Transglutaminase‐mediated cytokeratin modifications implicated in bile‐acid‐induced hepatocyte death

Abstract

Transglutaminases (TGs) are crosslinking enzymes that catalyze the formation of isopeptide bonds between glutamine and lysine residues. They consist of eight isozymes: TG1–TG7 and factor XIIIa. Our previous studies have shown that TG1 and TG2 facilitate hepatic apoptosis, contributing to liver fibrosis, and that their crosslinking substrates—cytokeratin 18 (K18) and cytokeratin 8 (K8)—are also targeted by TGs in a bile‐duct‐ligation‐induced mouse model of liver fibrosis. However, the precise mechanisms by which TGs and keratins contribute to hepatocyte damage remain unclear. This study investigates the molecular mechanisms underlying TG1‐ and TG2‐mediated cell death in hepatocytes exposed to bile acids. HepG2 cells and primary hepatocytes were treated with glycochenodeoxycholic acid (GCDCA), a toxic bile salt elevated in cholestasis. GCDCA‐reduced cell viability and induced apoptosis in a dose‐dependent manner. Knockdown of K18/K8 or TG1/TG2 by siRNA significantly attenuated GCDCA‐induced apoptosis, indicating their contributory roles in hepatocyte injury. GCDCA‐treated cells showed increased levels of proteins crosslinked by TG1 and TG2. In vivo analysis using cholestatic model mice also showed elevated high‐molecular‐weight protein complexes involving K18/K8, suggesting early‐stage Mallory body formation, as observed in chronic liver injury. Mass spectrometry identified cytoskeletal proteins, such as vimentin and periplakin, and regulatory proteins, such as ATP synthase subunit β and PI3K adapter protein, as K18‐crosslinked partners. These results suggest that TG1/TG2‐mediated aggregation of K18 sequesters essential structural and survival proteins, promoting hepatocyte apoptosis. Targeting these pathological interactions may provide a novel therapeutic strategy to mitigate liver fibrosis and improve hepatocyte survival.

Cholestasis and bile‐acid exposure enhance expression and activity of protein crosslinking enzymes TG1 and TG2 in hepatocytes. Substrate proteins were identified by mass spectrometry using biotin‐labeled peptides (pepK5/pepT26) or amine donor (biotinylated pentylamine; BPA). Crosslinking‐induced aggregation and fragmentation of keratin 18 and 8 (K18/K8) are suggested to alter stability and interactions, thereby promoting apoptosis in hepatocytes. These results suggest a novel mechanism linking abnormal protein crosslinking to cholestatic liver disease.

Abbreviations

BDL

bile duct ligation

BPA

biotinylated pentylamine

CBB

coomassie brilliant blue

FXIIIa

factor XIIIa

GCDCA

glycochenodeoxycholic acid

HRP

horseradish peroxidase

HRP‐SA

HRP‐conjugated streptavidin

K18

keratin 18

K8

keratin 8

PI3K

phosphoinositide 3‐kinase

SDS/PAGE

sodium dodecyl‐sulfate polyacrylamide gel electrophoresis

TG1

transglutaminase 1

TG2

transglutaminase 2

Introduction

Transglutaminases (TGs) are a crosslinking enzyme family that catalyzes the formation of isopeptide bonds between a specific glutamine (Gln) and lysine (Lys) residues in the presence of Ca²⁺ [1]. The TGs family consists of eight isozymes, TG1–7 and factor XIIIa (FXIIIa), which are distributed widely and involved in various biological and physiological processes, such as blood coagulation, cell envelope formation, signal transduction, and extracellular matrix stabilization. In the pathological functions, TGs are also involved in skin and liver diseases, celiac disease, inflammation, cancer, and neurodegeneration [2]. Previous research has reported the involvement of TG2 in liver diseases and demonstrated that TG2 plays an active role in the progression of liver injury and the fibrosis model both in vitro and in vivo [3, 4, 5]. Our previous study has also elucidated the involvement of TGs in liver injury [6, 7, 8] and fibrosis [9, 10].

Liver fibrosis is defined as the overgrowth, hardening, and/or scarring of tissues leading to the excess deposition of extracellular matrix components, which include collagen, in the liver [11]. In the initial steps of liver fibrosis, several tissue injury responses are triggered by various factors, such as alcohol abuse, nonalcoholic steatohepatitis, chronic hepatitis C virus infection, and alterations in the concentration of bile acids and cholestasis [12, 13]. As a result of these tissue injury responses, apoptosis is induced in parenchymal liver cells, hepatocytes, which play an important role in disease development. The injury responses also modulate the infiltration of inflammatory cells that produce several profibrotic cytokines. The release of cytokines causes uncontrolled collagen production by myofibroblasts, known as activated hepatic stellate cells, leading to fibrosis progression.

We have clarified that the expressions and activities of TG1 and TG2 isozymes are specifically up‐regulated in a mouse liver fibrosis model induced by bile duct ligation (BDL) [10]. BDL is a common experimental model used to induce obstructive fibrosis and cholestatic injury in mice and rats, leading to bile acid accumulation in the liver [10, 14]. Bile acid is a water‐soluble, amphipathic steroid acid synthesized in the liver. It is found predominantly in the bile, comprising 80% of the organic compounds present [15]. Studies have shown that high bile concentrations induce hepatocyte apoptosis in vitro, which triggers liver fibrosis and cholestatic liver injury in vivo [16]. It is known that bile acids such as glycochenodeoxycholic acid (GCDCA) and chenodeoxycholic acid (CDCA) induce hepatocyte apoptosis via the activated death receptor pathway, for instance, Fas, in a ligand‐independent manner [17]. GCDCA, the most abundant bile salt formed in the liver, has high toxicity and concentrations in the bile and serum following cholestasis. This makes it suitable for use in cellular models of the disease. In fact, toxic bile acids have caused injuries to isolated hepatocytes [18], cultured hepatocytes [19], and the intact liver [20].

