Abnormal circ-CDK8 expression affects periodontitis development by regulating let-7b-5p/MAP4K3 signaling

Abstract

Periodontitis, a chronic inflammatory disorder characterized by progressive alveolar bone loss, relies heavily on the osteogenic differentiation capacity of periodontal ligament stem cells for bone regeneration. While inflammatory conditions are known to impair this osteogenic potential, the specific regulatory mechanisms, particularly those involving circular RNAs, remain to be elucidated. This study was therefore conducted to investigate the functional role of circ-CDK8 in regulating periodontal ligament stem cells (PDLSCs) differentiation under inflammatory conditions and to elucidate its mechanism of action through the let-7b-5p/MAP4K3 pathway and associated autophagy processes. Our investigation revealed significant upregulation of circ-CDK8 in periodontitis tissues compared to healthy tissues. Using an inflammatory model with TNF-α and IL-1β stimulation, we demonstrated that circ-CDK8 suppression enhanced osteogenic differentiation while concurrently reducing autophagic activity. Mechanistic studies established that circ-CDK8 executes its regulatory function through the let-7b-5p/MAP4K3 axis, where its inhibition promotes osteogenic differentiation via autophagy modulation. These findings not only identify a novel circ-CDK8/let-7b-5p/MAP4K3 regulatory pathway in periodontitis pathogenesis but also position circ-CDK8 as a promising therapeutic target for periodontal regeneration.

1. Introduction

Periodontitis is a prevalent oral condition with the highest occurrence rate and the broadest impact [1,2]. It is a leading cause of tooth loss among adults [3]. Some researchers suggest that the primary cause is the persistent chronic inflammatory environment in the periodontal area, which hinders the proliferation and differentiation of periodontal ligament stem cells (PDLSCs) and impacts the regeneration capacity of these stem cells [4]. The direct effects of the inflammatory process of periodontitis on alveolar bone resorption include the release of inflammatory mediators such as tumor necrosis factor α (TNF-α), interleukin 1 (IL-1) and interleukin 6 (IL-6), which activate osteoclasts and lead to resorption and destruction of alveolar bone [5,6]. Therefore, elucidating the effect of inflammatory environment on the osteogenic differentiation of PDLSCs and its specific mechanism is a key issue that must be solved in the study of periodontal regeneration.

Autophagy is an intracellular degradation and recycling process by which cells break down damaged proteins, organelles, or other intracellular components in order to maintain the stability of the intracellular environment and cell survival [7]. Autophagy is a highly regulated process that plays an important physiological role in starvation, hypoxia, infection, cellular stress and aging [[8], [9], [10]]. Abnormalities in autophagy are associated with the occurrence and development of a variety of diseases, including neurodegenerative diseases, cancers, metabolic diseases, and diseases of the immune system [[11], [12], [13]]. Autophagy plays an important role in maintaining periodontal tissue homeostasis because it removes damaged cell components, bacteria, and toxic substances produced during inflammation. During the development of periodontitis, autophagy may be activated as a cytoprotective mechanism that helps cells resist stress caused by bacterial infection and inflammation [6]. However, overactivation or dysregulation of autophagy may also have adverse effects on periodontal tissue. For example, excessive autophagy may lead to cell death, further exacerbating the destruction of periodontal tissue [14]. In addition, autophagy may in some cases be associated with inflammatory responses and bone resorption in periodontitis [15]. In conclusion, the relationship between autophagy and periodontitis is multifaceted, and autophagy plays a dual role in the occurrence and development of periodontitis, which may be either protective or destructive. Further research will contribute to a more complete understanding of the role of autophagy in periodontitis and may provide clues for the development of new treatments.

