dynamic balance between HIV-1 and IFNα in modulating miR-422a levels, likely influencing HIV-1 pathogenesis. As HIV-1 transmitted/founder (T/F) variants are known to be highly resistant to IFN-I to enable colonization of the new host,^55,56 it may be worthwhile to investigate the relative capacities of T/F and chronic control (CC) viruses to induce miR-422a expression.

A limitation of our study is that miR-422a, like the majority of miRNAs, likely interacts with and regulates numerous cellular factors and therefore exerts pleiotropic effects that are not fully captured in our experiments. For instance, computational analyses indicate that miR-422a regulates various retroviral restriction factors and genes involved in p53-dependent apoptosis and pyroptosis pathways.³¹ In cancer cells, miR-422a has been shown to suppress proliferation and migration while promoting apoptosis by targeting key regulatory molecules such as PDK2, CDC40, and MAPKK6.^{57,58,59,60,61} Our experiments, however, demonstrated that miR-422a modulation had no impact on the survival or proliferation of primary CD4+ T cells (data not shown). Our RNA-seq data also showed that miR-422a mimic transfection broadly impacted gene expression in CD4+ T cells. The findings presented here demonstrate that miR-422a enhances HIV replication through MECP2 suppression, leading to IFNα evasion. Nevertheless, given its pleiotropic activities across cellular lineages, miR-422a manipulation may influence HIV pathogenesis in ways that are not predictable based on our study design.

In summary, our findings demonstrate that miR-422a is a key host factor induced by HIV infection and TCR stimulation that supports HIV replication and persistence in the CD4+ T cell compartment. These data provide a mechanistic framework supporting previous observations that miR-422a expression is downregulated in HIV elite controllers compared with viremic progressors and PLWH on ART.⁶² Our data warrant investigation into therapeutic targeting of miR-422a using modified antagomir oligonucleotides, similar to miravirsen targeting of miR-122 as an anti-HCV therapy.⁶³ Additionally, as demonstrated in our experiments, CRISPR-Cas9 technology could be leveraged to suppress miR-422a expression in HIV-1 target cells as a therapeutic approach.⁶⁴ Therapeutic targeting of miR-422a early during ART initiation could potentially reduce the initial seeding of the viral reservoir. Moreover, targeting miR-422a may restore host antiviral defense, complementing ART by enhancing immune-mediated control of the virus and potentially reducing chronic inflammation and comorbidities associated with persistent immune activation.

Materials and methods

Cell culture and reagents

Human PBMCs were isolated from whole blood obtained from anonymous blood donors (Vitalant Blood Center; UCSF IRB no. 11–06262) by Ficoll-Hypaque density gradient centrifugation (Corning, #25-072-CV), following the manufacturer’s instructions. Primary CD4+ T cells were isolated from PBMCs by negative selection using the EasySep Human CD4+ T cell Isolation Cocktail, according to the manufacturer’s protocol (StemCell Technologies, #17952). Purified CD4+ T cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) (Thermo Fisher Scientific, #11875093) at 37°C with 5% CO₂. A subset of purified CD4+ T cells was activated with Dynabeads Human T-Activator CD3/CD28 (Thermo Fisher Scientific, #11131D) for 72 h at a concentration of 1 bead per cell in the presence of 100 U/ml IL-2 (PeproTech, #200-50UG) in RPMI 1640 at 37°C with 5% CO₂. All cell lines were cultured at 37°C with 5% CO₂. Jurkat cells (E6-1) were obtained from BEI (#ARP-177) and cultured in RPMI 1640 medium supplemented with 10% FBS. HEK-293T cells were obtained from American Type Culture Collection (ATCC) (#CRL-3216) and cultured in DMEM medium (Thermo Fisher Scientific, #11-965-092) supplemented with 10% FBS and 1% penicillin-streptomycin (Thermo Fisher Scientific, #15140122).

Human recombinant IFNα was obtained from Millipore SIGMA (IFNα2, #IF007) and used for cell treatment. Baricitinib was obtained from Millipore SIGMA (#AMBH2D6F8D04) and used as a JAK inhibitor. Raltegravir was obtained from Millipore SIGMA (#SML3670) and used as an HIV-1 integration inhibitor. miR-422a mimic, mimic control, miR-422a antagomir, and antagomir control were synthesized and obtained from QIAGEN.