To investigate the molecular mechanisms of TG1 and TG2, we established a global identification method for substrate proteins, incorporating isozyme‐specific substrate peptides for TG1 and TG2. Additionally, we successfully identified 43 and 42 possible substrates for TG1 and TG2, respectively, focusing on keratin 18 (K18) and keratin 8 (K8) as substrates for both enzymes [10]. K18 and K8 belong to the keratin family, the most diverse family of intermediate filament proteins, and are expressed in epithelial cells. Humans possess at least 54 functional keratin genes, classified into type I (K9 to K20) and type II (K1 to K8) keratins [21, 22]. Type I and type II keratins pair together to form heterodimer structures. Keratins are important for maintaining the mechanical stability and integrity of epithelial cells, and are involved in intracellular signaling pathways, such as cellular stress, wound healing, and apoptosis. K18 and K8 are typically co‐expressed in simple epithelial cells and uniquely in adult hepatocytes [22, 23, 24, 25]. Previous studies have reported K18 and K8 as being involved in hepatocyte death [26, 27]. K18 and K8 were found to play a protective role against TNF‐mediated apoptotic liver damage in mice and epithelial cells. They do this by binding with the cytoplasmic domains of TNFR2 to moderate the TNF‐dependent activation of JNK and NF‐kB transcription factor [28]. They were also found to be resistant to Fas‐mediated apoptosis via the modulation of Fas targeting to the cell surface [29]. Research on the cleavage of K18 by caspase‐3 reported that mice with mutations at caspase‐3 cleavage sites in K18 were more susceptible to Fas‐mediated liver apoptosis [30]. However, contradicting results showed that a similar K18 mutant in mice suppressed Fas‐mediated apoptosis [31].

Hence, although K18 and K8 involve hepatocyte death, the detailed mechanism has not yet been fully elucidated. Based on our previous results that both TG1 and TG2 crosslink K18 and K8 in the early phase of liver fibrosis induced by BDL, we focused on investigating the relationship between TG1/TG2 and K18/K8 in hepatocyte death induced by GCDCA. In this study, we will first confirm whether K18/K8 is indeed a substrate of TG1/TG2, initially by inducing hepatocyte cholestasis, and then comprehensively analyze the proteins crosslinked with K18 to further detail the unknown molecular mechanisms affecting hepatocyte death. These studies can enhance our understanding of the hepatocyte death pathway, a critical early step in several liver diseases, and elucidate the interaction network associated with Mallory bodies, including K18/K8, in liver injury. These studies may not only fill a gap in the understanding of the biochemical background of liver fibrosis but also lead to the development of new therapeutic strategies to control the disease by targeting these molecular interactions.

Results

Effects of TG1 and TG2 in the cell viability and death of GCDCA‐treated HepG2

Based on a previous study [32], we first determined the optimal concentration of GCDCA and then measured its effects on cell viability in HepG2 cells. GCDCA treatment dose‐dependently decreased cell viability (Fig. 1A) and increased caspase 3/7 activity (Fig. 1B) in HepG2 cells. The increase in caspase‐3 activity by GCDCA treatment was more sensitive, and more pronounced changes were observed in the primary hepatocytes isolated from mouse normal liver (Fig. 1C,D). We next investigated the biological roles of TG1 and TG2 in GCDCA‐treated HepG2. The knockdown of TG1 and TG2 was carried out by siRNA transfection into cells, and their knockdown efficiencies by siRNA were confirmed using RT‐qPCR and western blotting. These results showed effective suppression of TG1 and TG2 (Fig. 1E,F). The knockdown of TG1 and TG2 siRNAs suppressed reduced cell viability and caspase 3/7 activation in GCDCA‐treated HepG2 cells (Fig. 1G,H). Moreover, pan‐transglutaminase inhibitor, cystamine, also significantly inhibited the reduction in cell viability caused by GCDCA treatment (Fig. 1I). These results suggest that the crosslinking activities of TG1 and TG2 might involve hepatocyte apoptosis induced by GCDCA.

Fig. 1.

Effects of transglutaminase 1 (TG1) and transglutaminase 2 (TG2) on cell viability and apoptosis of glycochenodeoxycholic acid (GCDCA)‐treated HepG2 cells. HepG2 cells were treated with GCDCA at concentrations of 0, 100, 250, 500, and 1000 μm for 24 h to assess cell viability using WST‐8 assay (A) and caspase activities via caspase‐Glo 3/7 assay (B). Western blot analysis shows cleaved caspase‐3 levels in HepG2 cells (C) and primary hepatocytes isolated from mouse normal liver (D) treated with increasing concentrations of GCDCA. GAPDH is used as a loading control to ensure equal protein loading across the samples. Quantitative analyses of each cleaved caspase‐3 level, normalized to GAPDH, are provided. The cells were transfected with siRNAs targeting TG1 and TG2, or control nontarget siRNAs. After transfection, cells were lysed, and TG1 and TG2 mRNA and protein levels were measured by RT‐qPCR and western blotting, using GAPDH as a loading control (E, F). Additionally, siRNA‐treated cells were exposed to GCDCA at 0, 400, and 800 μm for further assessment of cell viability (G) and caspase activities (H). In parallel, cells were treated with GCDCA along with 10 μm cystamine or a vehicle control (I). Representative images from three independent experiments (n = 3). Statistical significance was determined by Student's t‐test, with **P < 0.01 and *P < 0.05 indicating significance. Comparisons were made between the control siRNA‐treated and the TG1 or TG2 siRNA‐treated groups (G–I).