Circular RNA (circRNA) is a special class of non-coding RNA molecules whose molecular structure is closed-loop and is not affected by RNA exonuclease [16]. CircRNA is widespread in eukaryotes and plays an important role in cell differentiation and development, gene expression regulation, and disease occurrence [17]. CircRNAs function mainly by sponging miRNAs, and they can also regulate transcription and protein translation. Several circRNAs have been shown to play an important role in cancer, neurodegenerative diseases, cardiovascular diseases and diabetes [18,19]. It was reported that inhabition of circ_0138959 promoted cell viability and suppressed pyroptosis of human gingival fibroblasts via the miR-527/CASP5 axis, which may be a promising therapy for periodontitis [20]. Periodontitis is a chronic inflammatory disease that leads to the destruction of periodontal tissues, including the gingiva, alveolar bone, and periodontal ligament [21,22]. Osteogenesis is one of the key factors in the treatment and prevention of periodontitis. During the development of periodontitis, the function and activity of osteoblasts are affected, leading to alveolar bone resorption and destruction [23]. Therefore, promoting the differentiation and function of osteoblasts and enhancing the regeneration and repair ability of alveolar bone are important strategies for the treatment of periodontitis. PDLSCs, as stem cells with multidirectional differentiation potential in periodontal tissue, are of great significance in osteogenic differentiation of periodontal tissue regeneration [24]. However, the regulatory mechanism of inflammation in the osteogenic differentiation of PDLSCs remains unclear. This study aims to investigate the effect of circ-CDK8 and autophagy in PDLSCs osteogenic differentiation. In the present study, we found that circ-CDK8 repressed the osteogenic differentiation of PDLSCs by triggering autophagy activation in a hypoxic microenvironment [25]. However, it is still unclear whether circ-CDK8 could regulate autophagy of PDLSCs in inflammatory environment, as well as the underlying mechanisms.

Therefore, this study sought to elucidate the functional role of circ-CDK8 in PDLSCs under inflammatory conditions. We specifically examined its expression pattern in inflammatory PDLSCs, evaluated its functional impact on both osteogenic differentiation and autophagy processes, and investigated its potential mechanism through let-7b-5p sponging and subsequent MAP4K3 regulation. Our results demonstrate that circ-CDK8 shows significant upregulation under inflammatory stimulation and functionally inhibits osteogenic differentiation through autophagy modulation via the let-7b-5p/MAP4K3 axis. As the first report of this mechanistic pathway, our findings suggest that targeting circ-CDK8 could open new therapeutic avenues for periodontitis treatment.

2. Materials and methods

2.1. Isolation and culture of human PDLSCs

Cell source: Teeth extracted from oral and maxillofacial surgery patients in the Affiliated Hospital of Qingdao University were collected. The patient was in good health with no history of systemic diseases, aged 18-30 years, and had a total of 30 third molars or premolars that needed to be removed due to impacted or orthodontic conditions. All the teeth were completely extracted with intact roots and no caries, and the periodontal pocket depth was less than 3 mm. With the patient's consent and signed informed consent, the donated teeth were used for scientific research.

The obtained teeth were placed in a glass substrate Petri dish and repeatedly washed with PBS solution containing 100 U/mL penicillin and 100 U/mL streptomycin until there was no obvious blood stain on the tooth surface and the flowing liquid was clear; the crown of the tooth was held with a hemostatic clamp, the periodontal tissue (1/3 of the root space) was scraped from the root surface and the root space with a blade, and the tissue was soaked in pre-cooled α-MEM, centrifuged (800 r/min, 5 min), the tissue was collected, and the supernatant was discarded; the precipitated tissue was taken, 3 mg/mL of type I collagenase was added, and mixed in the centrifuge tube; The tissue suspension was incubated in a 50 mL/L CO² incubator at 37 °C for 45 min and mixed every 15 min during the incubation period; after digestion, add 8 mL PBS solution, suspend and wash the tissue, centrifuge again, and discard the supernatant; add 3 mL of basic medium for re-suspension, inoculation in a six-well plate, incubator culture, liquid change every 3d, and observe the situation of cells climbing out of the tissue with an inverted microscope.

2.2. Stem cell surface marker detection

Surface markers of PDLSCs and I-PDLSCs were analyzed by flow cytometry. The following markers were used: CD45 (negative marker), CD73, and CD105 (positive markers).The specific steps are as follows: the PDLSCs and I-PDLSCs obtained after pretreatment were digested with trypsin-EDTA respectively and repeatedly blown until single-cell suspension was formed; 1 × 10⁶ cell suspensions were placed in EP tubes, washed twice with PBS, centrifuged (800 r/min, 5 min), and cells were collected; The cells were resuspended in 100 μL PBS and incubated with antibodies CD45, CD73 and CD105 (1.25 μL per tube), and incubated on ice for 30 min away from light; Centrifuge (800 r/min, 5 min) and collect cells, wash twice with PBS; 400 μL fresh PBS solution is repeatedly blown, re-suspended, to be tested; PDLSCs and I-PDLSCs without antibody incubation were used as blank controls, and the positive rate of expression of surface markers in each group was detected by flow cytometry and quantitatively analyzed.