HIV-1_NL4-3 viral stocks were generated by transfection of proviral DNA (BEI, #ARP-114) into HEK-293T cells via polyethylenimine (PEI, Polysciences, #26913-06-4) as described previously.⁶⁵ Specifically, VSVG-pseudotyped HIV_NL4-3 ΔEnv EGFP reporter virus stocks were produced by co-transfecting the plasmid encoding HIV_NL4-3 ΔEnv EGFP (BEI, #ARP-11100) and the plasmid encoding VSVG (Addgene, #8454) at a ratio of 3:1 into HEK-293T cells at 50%–60% confluency in culture flasks. VSVG-pseudotyped HIV_NL4-3 ΔEnv ΔNef GFP reporter virus stocks were produced by co-transfecting the plasmid encoding HIV_NL4-3 ΔEnv EGFP (BEI, #HRP-20247) and the plasmid encoding VSVG at a ratio of 3:1. Cells were incubated for 12 h before replacing the medium with DMEM containing 10% FBS and 1% antibiotics. Seventy-two hours post-transfection, supernatants were collected and concentrated using Lenti-X Concentrator (Takara, #631232). Virus stocks were resuspended in PBS and stored at −80°C.

Viral infections

Jurkat cells and primary CD4+ T cells were spinoculated in 96-well V-bottom plates (Thermo Fisher Scientific, #277143) in 50 μL RPMI 1640 containing 100 ng HIV_NL4-3, 250 ng HIV_NL4-3 ΔEnv EGFP reporter virus, or 250 ng HIV_NL4-3 ΔEnv ΔNef GFP reporter virus of p24 per million cells for 2 h at 2,350 rpm at 37°C. After spinoculation, all cells were cultured in RPMI 1640 supplemented with 10% FBS and 1% antibiotics. Viral replication was determined by measuring tat-rev expression, p24 concentration, and Gag expression. tat-rev expression was measured by quantitative reverse-transcription PCR (RT-qPCR). Supernatant p24 concentration was determined by ELISA (Abcam, #ab218268). Infected cells were harvested and stained for intracellular HIV-1 Gag protein using the KC-57 antibody (Beckman Coulter, #6604667). Infection levels were presented as the percentage of Gag-positive cells.

Generation of miRNA overexpression and CRISPR-Cas9 KO cell lines

Lentivirus was first generated by co-transfecting HEK-293T cells with lentiviral vectors, VSVG, and psPAX2 (Addgene, #12260) as previously described.⁶⁶ The lentiviral vectors used were PMIRH422aPA-1 (System Biosciences), pLV[CRISPR]-hCas9:T2A:Puro-U6>hMECP2[gRNA#8537] (VectorBuilder, sgRNA sequence: TGGTGATCAAACGCCCCGGC), and pLV[CRISPR]-hCas9:T2A:Puro-U6>hmiR422a[gRNA] (VectorBuilder, sequence of sgRNA: CATCTGCAGCAGAGAGACTC). Lentiviruses were harvested and transduced into Jurkat cells. Transduced cells were subsequently selected in puromycin-containing media (1 μg/mL) for at least 1 week. miR-422a overexpression cell lines were identified by RT-qPCR. MECP2 KO cell lines were identified by western blot analysis using anti-human MECP2 antibody (Thermo Fisher Scientific, #PA1-888). miR-422a KO cell lines were identified by RT-qPCR.

Electroporation and nucleofection

To overexpress Nef in primary CD4+ T cells, nucleofector technology was used with the Lonza Walkersville P3 Primary Cell 4D-nucleofector X kit (Lonza, #NC0545312), following the manufacturer’s instructions. For each nucleofection, one million cells were resuspended in 100 μL of solution and mixed with the indicated Nef-encoding plasmid DNA. Nucleofection was performed using the Lonza 4D-Nucleofector X unit (Lonza, #AAF-1003X) with the EO-115 program. Cells were incubated for 10 min at room temperature, resuspended in pre-warmed medium, and then cultured at 37°C with 5% CO₂. Cells were harvested 48 h post-transfection.

To KO MECP2 in primary CD4+ T cells, CRISPR RNP genome editing was used as previously described.⁶⁷ The sequence of the CRISPR RNA (crRNA) targeting MECP2 is GTTGATTGCGTACTTCGAAA. The mixture of 160 μM trans-activating crRNA (tracrRNA) (Integrated DNA Technologies, #1072533) and 160 μM crRNA was incubated at 37°C for 30 min to generate guide RNAs at a concentration of 80 μM. Guide RNAs were stored at −80°C. 4 μL of gRNA were combined with 4 μL of purified SpCas9-NLS protein (QB3 core, Berkeley) at 40 μM and incubated at 37°C for 15 min to form Cas9-RNPs. Nucleofection was conducted as described using the Lonza 4D-Nucleofector X unit. Cells were nucleofected and cultured for 24 h before being infected with HIV-1_NL4-3.