Detection of possible substrates of TG1 and TG2 in GCDCA‐induced hepatocyte apoptosis

To investigate the functions of TG1 and TG2 in GCDCA‐treated HepG2, we detected Lys‐ and Gln‐donor substrates crosslinked by TGs. The biotinylated pepK5 and pepT26 that we previously used to detect Lys‐donor substrates crosslinked by TG1 and TG2, respectively [10]. The biotinylated pentylamine (BPA), a detection probe that is crosslinked to the Gln‐donor substrates by pan‐TGs, was incubated with extracts of HepG2 treated with indicated doses of GCDCA. The resultant proteins that incorporated these peptides or BPA were detected using HRP‐conjugated streptavidin (HRP‐SA) after SDS/PAGE (Fig. 2A). Compared with corresponding controls, GCDCA marginally increased the amounts of several proteins incorporated with pepK5 and pepT26 (Fig. 2A,B). Black arrowheads indicate the location of bands with significantly and slightly increased GCDCA‐dependent incorporation of pepK5 and pepT26, respectively, compared with the corresponding controls. No similarly enhanced bands were detected for BPA‐incorporated proteins (Fig. 2A,B). Since the pepT26‐incorporated proteins had significantly enhanced incorporation, as indicated by black arrowhead, these proteins were next purified with monoavidin resin and subjected to SDS/PAGE. After CBB staining, gels including these two bands were cut and digested by trypsin for in‐gel trypsin digestion for identification using MALDI‐TOF/TOF mass spectrometer. This result showed that K18 and K8 were included in these two enhanced bands (Fig. 2C and Table 3), which was consistent with the previous findings that K18 and K8 were crosslinked as substrates by TG1 and TG2 in a mouse liver injury model [10].

Fig. 2.

Detection of potential substrates in glycochenodeoxycholic acid (GCDCA)‐induced HepG2 cells. Cell extracts from HepG2 treated with 0, 400, and 800 μm GCDCA were incubated and crosslinked with biotinylated peptides pepK5, pepT26, and BPA by endogenous transglutaminases (TGs), followed by detection using horseradish peroxidase‐conjugated streptavidin (HRP‐SA) (A). Arrowheads indicate bands with significant or modest increases in protein levels, reflecting GCDCA‐induced changes in the incorporation of biotin‐pepK5 and biotin‐pepT26 into substrates compared with controls. GAPDH was used as a loading control. Protein band intensities were quantified using ImageJ and presented as bar graphs, normalized to the control (without GCDCA treatment) (B). Data are expressed as the mean ± SD (n = 3), with *P < 0.05 indicating statistical significance (Student's t‐test). Cell extracts from HepG2 cells treated with 0 or 800 μm GCDCA were incubated with biotin‐pepT26 by endogenous transglutaminase 2 (TG2). The proteins incorporated with pepT26 were purified with monoavidin resin and separated by SDS/PAGE, visualized with Coomassie brilliant blue (CBB) staining or transferred to a membrane; after dual visualization with HRP‐SA and CBB staining, the central portion of the relevant band was precisely cleaved to ensure accurate truncation based on increased incorporation with pepT26 as indicated with red arrowheads. The gels including these two bands were cut and digested by trypsin for in‐gel trypsin digestion for identification using MALDI‐TOF/TOF mass spectrometer (C).

Table 3.

Protein identification using MALDI‐TOF/TOF mass spectrometry of gel 1 and 2 regions containing bands with GCDCA‐dependent increased uptake of pepT26 after CBB staining.

Sample	Accession	Description
Gel 1	P04264	Keratin, type II cytoskeletal 1
	P17987	T‐complex protein 1 subunit alpha
	P35527	Keratin, type I cytoskeletal 9
	P13645	Keratin, type I cytoskeletal 10
	O60701	UDP‐glucose 6‐dehydrogenase
Gel 2	P13645	Keratin, type I cytoskeletal 10
	P48668	Keratin, type II cytoskeletal 6C
	P05787	Keratin, type II cytoskeletal 8
	P63261	Actin, cytoplasmic 2
	P04264	Keratin, type II cytoskeletal 1
	P05783	Keratin, type I cytoskeletal 18
	P49411	Elongation factor Tu, mitochondrial
	P08559	Pyruvate dehydrogenase E1 component subunit alpha, somatic form, mitochondrial
	P35527	Keratin, type I cytoskeletal 9
	P37268	Squalene synthase

Evaluation of K18 and K8 incorporated with substrate peptides during GCDCA‐induced hepatocyte apoptosis

To determine whether K18 and K8 are substrates for TG1 and TG2, proteins incorporating pepK5 or pepT26 were purified with monoavidin resin and analyzed via western blot using anti‐K18 and K8 antibodies, along with HRP‐SA (Fig. 3A,C). Following purification, levels of these pepK5 and pepT26‐incorporated proteins, including K18 and K8, were found to be significantly elevated in GCDCA‐treated HepG2 cells. The pepK5 and pepT26‐incorporated bands that are significantly increased by GCDCA treatment as detected by HRP‐SA are indicated by arrowheads, and quantitative analysis of the entire blot is shown in Fig. 3B,D, respectively.

Fig. 3.

Evaluation of K18 and K8 incorporated with pepK5 and pepT26 during glycochenodeoxycholic acid (GCDCA)‐induced hepatocyte apoptosis. Cell extracts prepared from GCDCA‐treated HepG2 were incubated and crosslinked with biotin‐pepK5 or biotin‐pepT26. The substrate proteins incorporated with pepK5 (A, B) and pepT26 (C, D) by endogenous transglutaminase 1 (TG1) and transglutaminase 2 (TG2), respectively, were purified using monoavidin resin and detected by immunoblotting using anti‐K18 and K8, and horseradish peroxidase‐conjugated streptavidin (HRP‐SA). Band intensities indicated by arrowheads in panels A and C were quantified using ImageJ and normalized to the control condition (without GCDCA treatment). The quantified results are shown as bar graphs in panels B and D. Data are expressed as the mean ± SD (n = 3), with **P < 0.01 and *P < 0.05 indicating significances (Student's t‐test).