2.3. Preparation of PDLSCs in inflammatory culture

I-PDLSCs were established by culturing PDLSCs for at least 7 days in an inflammatory medium (basal medium supplemented with 10 ng/mL TNF-α and 5 ng/mL IL-1β). It was used as a cell model of PDLSCs in inflammatory environment. PDLSCs from the same source and cultured in basic medium for 7 days or more were periodontal stem cells under normal environment, and were set as control cells (PDLSCs). I-PDLSCs were always cultured under the condition of inflammatory cytokines during the whole experiment.

2.4. Adipogenic differentiation

PDLSCs and I-PDLSCs were seeded in 6-well plates at the density of 2 × 10⁵ cells per well, and cells were cultured to 90% confluent with basal or inflammatory medium, respectively. The medium was replaced with adipogenic induction medium consisting of α-MEM supplemented with 10% FBS, 0.01 mg/mL insulin, 0.5 mM IBMX, 0.2 mM indomethacin, and 0.1 μM dexamethasone. The fluid was changed every 3d and cultured for 14 days.

2.5. Oil red O stain

Cells were washed twice with PBS, fixed with 4% paraformaldehyde overnight at 4°C, and then washed five times with PBS to thoroughly remove the fixative.; the configuration of oil red O dye solution: weigh 0.03 g oil red O, dissolve 6 mL isopropyl alcohol and mix well, add 4 mL distilled water and mix well, stand for 10 min, filter and remove precipitation; Oil red O dye solution was dyed at room temperature for 20 min, washed with PBS 3 times, observed with inverted phase contrast microscope and took staining photos.

2.6. Osteogenic differentiation

PDLSCs and I-PDLSCs were plated into 6-well plates with 1 × 10⁵ PDLSCs and I-PDLSCs per well. When cells reached 80% confluence, the culture medium of the osteoblast group was changed to one containing 5% FBS, 0.15 μM Dexamethasone (DXMS), 10 mM β-sodium glycerophosphate and 50 μM ascorbic acid. The fluid was changed every 3 days and for up to 28 days.

2.7. Alkaline phosphatase (ALP) staining

ALP is a kind of hydrolase in cells or tissues, which can be used to detect the osteogenic differentiation potential of stem cells. ALP staining was performed 14 days after osteogenic induction of PDLSCs and I-PDLSCs. The cells of each group after 14 days of osteogenic induction were gently washed 3 times with PBS, and 4% paraformaldehyde was fixed overnight at 4 °C; washed five times with PBS to ensure complete removal of paraformaldehyde; Configure ALP staining solution (ALP dyeing buffer: dyeing solution BCIP: dyeing solution) according to the requirements of the manual ALP staining buffer: BCIP solution: NBT solution = 3 mL: 10 μL: 20 μL; After the last PBS rinse, absorb the liquid, add ALP dyeing solution to 500 μL per well, and incubate overnight at room temperature away from light; Remove the ALP dyeing solution, gently wash with PBS for 3 times to terminate the color reaction, dry at room temperature, and take dyeing photos directly with an ordinary camera and an inverted microscope camera, and for comparison and analysis.

2.8. Alizarin red staining (ARS)

Alizarin red staining was performed 28 days after osteogenic induction of PDLSCs and I-PDLSCs, respectively. The cells of each group after 28 days of osteogenic induction were gently washed 3 times with PBS, and 4% paraformaldehyde was fixed overnight at 4 °C; PBS gently washed cells 5 times at most no residual paraformaldehyde; Configure alizarin red dye solution: dissolve 1 g Tris-base in 80 mL, double-distilled water, adjust the pH to approximately 8.0, continue to add double-distilled water to a fixed volume of 100 mL, add 0.1 g alizarin red, mix and stand for 10 min, filter with a small filter; After the cells were washed by PBS for the last time, all liquids were absorbed and 500 μL alizarin red dye was added to each well for 30 min at room temperature. The alizarin red dye solution was removed, gently washed with PBS for 3 times, and dried at room temperature. After that, the stained images were taken directly with ordinary camera and inverted microscope camera respectively, and then compared and analyzed.

2.9. Cell viability assay

The viability of the cells was assessed using a cell proliferation assay. The cells were seeded into a 96-well plate and left to incubate overnight in a complete growth medium. To evaluate cell survival, the Cell Counting Kit-8 (CCK-8) from Solarbio, was used according to the manufacturer’s instructions. The absorbance at 450 nm was then measured using a microplate spectrophotometer (Molecular Devices, Sunnyvale, CA, USA).