Transfection with miRNA mimic and antagomir

Stimulated or unstimulated primary CD4+ T cells were seeded into 24-well plates, then miR-422a mimic or antagomir, along with respective negative controls, was transfected using Hiperfect transfection reagents (QIAGEN, #301705) following the manufacturer’s instructions. The concentration of miR-422a mimic, antagomir, and NCs used throughout the study was 50 nM. Twenty-four or seventy-two hours after transfection, cells were infected with HIV-1 or harvested for target analysis.

RT-qPCR

Total RNA was extracted using TRIzol reagent following the manufacturer’s protocol. Reverse transcription was carried out using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, #K1622) according to the provided instructions. For miR-422a analysis, the reverse transcription primer used was 5′-GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN-3′. RT-qPCR was performed using SYBR Green Universal Master Mix (Thermo Fisher Scientific, #43-091-55) on a ViiA7 Real-Time PCR System. The following primers were used: For pri-miR-422a: forward 5′-TGCATACCTCATTGGTGAGCAT-3′, reverse 5′-AGCCAAGCTAGGATAGCCA-3′. For mature miR-422a: forward 5′-ACUGGACUUAGGGUCAGAAGGC-3′, reverse 5′-GCGAGCACAGAATTAATACGACTCAC-3′. For U6: forward 5′-CTCGCTTCGGCAGCACA-3', reverse 5′-AACGCTTCACGAATTTGCGT-3′. For MECP2: forward 5′-GATCAATCCCCAGGGAAAAGC-3′, reverse 5′-CCTCTCCCAGTTACCGTGAAG-3′. For tat-rev: forward 5′-GCATCTCCTATGGCAGGAAG-3′, reverse 5′-CGTTCACTAATCGAATGGA-3′. For IFIT1: forward 5′-TGCTCCAGACTATCCTTGACCT-3′, reverse 5′-TCTCAGAGGAGCCTGGCTAA-3′. For ISG15: forward 5′-AGCATCTTCACCGTCAGGTC-3′, reverse 5′-GCGAACTCATCTTTGCCAGT-3′. For glyceraldehyde 3-phosphate dehydrogenase (GAPDH): forward 5′-CGGGGCTCTCCAGAACATC-3′, reverse 5′-CTTCGACGCCTGCTTCAC-3′.

Construction of luciferase reporters and luciferase assays

To confirm that MECP2 is a target of miR-422a, a fragment of the MECP2 3′UTR containing the predicted target site was amplified and cloned downstream of the firefly luciferase gene in the pGL-3-control vector (Addgene, #212937). The forward primer used for MECP2 3′UTR amplification was 5′-GCTCTAGAAGCTGGGCCCGATTTGGTAGTT-3′, and the reverse primer was 5′-GCTCTAGAACGCTTGAAATGCTGTGTTC-3'. Three mutant luciferase vectors were generated by mutating the seed regions within the two predicted target sites using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, #E0554S). The following primers were used for site mutations: For MECP2 3′UTR SITE1 Mutant: forward 5′-TCAAGTCTAGCGTAGTGCAGCA-3′, reverse 5′-ACTTTCTGAGTGAGGTCAAGGTC-3’. For MECP2 3′UTR SITE2 Mutant: 5′-CAAGCTGCTTCCCCGTCACCT-3′, reverse 5′-AACCAATGATTCCAGAAGCCACATTACATTTG-3’. HEK-293T cells were seeded in 24-well plates and co-transfected with a miR-422a mimic, pRL-TK (renilla luciferase plasmid), and one of the following constructs: pGL-3-control, MECP2 3′UTR-Luc, MECP2 3′UTR SITE1 Mutant-Luc, MECP2 3′UTR SITE2 Mutant-Luc, or MECP2 3′UTR SITE1&2 Mutant-Luc, using Lipofectamine LTX and Plus Reagent (Invitrogen, #A12621). After 24 h, luciferase activity was measured using the Dual-Luciferase Reporter Assay Kit (Promega, #E2920) according to the manufacturer’s protocol.