TG1 and TG2 directly crosslink recombinant K18 or K8 proteins

Mouse recombinant K18 and K8 were prepared (Fig. 4A,B), and incubation of these proteins with TG1 or TG2 in the presence of pepK5, pepT26, BPA, or these peptide mutants (pepK5QN and pepT26QN), in which Gln was replaced with an asparagine, also resulted in the marked incorporations of pepK5 and pepT26 into both K18 and K8 (Fig. 4C,D). Interestingly, when K8 was incubated with pepT26 and TG2, a high‐molecular‐weight complex of K8 accumulated at the top of the stacking gel (Fig. 4D), indicating direct intermolecular crosslinking by TG1 or TG2, which was different from the results obtained with K18 (Fig. 4C). Furthermore, this result for K8 multimers was also observed in Fig. 3C.

Fig. 4.

Direct crosslinking of recombinant K18 and K8 proteins by transglutaminase 1 (TG1) and transglutaminase 2 (TG2). The K18 and K8 genes were cloned from cDNA derived from mouse liver tissue, and recombinant proteins were produced using E. Coli and purified using affinity resin. The purified K18 (A) and K8 (B) proteins were subjected to SDS/PAGE, and gels were stained with CBB. The lanes included initial crude extracts before purification (lane A), flow‐through fractions after resin binding (lane T), elution fractions collected during purification (lane E1–E5), and final protein samples recovered from the TALON resin following treatment with Laemmli sample buffer and boiling (lane SDS). Following purification, urea‐denatured proteins were refolded by stepwise dialysis in Tris–HCl and NaCl buffer, gradually decreasing urea concentrations from 4 m to 0 m to restore their native conformations. The K18 (C) and K8 (D) proteins were subjected to crosslinking reactions with biotin‐pepK5, biotin‐pepT26, and BPA. Arrowheads indicate bands corresponding to the molecular weight position of the monomeric K18 and K8 proteins. In parallel, the biotin‐pepK5QN and T26QN (each Gln was replaced with asparagine) were also used during the incubation for crosslinking reactions, respectively. The reaction products were then transferred onto membrane for detection using peroxidase‐conjugated streptavidin or CBB staining. Representative images from three independent experiments (n = 3).

Effects of K18 and K8 on GCDCA‐induced hepatocyte apoptosis

In HepG2 cells treated with GCDCA, the incorporation of pepK5 and pepT26 into K18 and K8 increased approximately threefold (Fig. 2A,B), while the expression level of K18 showed a slight decrease but was statistically significant (Fig. 5A, right graph). This suggests that the increased peptide incorporation into K18 is attributable to enhanced TG activity rather than an increase in the amount of K18 protein itself. Furthermore, K8 expression remained unchanged at the position of the main K8 band, although two lower molecular weight K8 bands indicated as ‘(2)’ were also detected and showed marginal enhancement (Fig. 5A). The siRNA targeting K18 and two different siRNAs targeting K8 (K8‐2 and K8‐3) significantly reduced the expression levels of both K18 and K8, compared with control cells transfected with nontargeting siRNA (Fig. 5B,C). The K18 knockdown (Fig. 5D) failed to show reduced cell viability (Fig. 5E) and enhanced apoptotic induction (Fig. 5F), whereas the K8 knockdown (Fig. 5G) also showed the suppression of GCDCA‐reduced cell viability (Fig. 5H), but no changes in caspase activation (Fig. 5I). These results suggest that K18 contributes to reduced cell viability through an apoptotic pathway, whereas K8 regulates cell viability in a caspase‐independent manner.

Fig. 5.

Effects of K18 and K8 on apoptosis in glycochenodeoxycholic acid (GCDCA)‐induced HepG2 cells. HepG2 cells were treated with GCDCA at concentrations of 0, 400, and 800 μm and subsequently analyzed for K18 and K8 expression using specific antibodies (A). Band intensities were quantified with ImageJ after normalization to GAPDH, and results presented as bar graphs normalized to the control treatment (without GCDCA treatment) (right panels). Western blot analysis and subsequent quantification were performed to assess the knockdown efficiency of K18 and K8 siRNAs (B, C). The efficiencies of two different K8 siRNAs (K8‐2 and K8‐3 siRNAs) were confirmed. In parallel, cells transfected with either nontargeting control siRNA or siRNA targeting K18 or K8 (two siRNAs due to suboptimal knockdown efficiency) were analyzed by western blot to evaluate protein modulation in response to GCDCA treatment. Relative protein levels are shown as bar graphs (D, G). These transfected cells were further treated with GCDCA at 0, 400, and 800 μm and assessed for changes in cell viability (E, H) and caspase activities (F, I). Representative images from three independent experiments (n = 3). Statistical significance was determined by Student's t‐test, with **P < 0.01 and *P < 0.05 indicating significance. Comparisons were made between the control siRNA‐treated and the K18 or K8 siRNA‐treated groups (D–I).