2.10. Transmission electron microscopy (TEM)

TEM was utilized to examine the ultrastructure of the cells. The PDLSCs were treated with an electron microscope fixative for fixation. Following fixation, the samples were dehydrated using a series of ethanol and propylene oxide treatments. Subsequently, thin sections were prepared and stained with 0.3% lead citrate solution. Autophagosomes were observed and imaged using a JEM-1010 transmission electron microscope by JEOL, based in Tokyo, Japan.

2.11. Western blotting analysis

Total protein was extracted according to the manufacturer's instructions and protein concentrations were determined using a BCA protein assay kit. Protein samples were then separated on SDS-polyacrylamide gels and transferred onto PVDF membranes. The membranes were blocked in TBST buffer containing 5% BSA for 2 h, followed by incubation with primary antibodies overnight at 4 °C. The membranes were then probed with corresponding secondary antibodies for 2 h at room temperature. Ultimately, images were captured utilizing the ChemiDoc Touch Imaging System (BioRad).

2.12. Quantitative real-time PCR analysis

Total RNA was isolated using the TRIzol reagent (Thermo Fisher Scientific). qRT-PCR was conducted on the Bio-Rad CFX96 PCR system with the PrimeScript™ RT Reagent Kit (Takara, Dalian, China). The primers employed for qRT-PCR are detailed in Table 1. GAPDH and U6 were utilized as reference genes for normalization of target gene expression levels. The relative expression values were calculated using the 2 ^−(ΔΔCt) method.

Table 1.

Primers and siRNA sequences.

Gene name	Forward	Reverse
circ-CDK8	GGACCCCCGTTGAAGAAAGT	TTGGGTCCATGGTAAGCAGC
RUX2	CGGAATGCCTCTGCTGTTATG	AAGGTGAAACTCTTGCCTCGTC
ALP	GGACCATTCCCACGTCTTCAC	CCTTGGTAGCCAGGCCCATTG
let-7a-5p	CCCCCCTGAGGTAGTAGGTTGTAT	CCAGTGCAGGGTCCGAGGT
let-7i-5p	GGGCCTGAGGTAGTAGTTTGTGC	CCAGTGCAGGGTCCGAGGT
miR-4500	CCCCCCCCTGAGGTAGTAGTT	CCAGTGCAGGGTCCGAGGT
let-7c-5p	CCCCCCTGAGGTAGTAGGTTGTAT	CCAGTGCAGGGTCCGAGGT
let-7b-5p	CCCCCTGAGGTAGTAGGTTGTGT	CCAGTGCAGGGTCCGAGGT
miR-98-5p	CCCCCCTGAGGTAGTAAGTTGTAT	CCAGTGCAGGGTCCGAGGT
GAPDH	CATGTTCGTCATGGGTGTGAA	GGCATGGACTGTGGTCATGAG
U6	CGCTTCGGCAGCACATATACTA	GGAACGCTTCACGAATTTGC
let-7a-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT
let-7i-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAGC
miR-4500-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAGAAA
let-7c-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCAT
let-7b-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCAC
miR-98-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAAT
si-circ-CDK8	CAGACTATCAGCTTCAGAA

2.13. Statistical analysis

All data are presented as mean ± standard deviation (SD) from at least three independent experiments. Prior to analysis, the normality of data distribution for all datasets was confirmed using the Shapiro-Wilk test, and the homogeneity of variances was verified using both the F-test and Levene's test. Statistical analyses were performed using GraphPad Prism 10. Comparisons between two groups were conducted using the unpaired Student's t-test, while comparisons among multiple groups were performed using one-way analysis of variance (ANOVA). A P-value <0.05 was considered statistically significant (∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001).