Flow cytometry

HIV-1_NL4-3-infected cells were fixed and permeabilized using 4% paraformaldehyde (PFA) and 0.01% Triton X-100, as previously described.⁶⁸ They were then stained with anti-Gag antibody for 30 min at room temperature (RT). Primary CD4+ T cells were stained for activation markers using the antibodies BV605 anti-human CD69 (Biolegend, #310932) and antigen-presenting cell (APC) anti-human CD25 (Biolegend, #385806). Flow cytometry analyses were performed on the Cytek Aurora (Cytek Biosciences) or LSR Ⅱ flow cytometer (BD Biosciences). The details of the gating strategy were as follows: live cells were first selected using a forward/side scatter (FSC/SSC) plot; singlets were then identified using FSC height vs. FSC area (FSC-H vs. FSC-A) to exclude doublets; Gag-positive cells were gated based on uninfected cells; and activated cells were gated as CD69+CD25+ double-positive cells based on IgG isotype staining controls.

Western blotting

To analyze the levels of MECP2, STAT3, and phosphorylated STAT3 protein expression, cells were lysed with radioimmunoprecipitation assay (RIPA) buffer (Thermo Fisher Scientific, #PI89900) supplemented with a protease inhibitor cocktail (Cell Signaling Technology, #7012). Proteins in each sample were quantified using a Qubit fluorometer with Protein Broad Range Assay Kits (Thermo Fisher Scientific, #Q33212). Equal amounts of each extract were run on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and then transferred to polyvinylidene fluoride (PVDF) membranes. The membranes were blocked with 5% nonfat milk for 1 h at RT and incubated overnight at 4°C with anti-MECP2, anti-GAPDH, or anti-β-actin antibodies. After washing, the membranes were incubated with the appropriate secondary antibodies for 1 h at RT. Antibodies were visualized using ultrasensitive enhanced chemiluminescent (ECL) reagent (Thermo Fisher Scientific, #PI34094) following the manufacturer’s instructions.

RNA-sequencing and IPA

RNA concentration and quality were measured using High Sensitivity RNA ScreenTape Analysis (Agilent, 5067-1500). cDNA libraries were prepared using the Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina, 20020597), and sequencing was performed on the Illumina Nextseq 550 Platform, generating 75 bp paired-end reads. The quality of raw sequencing reads was assessed using FastQC. The raw RNA-sequencing data were aligned to the human genome (GRCh38) using STAR (version 2.7.3a). For normalization, DESeq2 was used to estimate size factors based on median-of-ratios to account for library depth and composition biases; low-count genes (fewer than 10 reads across all samples) were filtered prior to analysis. Differential expression analysis was performed using DESeq2 according to a standard protocol. Genes with an adjusted p value (FDR) < 0.05 were considered significantly differentially expressed. GeneMANIA was used to predict the function and network of the gene sets. DEGs were identified and imported into the QIAGEN IPA software application. IPA was used to identify gene ontologies, pathways, and regulatory networks to which DEGs belonged, as well as URs with q < 0.05.⁶⁹

Statistical analysis

Statistical analysis was performed using GraphPad Prism version 8 software. Sample sizes are indicated in the figure legends. Data were collected from a minimum of three independent experiments and are presented as means ± SEM or median. Data were analyzed for statistical significance using an unpaired or paired Student’s t test to compare two groups. Only p values of 0.05 or lower were considered statistically significant (p > 0.05 [ns], p ≤ 0.05 [∗], p ≤ 0.01 [∗∗], p ≤ 0.001 [∗∗∗], p ≤ 0.0001 [∗∗∗∗]).

Data and code availability

The datasets generated for this study are available on request from the corresponding author.

Acknowledgments

This research was supported by National Institutes of Health grants R01AI172754 (S.K.P.), R01AI184421 (S.K.P.), and P01AI69606 (S.A.Y. and S.K.P.), and by the UCSF-Bay Area Center for AIDS Research (P30 AI027763).

Author contributions

L.D. and S.K.P. initiated the project and designed the experiments. L.D., M.S.B., and P.D. performed and processed RNA-seq. J.-N.B. analyzed RNA-seq data. S.T., N.K., and S.A.Y. performed digital PCR for HIV transcriptional profiling measurements. J.G. prepared and provided HIV-1 Nef expression constructs. L.D. and S.K.P. prepared the manuscript. S.K.P. supervised the work.

Declaration of interests

The authors declare no competing interests.