Involvement of cell death signals in GCDCA‐treated hepatocyte apoptosis

Apoptosis in GCDCA‐treated hepatocytes was induced through the multimerization of the tumor necrosis factor‐associated apoptosis‐inducing ligand (TRAIL) receptor [33]. Given that K18 and K8 interact with TNF receptors [29], we hypothesized that their crosslinking by TG1 and TG2 causes multimerization, induces apoptosis, and inhibits cell growth. Since TG1 and TG2 expressions are regulated by TNF signal and the multimerization of their receptors is promoted in the presence of TNF, we next examined whether co‐treatment of GCDCA and TNF‐α promotes crosslinking of K18. Protein incorporated with pepK5 and pepT26 markedly increased in HepG2 cells treated with both GCDCA and TGF‐α, compared to those treated with either agent alone (Fig. 6A). It is known that K18 is cleaved by caspase‐3 in hepatocellular injury by GCDCA, and the M30 antibody recognizing the K18‐Asp396 cleavage site has been used as a marker of apoptosis. The K18 degradation was not observed in GCDCA‐treated HepG2 (Fig. 5A), but when GCDCA was treated with TNF‐α or thapsigargin, which is the inducer of caspase‐3 activation and endoplasmic reticulum (ER) stress in HepG2 [34], bands that appeared to be K18 fragments were prominently observed in the insoluble fraction of cell extracts (Fig. 6B,C). These results suggest that TG1 and TG2 are involved in the crosslinked aggregation of K18 and K8 (like an inclusion body seen in vivo) during hepatocellular injury induced by GCDCA, which increases sensitivity to cytokines, such as TNF released during inflammation in vivo and contributes to apoptosis induction.

Fig. 6.

Role of cell death signaling pathway in HepG2 cells treated with glycochenodeoxycholic acid (GCDCA). HepG2 cells were treated with 0 or 400 μm GCDCA in the presence or absence of 40 ng·mL⁻¹ TNF‐α, and the cell extracts were incubated with biotin‐pepK5, biotin‐pepT26, or BPA. After crosslinking by endogenous transglutaminases (TGs), the reaction products were detected using horseradish peroxidase (HRP‐SA) (A). Arrowheads indicate bands showing a statistically significant increase in peptide incorporation compared with control. GAPDH was used as a loading control. In a parallel experiment performed without the addition of TG substrates, cells were treated with 40 ng·mL⁻¹ TNF‐α or 62.5 nm thapsigargin in combination with GCDCA, and K18 expression and cleavage were analyzed by immunoblotting using anti‐K18 and M30 antibodies to demonstrate caspase‐mediated degradation of K18 (B). Arrowheads indicate bands of degradation products showing significant or moderate increases compared with the control group. Band intensities were quantified using ImageJ and presented as relative values compared with untreated controls in bar graphs (C). Additionally, mouse liver extracts from Day 0 (Control) and Day 3 after BDL surgery were subjected to immunoprecipitation with an anti‐K18 antibody (left panel) and proteins were assessed by CBB staining to evaluate purity (right panel). The positions of excised gel regions (Gel 1 and 2) are indicated by blank squares, corresponding to proteins identified by mass spectrometry (D).

Identification of proteins crosslinked with K18 in mouse liver fibrosis model

We have identified proteins that are crosslinked with K18 by TG2 in an in vivo model. Since both K18 and K8 were previously shown to be crosslinked by TG1 and TG2 in a mouse liver injury model induced by BDL [10], we used this model to identify proteins that are crosslinked to K18. Anti‐K18 antibody was added to mouse liver tissue extracts collected on Days 0, 3, 7, and 14 after BDL surgery, and immunoprecipitation was performed using protein G Sepharose, followed by detection with an anti‐K18 antibody. The results revealed a notable increase in high‐molecular‐weight bands (approximately 75–250 kDa) compared with the monomeric position (approximately 50 kDa), with the strongest signal observed on Day 3 post‐BDL. Based on this, we selected tissue extracts from Day 3, when the increase in K18 was most prominent, for further analysis. Similar immunoprecipitation was performed again, and in this experiment, we specifically focused on protein bands with molecular weights greater than that of monomeric K18, as observed by electrophoresis under denaturing conditions, in which samples were boiled in the presence of a reducing agent and high concentration of SDS to disrupt noncovalent interactions. In the BDL model, a marked increase in signal intensity was observed, particularly in the high‐molecular‐weight range of 75–250 kDa. Therefore, two separate gel regions containing these increased signals were cut and subjected to mass spectrometry. As a result, 13 and 10 proteins were identified in the high (150–250 kDa: Gel 1) and medium molecular weight (50–150 kDa: Gel 2) regions, respectively, with a 1.2‐fold increase in the BDL model compared with the control sample (Fig. 6D and Table 4).

Table 4.

List of identified proteins crosslinked with K18 in the mouse liver fibrosis model (> 1.2‐fold).

Sample	Accession	Description	Fold change (BDL/Cont)
Gel 1 (150–250 kDa)	P18524	Ig heavy chain V region RF	Infinite
	P56480	ATP synthase subunit beta, mitochondrial	Infinite
	Q9R269	Periplakin	Infinite
	Q99K28	ADP‐ribosylation factor GTPase‐activating protein 2	91.40
	P53395	Lipoamide acyltransferase component of branched‐chain alpha‐keto acid dehydrogenase complex, mitochondrial	26.83
	P11679	Keratin, type II cytoskeletal 8	7.84
	Q99M73	Keratin, type II cuticular Hb4	6.03
	Q9EQ32	Phosphoinositide 3‐kinase adapter protein 1	1.49
	P20152	Vimentin	1.43
	Q9D2G2	Dihydrolipoyllysine‐residue succinyltransferase component of 2‐oxoglutarate dehydrogenase complex, mitochondrial	1.39
Gel 2 (50–250 kDa)	P20152	Vimentin	381.9
	Q07797	Galectin‐3‐binding protein	209.0
	Q9R269	Periplakin	66.0
	P20029	78 kDa glucose‐regulated protein	10.4
	Q9QWL7	Keratin, type I cytoskeletal 17	9.6
	P56480	ATP synthase subunit beta, mitochondrial	8.7
	Q99K28	ADP‐ribosylation factor GTPase‐activating protein 2	5.6
	P18524	Ig heavy chain V region RF	2.2
	P11679	Keratin, type II cytoskeletal 8	1.6