3. Results

3.1. The effect of inflammation on the performance of PDLSCs

The results of characteristic stem cell surface markers showed that PDLSCs expressed positive cell surface markers (CD73, CD90, CD105) and negative cell surface markers (CD45) (Fig. 1A). Oil red O stain and ARS indicated that cells have the potential of adipogenic differentiation and osteogenic differentiation, which is consistent with the characteristics of PDLSCs multidirectional differentiation potential (Fig. 1B). To evaluate the response of PDLSCs to inflammation, we treated the cells with TNF-α (10 ng/ml) and IL-1β (5 ng/mL) for 7 days, which were initially proposed to be I-PDLSCs, and then detected the cell viability and osteogenic differentiation ability. After incubating for 14 days, compared with PDLSCs, the proliferation rate of I-PDLSCs was significantly lower, especially after 7 days of growth, the difference became more pronounced (Fig. 1D). Subsequently, we examined the osteogenic differentiation of PDLSCs and I-PDLSCs. After 7 days osteogenic induction, both PDLSCs and I-PDLSCs expressed ALP, an early marker of osteogenic differentiation. The expression level of ALP in I-PDLSCs cells was lower than that of PDLSCs (Fig. 1, Fig. 2H). Flow cytometry analysis showed that the apoptosis rate was higher in the I-PDLSCs than in the PDLSCs (Fig. 1E), suggesting that inflammation inhibited the growth of PDLSCs. Taken together, inflammation has been shown to decrease proliferative ability and osteogenic differentiation ability of PDLSCs.

Fig. 1.

Characterization of PDLSCs and the impact of inflammation on their cellular functions. (A) Flow cytometry analysis of PDLSCs surface markers. PDLSCs are positive for CD73, CD90, and CD105, but negative for CD45. (B) Representative images of adipogenic and osteogenic differentiation as assessed by Oil Red O and Alizarin Red S (ARS) staining, respectively. (C) ALP staining for early osteogenic differentiation. The quantitative analysis of ALP activity in (C) is shown in Fig. 2H. (D) Cell proliferation curves measured by the CCK-8 assay. (E) Flow cytometry analysis showing the increased apoptosis rate in I-PDLSCs compared to PDLSCs. Scale bar = 500 μm. Values are presented as means ± SD of three to five independent experiments. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001,∗∗∗∗p < 0.0001.

Fig. 2.

The role of circ-CDK8 in the regulation of osteogenic differentiation of PDLSCs under inflammatory conditions. (A) ARS staining shows calcium nodule formation on day 14 of osteogenic induction. (B and C) The mRNA (B) and protein (C) expression levels of osteogenesis-related markers (RUNX2, ALP) in PDLSCs and I-PDLSCs after 7 days of osteogenic induction, as determined by qRT-PCR and western blotting, respectively. (D) Relative expression levels of circ-CDK8 in clinically healthy periodontal tissues and periodontitis tissues, as measured by qRT-PCR. (E) Western blot analysis demonstrates the protein levels of RUNX2 and ALP following circ-CDK8 knockdown in I-PDLSCs. (F) Flow cytometry quantifying apoptosis in PDLSCs and I-PDLSCs. (G) ALP staining on day 7 of osteogenic induction. Scale bar = 500 μm. (H) Quantitative analysis of ALP activity based on the staining in Fig. 1C. (L) ALP activity under the indicated treatments for 7 days.(I) Extracellular matrix mineralization was assessed by measuring the OD562 value.(J,K) Semi-quantitative analysis of RUNX2 and ALP proteins under the indicated treatment conditions ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001.Each experiment was independently repeated three times.

3.2. The role of circ-CDK8 in the regulation of inflammation on osteogenic differentiation of PDLSCs

To further determine the effect of inflammation on osteogenic differentiation, ARS was analyzed. The results showed less calcium salt deposited with inflammation treatment on day 14 (Fig. 2A,I). Furthermore, osteogenesis-related gene expression was assessed by qRT-PCR and Western blot, the results showed that the mRNA and protein expression of ALP and Runt related transcription factor 2 (RUNX2) decreased with inflammation treatment on 7 days (Fig. 2B and C,2J). To explore the significance of circ-CDK8 in PDLSCs, as shown in Fig. 2D, circ-CDK8 expression was strikingly decreased in I-PDLSCs compared to PDLSCs. And then we transfected PDLSCs and I-PDLSCs with si-circ-CDK8 to explore the effect of circ-CDK8 on osteogenic differentiation. The Western blot results revealed that the decreased expression of circ-CDK8 promoted the expression of osteogenesis-related proteins (RUNX2 and ALP) (Fig. 2E and K), and ALP staining showed the same tendency as Western blot (Fig. 2G and L). In addition, flow cytometry analysis showed that apoptosis rate was decreased after si-circ-CDK8 treatment (Fig. 2F). Therefore, circ-CDK8 is involved in the regulation of inflammation on osteogenic differentiation of PDLSCs.