In both gel regions, several proteins exhibited significant increases, indicating their involvement in early‐stage hepatocyte death, observed 3 days post‐BDL surgery. Among the cytoskeletal and adhesion proteins, vimentin (P20152) displayed a striking 381.9‐fold increase in the Gel 2 region, indicating significant cytoskeletal changes. Similarly, periplakin (Q9R269) was not detected in control samples but was present in the BDL model, indicating a significant change. Although no pronounced increase in K18 was observed, K8 (P11679) increased by 7.8‐fold in the Gel 1, while keratin, type II cuticular Hb4 (Q99M73) and type I cytoskeletal 17 (Q9R269) also exhibited notable increases, further suggesting cytoskeletal involvement. Among the immune and stress response proteins, the Ig heavy chain V region RF (P18524) displayed an infinite fold change in the Gel 1, indicating a highly significant presence in the BDL model. Galectin‐3‐binding protein (Q07797) showed a 209‐fold increase in the Gel 2, suggesting a robust involvement in the immune response and hepatocyte injury, while the 78 kDa glucose‐regulated protein (P20029) increased by 10.4‐fold, indicating a response to cellular stress. Mitochondrial proteins also showed significant changes. ATP synthase subunit β (P56480) and other mitochondrial proteins exhibited significant increases compared with their levels in control samples, indicating major alterations in mitochondrial function. The lipoamide acyltransferase component of the branched‐chain alpha‐keto acid dehydrogenase complex (P53395) displayed a 26.8‐fold increase, while the dihydrolipoyllysine‐residue succinyltransferase component of the 2‐oxoglutarate dehydrogenase complex (Q9D2G2) showed a 1.4‐fold increase, further implicating mitochondrial involvement. Signaling and regulatory proteins also exhibited significant upregulation. ADP‐ribosylation factor GTPase‐activating protein 2 showed a 91.4‐fold increase in the Gel 1, indicating significant upregulation. Isoforms of phosphoinositide 3‐kinase (PI3K) adapter protein 1 showed increases of 2.41‐fold and 1.49‐fold in the Gel 1, suggesting alterations in signaling pathways.

These results suggest that in the BDL model, K18 is involved in crosslinking with various proteins across different molecular weight ranges. The identified proteins include cytoskeletal and adhesion proteins, immune and stress response proteins, mitochondrial proteins, and signaling molecules. This comprehensive protein profile indicates that K18 and its associated proteins play significant roles in the pathology of hepatocyte death.

Discussion

High concentrations of hydrophobic bile acid GCDCA are known to cause hepatocellular injury in chronic cholestatic liver diseases. Many experimental studies also demonstrate that toxic bile acids induce hepatocellular and liver injuries [18, 19, 20]. We have previously shown that TG1 and TG2 expression and activity are significantly increased in liver parenchymal cells in a mouse model of cholestasis induced by BDL [10]. Additionally, we found that K18 and K8, which are associated with hepatocyte death, were extensively crosslinked by both TG1 and TG2 in this model. Since we previously found that crosslinking by TG2 promotes hepatocyte apoptosis [6], we focused on investigating the relationship between TG1/TG2 and K18/K8 in hepatocellular injury induced by GCDCA. It has been reported that GCDCA induces apoptosis through both mitochondria‐mediated and ER stress‐associated pathways in hepatocytes [35, 36]. This is partially consistent with our present study, which confirmed that GCDCA‐treated HepG2 cells proceed through a similar apoptotic pathway involving inflammatory cytokines and ER stress. HepG2, a human hepatoma cell line, differs from normal hepatocytes in morphology and metabolism, but undergoes cell death via similar pathways, making it widely used in hepatocyte research. In addition, we also confirmed the apoptotic pathway observed in HepG2 was reproduced in the analysis using primary hepatocytes [6].

We determined the optimal GCDCA concentration to induce apoptosis in HepG2 cells by evaluating cell viability, caspase activity, phosphatidylserine exposure, and DNA fragmentation. Then, we next investigated the involvement of TGs in GCDCA‐induced apoptosis. The siRNA targeting TG1 and TG2 successfully knocked down these genes in HepG2 cells, revealing their pro‐apoptotic roles in GCDCA‐induced cell death. The knockdowns of TG1 and TG2 showed a decrease in the enhanced caspase activities in GCDCA‐treated HepG2. Interestingly, TG2 siRNA exhibited a significantly higher inhibitory effect on apoptosis than TG1 siRNA, suggesting that TG2 plays a predominant role in apoptosis induction in GCDCA‐treated HepG2 cells. However, it is premature to draw conclusions based on these results by completely distinguishing isozymes, since suppression of TG2 expression also affects TG1 expression in redundancy [37]. Furthermore, the inhibition of apoptosis by cystamine, a pan‐inhibitor of the TGs, underscores the importance of their crosslinking activity. The target proteins crosslinked with biotinylated pepK5 and pepT26 by TGs were detected and specifically enhanced in GCDCA‐treated HepG2. We believe that the enhanced bands in GCDCA‐treated HepG2 cells primarily reflect a significant increase in TG2 activity. However, these results may be attributed to both increased peptide incorporation (due to elevated TG activity) and potentially increased expression of substrate proteins in response to GCDCA. Furthermore, the band intensification may reflect not only a higher frequency of Lys residue modification but also incorporation at multiple Lys residues within the substrate proteins. Several proteins in the gel fractions after SDS/PAGE at the same positions as these enhanced bands were identified by mass spectrometry analysis, and among them, K18 and K8 were included. Further evaluation using antibodies after purification of biotin‐labeled TGs substrates also revealed that both K18 and K8 were crosslinked by TGs in GCDCA‐treated HepG2. In the case of K18 and K8, these expression levels are not increased by GCDCA treatment, suggesting that the enhanced peptide incorporation is mainly driven by increased TG activity. These results were consistent with our previous data on the identification of K18 and K8 as substrates of TG1 and TG2 in the mouse cholestatic liver injury model [10].

Further mass spectrometry analysis of the interaction network of K18 in liver extracts derived from the BDL model revealed that K18 plays a complex role in crosslinking with a variety of proteins with large differences in molecular weight. Notably, K18 interacts with structural proteins, such as vimentin and periplakin, which are pivotal during structural and functional adaptations in hepatocytes under stress. Additionally, proteins involved in critical signaling pathways, such as ADP‐ribosylation factor GTPase‐activating protein and PI‐3 K adapter protein, were identified. These proteins play essential roles in regulating cellular functions, including survival, growth, and metabolism. The PI‐3 K/Akt pathway, known for promoting cell survival and inhibiting apoptosis, appears integral to these processes. Given that ursodeoxycholic acid (UDCA), commonly used in treating cholestatic liver diseases, activates this survival pathway, PI‐3 K activity is closely linked to hepatocyte survival dynamics [38]. Our findings revealed that during hepatocyte injury, TG2 activity increases and facilitates the crosslinking of K18 with various survival‐related proteins into aggregates, potentially triggering cell death by disrupting survival signals.

Treatment of siRNA targeting K18 and K8 elucidated distinct roles in GCDCA‐induced apoptosis. Specifically, K18 enhanced pro‐apoptotic pathways, whereas K8 appeared to modulate cell viability through mechanisms independent of caspase activation. This differentiation in function suggests unique molecular pathways for each protein. Prior research indicates that both K18 and K8 are implicated in TNF‐mediated damage in hepatocellular contexts, with interaction involving TNF receptors (TNFRs), TRADD, and FAS influencing signal transduction pathways [26, 28]. Moreover, TNF‐α is known to exacerbate hepatocyte apoptosis following bile acid accumulation, as seen in bile duct ligated (BDL) mouse models [39]. The TNF signaling cascade, which operates through TNFR1 and TNFR2, plays a critical role in cellular processes, including proliferation, differentiation, and apoptosis, and is particularly relevant in liver injury scenarios [40, 41]. Despite attempts to delineate the interactions of K18 with components of the TNF pathway in GCDCA‐treated HepG2 cells using immunoprecipitation, no significant changes were observed in the binding dynamics with TRADD and FAS upon treatment with GCDCA. These findings highlight the complex regulation of hepatocellular apoptosis by TNF signaling and underscore the need for further studies to unravel the specific contributions of K18 and K8 within this pathway.

The expressions of TG1 and TG2 are regulated by TNF signaling, which also promotes the multimerization of their receptors in the presence of TNF. This regulation aligns with the observed enhancement of TG1 and TG2 activities following the combined treatment of GCDCA and TNF‐α (Fig. 6A). In our experiments conducted in this study, Gln‐donor probes (specifically pepK5 and pepT26) were incorporated into the substrate in the extract, and these probes did not react as Lys donors. While BPA is membrane‐permeable, pepK5 and pepT26 are not; it is necessary to perform peptide‐incorporation assays using cell extracts. However, we acknowledge that this experimental method has inherent limitations. In some experiments using BPA, even when extraction solutions were employed, we observed substrate crosslinking patterns that were similar to those seen in living cells. Nevertheless, in the present experiments, the physiological substrate specificity of TG1/TG2 may not have been fully recapitulated. Therefore, the identified crosslinked proteins should be regarded as a potential substrate pool rather than in vivo targets. Further validation in living cells or in vivo models will be essential to confirm their physiological relevance.

Interestingly, the cleaved product of K18, typically soluble, was found exclusively in the insoluble fraction. This suggests that modifications in the Lys residues of K18 and K8 by TG1 and TG2 could lead to their aggregation and subsequent cleavage. Furthermore, the application of thapsigargin, a known ER stress inducer, resulted in the activation of caspase‐3 in HepG2 cells [10], which was found to enhance the M30 levels in K18 fragments. Despite conflicting reports on the effects of caspase‐mediated cleavage of K18 on Fas‐stimulated apoptosis [31], previous findings suggest that apoptosis may be induced by the cleavage of residual endogenous K18. This raises intriguing questions about the role of cleaved K18 in promoting hepatocellular apoptosis, consistent with the outcomes of this study.

GCDCA‐treated HepG2 cells are involved in several pathways related to cell death. ER stress, a critical factor in the development of various liver diseases, such as Hepatitis C virus infection [39], nonalcoholic hepatic steatosis [40], and alcohol‐induced liver disease [41], is primarily induced by disruption in intracellular homeostasis and changes in the ER oxidative environment, leading to apoptosis [36]. Additionally, increased ER stress markers and autophagy, along with reduced levels of antioxidant proteins, were observed in GCDCA‐treated HepG2 cells. These findings indicate that the formation of high‐molecular‐weight complexes containing K18 and K8 may itself induce cell death via stress signals. The hypothesis is further supported by the observed suppression of GCDCA‐induced hepatocyte death when K18 expression is inhibited (Fig. 5D–F).

In this study, K18 and K8 were identified as isozyme‐selective substrates for TG1 and TG2 during human hepatocyte injury. These proteins were found to become insoluble through aggregation and cleavage upon injury, although the exact mechanisms of action via TG1 and TG2 remain under investigation. Further analysis of how TG1 and TG2‐mediated crosslinking modifications affect hepatocellular apoptosis may elucidate novel molecular mechanisms underlying liver injury, inflammation, and fibrosis, potentially leading to new therapeutic and preventive strategies for liver diseases.