3.3. Inflammation activates autophagy during the osteogenic differentiation of PDLSCs

According to our previous study, autophagy played an important role in osteogenic differentiation [26]. Thus, we investigated the autophagy level in PDLSCs and I-PDLSCs. Transmission electron microscopy (TEM) was used to observe autophagosomes. Compared with PDLSCs, I-PDLSCs significantly increased the number of autophagosomes on day 7 of osteogenesis (Fig. 3A). Accordingly, more LC3 dots were accumulated in I-PDLSCs compared with the PDLSCs by immunofluorescence (Fig. 3B). Western blot was then applied to detect the expression of autophagy-related genes (LC3 and p62). The results showed that the autophagy-related gene LC3 decreased and the expression of p62 increased in I-PDLSCs with si-circ-CDK8 treatment (Fig. 3C and I). Besides, there were less autophagosomes after transfecting si-circ-CDK8 in I-PDLSCs (Fig. 3D). Immunofluorescence exhibited that the level of autophagy was decreased with si-circ-CDK8 transfection (Fig. 3E). mTORC1 inhibits autophagy, and rapamycin (Rapa) can indirectly promote autophagy by inhibiting mTORC1 activity. To explore whether mTORC1-mediated autophagy is involved in the regulatory effect of circ-CDK8, we treated I-PDLSCs with Rapa. And Rapa can reverse the reduction in autophagy levels caused by si-circ-CDK8 treatment (Fig. 3F and J). At the same time, ALP staining indicated that the early osteogenic differentiation was inhibited by Rapa (Fig. 3G and K). ARS staining demonstrated that Rapa decreased calcium salt deposits (Fig. 3H and L). These data suggested that autophagy was related to osteogenic differentiation in PDLSCs and circ-CDK8 activated autophagy.

Fig. 3.

Inflammation activates autophagy and inhibits osteogenic differentiation in PDLSCs. (A, D) Representative transmission electron microscopy (TEM) images of PDLSCs (A) and I-PDLSCs (D) show autophagosomes after 7 days of osteogenic induction. (B, E) Immunofluorescence staining shows LC3 distribution in PDLSCs (B) and I-PDLSCs (E). (C, F) Western blot analysis (C) and quantification (F) demonstrate the expression of autophagy markers LC3 and p62 in PDLSCs and I-PDLSCs. (G, H) ALP staining on day 7 (G) and ARS staining on day 14 (H) assess osteogenic differentiation under inflammatory conditions. Scale bars = 500 μm (G, H); 50 μm (B, E); 5 μm (A, D). (I,J) Semi-quantitative analysis of LC3 and p62 proteins under the indicated treatment conditions. (K) ALP activity under the indicated treatments for 7 days. (L) Extracellular matrix mineralization was assessed by measuring the OD562 value. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001. Each experiment was independently repeated three times.

3.4. Circ-CDK8 acts as a let-7b-5p sponge to promote autophagy

The downstream targets of circ-CDK8 were identified using bioinformatics analyses using data in the Starbase v2.0 database. The results showed that let-7a-5p, let-7b-5p, let-7c-5p, let-7i-5p, miR-98-5p, miR-202-3p, miR-4500 could be downstream targets of circ-CDK8. QRT-PCR analyses further revealed that downregulation of circ-CDK8 significantly increased the expression of let-7b-5p and let-7c-5p (Fig. 4A). Thus, let-7b-5p expression was analyzed in the subsequent experiments. Western blot showed that let-7b-5p can regulate autophagy and osteogenic differentiation mediated by circ-CDK8 in I-PDLSCs (Fig. 4B,D and 4C,4E). Generally, our results showed that circ-CDK8 sponges let-7b-5p and regulates its activity, and it plays an important role in autophagy and osteogenic differentiation of PDLSCs.

Fig. 4.

Circ-CDK8 acts as a molecular sponge for let-7b-5p to promote autophagy. (A) Relative expression levels of candidate microRNAs in I-PDLSCs following transfection with si-circ-CDK8 or negative control, as determined by qRT-PCR. (B) Western blot analysis of osteogenic differentiation markers in I-PDLSCs after circ-CDK8 knockdown. (C) Western blot analysis of autophagy-related proteins in I-PDLSCs after circ-CDK8 knockdown. (D) Semi-quantitative analysis of ALP and RUNX-2 proteins under the indicated treatment conditions. (E) Semi-quantitative analysis of LC3 and p62 proteins under the indicated treatment conditions. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001. Each experiment was independently repeated three times.

3.5. let-7b-5p and MAP4K3 are downstream targets regulated by circ-CDK8 in PDLSCs

The downstream targets of circ-CDK8 and let-7b-5p were identified using bioinformatics analyses using data in the TargetScan, miRWalk and miRDB databases. MAP4K3 and PBX1 were shown to be related to let-7b-5p (Fig. 5A). The TargetScan database showed the MAP4K3 and let-7b-5p binding sites, which we selected as our research object (Fig. 5B). Western blot and qRT-PCR were performed to confirm the regulatory relationship between circ-CDK8 and MAP4K3. The results showed that interference with circ-CDK8 significantly reduced MAP4K3 expression at both mRNA and protein levels (Fig. 5C and D). Based on the above research, given that circ-CDK8 can regulate autophagy, we investigated the mechanism by which circ-CDK8 regulated autophagy. Interestingly, our results showed that let-7b-5p knockdown increased the number of autophagosomes on day 7 of osteogenesis, and co-transfection with si-MAP4K3 inhibited the level of autophagy induced by let-7b-5p inhibitor (Fig. 5E). Similarly, Western blot and immunofluorescence also showed that let-7b-5p and MAP4K3 can regulate autophagy by circ-CDK8 in I-PDLSCs (Fig. 5F and H,5 M). Interestingly, ALP staining showed that knockdown of circ-CDK8 promoted osteogenic differentiation in I-PDLSCs, and co-transfection with let-7b-5p inhibitor inhibited osteogenic differentiation, and si-MAP4K3 reversed this effect (Fig. 5G and K). And ARS staining and Western blot showed the same tendency as ALP staining (Fig. 5I,L and 5J,5 N). Based on the above results, MAP4K3 plays an important role in the osteogenic differentiation of PDLSCs by regulating autophagy, and circ-CDK8 inhibited osteogenic differentiation via the let-7b-5p/MAP4K3 pathway (Fig. 6).

Fig. 5.

let-7b-5p and MAP4K3 are functional downstream targets of circ-CDK8 in PDLSCs. (A) Venn diagram identifying potential targets of let-7b-5p from three bioinformatics databases. (B) Schematic of the predicted binding site of let-7b-5p on the MAP4K3 3′UTR. (C, D) Validation of MAP4K3 as a target of the circ-CDK8/let-7b-5p axis. (C) Western blot and (D) qRT-PCR analysis of MAP4K3 expression in I-PDLSCs following circ-CDK8 knockdown. (E) TEM images show autophagosomes (red arrows) in I-PDLSCs on day 7. (F) Immunofluorescence staining reveals LC3 distribution. (G) ALP staining indicates early osteogenic differentiation. (H) Western blot analysis demonstrates LC3 and p62 expression. (I) ARS staining detects calcium nodule formation on day 14. (J) Western blot analysis shows osteogenesis-related protein expression in I-PDLSCs on day 7. Scale bars = 500 μm (G, I); 50 μm (F); 5 μm (E). (K) ALP activity under the indicated treatments for 7 days. (L) Extracellular matrix mineralization was assessed by measuring the OD562 value. (M) Semi-quantitative analysis of p62 and LC3 proteins in I-PDLSCs after 14 days of osteogenic induction under the indicated treatment conditions. (N) Semi-quantitative analysis of RUNX2 and ALP proteins under the indicated treatment conditions. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001, ∗∗∗∗P < 0.0001. Each experiment was independently repeated three times.

Fig. 6.

Schematic model illustrating the mechanism by which circ-CDK8 regulates osteogenic differentiation in an inflammatory environment.

4. Discussion

In the present study, we found that circ-CDK8 was highly expressed in periodontitis tissues [25]. To our knowledge, this is the first report demonstrating that circ-CDK8 regulates autophagy through the let-7b-5p/MAP4K3 axis. Further experiments demonstrated that down-regulation of circ-CDK8 promoted the osteogenic differentiation of PDLSCs. Therefore, inhibition of circ-CDK8 may be a promising therapy for periodontitis.

In recent years, the role of circRNA in stem cell differentiation and development has attracted increasing attention, especially in the fields of bone development and regenerative medicine [27]. In the study of osteogenic differentiation of periodontal stem cells, it has been found that some specific circRNA molecules may play a key role. For example, circ_0084054, circ_0085289 and other circRNAs are up-regulated in osteogenic differentiation of periodontal stem cells, and promote osteogenic differentiation by targeting specific miRNA, such as miR-508-3p and let-7f-5p [28,29]. These findings provide preliminary evidence for the function and mechanism of circRNA in regulating osteogenic differentiation of PDLSCs. In our previous study, CoCl₂ suppressed osteogenesis by activating autophagy using circ-CDK8 in PDLSCs [25]. Thus, in the present study, we found that circ-CDK8 expression was significantly different between PDLSCs and I-PDLSCs (Fig. 2D). And interfering with circ-CDK8 transcription significantly inhibited the osteogenic differentiation of I-PDLSCs (Fig. 2G).

To clarify the specific mechanism of circ-CDK8 regulating I-PDLSCs osteogenic differentiation, we predicted the possible target gene of circ-CDK8 through bioinformatics analysis. We found that circ-CDK8 possibly targets hsa-let-7a-5p, hsa-let-7i-5p, hsa-miR-4500, hsa-let-7c-5p, hsa-let-7b-5p, hsa-miR-98-5p and hsa-miR-202-3p. In our study, qRT-PCR analyses further revealed that overexpression of circ-CDK8 significantly reduced the expression of let-7b-5p (Fig. 4A). Studies have shown that the expression of let-7b-5p was associated with osteogenic differentiation of dental pulp stem cells [30] and adipose tissue-derived stem cells [31]. In our study, we found that interfering with let-7b-5p transcription/function can effectively reverse the osteogenic differentiation promotion caused by interference with circ-CDK8 (Fig. 5G). Further analysis of data in the TargetScan, miRWalk and miRDB database revealed that MAP4K3 targets let-7b-5p (Fig. 5A). And we found that let-7b-5p and MAP4K3 are downstream genes regulated by circ-CDK8 in PDLSCs, which can regulate osteogenic differentiation of I-PDLSCs. However, the mechanisms through which circ-CDK8 regulates osteogenic differentiation in I-PDLSCs require further investigation.

Autophagy is a process within the cell that degrades and recycles its own components [32]. This process plays an important role in maintaining the stability of the cellular environment, regulating energy metabolism, promoting cell growth and development, and coping with various stress conditions [33]. Increasing evidence has demonstrated that autophagy plays an essential role in osteogenic differentiation [34,35]. And Shao et al. suggested that applying cyclic tensile stress (CTS) can promote the osteogenic differentiation of PDLSCs and is related to the activation of mitochondrial autophagy [36]. In the present study, we found that interfering with circ-CDK8 function decreased the expression of MAP4K3 and inhibited the accumulation of autophagosome and protein of LC3 under the treatment of si-circ-CDK8, promoting the osteogenic differentiation of I-PDLSCs. These data indicated that circCDK8 could activate autophagy and that downregulation of circ-CDK8 might reverse osteogenic inhibition through the let-7b-5p/MAP4K3 pathway.

Although this study reveals the role of circ-CDK8/let-7b-5p/MAP4K3 axis in regulating osteogenic differentiation of I-PDLSCs, there are still some limitations. First, our conclusions are mainly based on in vitro cell models, and the function of circ-CDK8 in animal models or clinical samples of periodontitis needs to be further verified by in vivo experiments. In the future, we will construct an animal model of periodontitis to evaluate its effect on alveolar bone regeneration by locally intervening in the expression of circ-CDK8.

In conclusion, our study first suggested that circ-CDK8 is overexpressed in I-PDLSCs. Furthermore, circ-CDK8 inhibited osteogenic differentiation by promoting autophagy of I-PDLSCs through the let-7b-5p/MAP4K3 axis. These findings provided a novel insight into the molecular mechanisms of periodontitis progression and presented a potential periodontitis treatment strategy.

Author contributions

JZ: Conceptualization, Methodology, Software, Supervision, and Data curation; CqY: Supervision, Methodology, and Software; YL: Writing – original draft preparation, Data curation, and Methodology; ClY: Data curation, Methodology, and Writing – review & editing; MJ: Writing – original draft preparation, Data curation, and Writing – review & editing; TL: Writing – original draft preparation.

Funding

This study was funded by Natural Science Foundation of Shandong Province (ZR2021MH305).

This study was funded by Special Project for Science and Technology Benefiting the People in Qingdao West Coast New Area (2022-46).

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.