Materials and methods

Materials

Chemical reagents were mainly purchased from WAKO chemicals (Osaka, Japan) and Nacalai Tesque (Kyoto, Japan). Anti‐K18 and anti‐K8 antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA) and Novus Biologicals (Centennial, CO, USA). TG1 and TG2 antibodies were produced in the laboratory as homemade antibodies, while horseradish peroxidase (HRP)‐conjugated anti‐rabbit and ‐mouse secondary antibodies were purchased from Jackson ImmunoResearch (West Grove, PA, USA). Anti‐K18 monoclonal and polyclonal antibodies were from Abcam (Cambridge, UK) and Santa Cruz Biotechnology, respectively. Anti‐K8 antibody was from Novus Biologicals. GAPDH monoclonal antibody was from Merck Millipore (Burlington, MA, USA). Cell counting Kit‐8 was purchased from Dojindo (Kumamoto, Japan), while Caspase‐Glo 3/7 was purchased from Promega (Madison, WI, USA). Surebeads were purchased from Bio‐Rad (Hercules, CA, USA). Dulbecco's modified Eagle's medium (DMEM), 4′,6‐diamidino‐2‐phenylindole (DAPI), and GCDCA were purchased from Nacalai Tesque. Lipofectamine RNAiMAX Transfection Reagent was purchased from Thermo Fisher (Waltham, MA, USA).

Cell culture

The HepG2 cell line (RRID:CVCL_0027; RCB1648) was obtained from the RIKEN Cell Bank (Tsukuba, Japan). The supplied information included the cell line identity and quality control documentation. All experiments were conducted with mycoplasma‐free cells. GCDCA was dissolved in sterile water to 100 mm, and HepG2 was treated with GCDCA at final concentrations of 200–800 μm for 24 h in human hepatocyte cell lines cultured in DMEM containing 5% FBS and 0.5% penicillin–streptomycin. TNF‐α (40 ng·mL⁻¹) or thapsigargin (62.5 nm) was administered simultaneously with GCDCA for 24 h, starting the day after cell seeding. To transfect siRNAs into HepG2 cells, each siRNA duplex (nontargeting and specific‐targeting siRNAs for human TG1, TG2, K18, K8‐2, and K8‐3) was diluted in DMEM to yield a concentration of 50 nm mixture. The Lipofectamine reagent RNAiMAX was then mixed with medium containing the siRNA solution at a ratio of 1 : 100 (v/v) and aliquoted in culture dishes to incubate for 15 min at room temperature. Then, HepG2 cells in DMEM supplemented with 5% FBS were seeded at a density of 1 × 10⁵ cells per well. Information for each siRNA is listed in Table 1. MISSON siRNA universal negative control #1 (SIC‐001) from Sigma‐Aldrich was used as control.

Table 1.

Each siRNA sequence of specific targeting to human TG1, TG2, K18, K8‐2, and K8‐3.

Gene	Sense	Antisense
TG1	5′‐CCAUCAUCGGCAAGUUUCATT‐3′	5′‐UGAAACUUGCCGAUGAUGGTT‐3′
TG2	5′‐CCCUGAUCGUUGGGCUGAATT‐3′	5′‐UUCAGCCCAACGAUCAGGGTT‐3′
K18	5′‐GGUCAUUGAUGACACCAAUTT‐3′	5′‐AUUGGUGUCAUCAAUGACCTT‐3′
K8‐2	5′‐GCACAAAGACTGAGATCTCTT‐3′	5′‐GAGAUCUCAGUCUUUGUGCTT‐3′
K8‐3	5′‐GCATGTACCAGATCAAGUATT‐3′	5′‐UACUUGAUCUGGUACAUGCTT‐3′

Cell viability assay

The cell viabilities of HepG2 cells were evaluated using a Cell Counting Kit‐8 (Dojindo) 24 h after GCDCA treatment. The 450 nm absorbance of the cell supernatant was measured at 20 min using spectrophotometer (Vient‐Nano; BioTek Instrument Inc., Winooski, VT, USA).

Cell death assay

Cell death in HepG2 cells was determined using the Caspase‐Glo 3/7 assay system (Promega) 24 h after GCDCA treatment. Caspase 3/7 activity was measured using a luminescence analyzer (EnSpire; PerkinElmer, Waltham, MA, USA) 2 h after the addition of the reagent.

Quantitative real‐time PCR

Total RNA was extracted from cultured cells using Sepasol‐RNA Super Reagent (Nacalai Tesque). Corresponding cDNA was synthesized using the ReverTra Ace qPCR RT Master Mix with gDNA Remover kit (TOYOBO, Osaka, Japan). Real‐time PCR analysis was conducted using THUNDERBIRD SYBR qPCR Mix (TOYOBO) in a LightCycler 96 (Roche Diagnostics, Mannheim, Germany). Specific primer pairs used are listed in Table 2.

Table 2.

Primer pairs for RT‐qPCR experiments in HepG2.

Gene	Forward	Reverse	Product size
TG1	TGCCCAGAGGACATTGTGTA	GTGGTCAAACTGGCCGTAGT	135
TG2	ATGCCGACGTGGTAGACTGG	CACTGCCCATGTTCATGCTC	270
K18	ACAGTCTGCTGAGGTTGGAGCT	TCCAAGCTGGCCTTCAGATTTC	111
K8	GCTGACCGACGAGATCAACT	CATGGACAGCACCACAGATG	97

Western blotting

HepG2 cells were lysed in a buffer containing 10 mm Tris–HCl (pH 8.0), 150 mm NaCl, 0.5 mm EDTA, 1% Triton X‐100, 1 mm β‐mercaptoethanol, and protease inhibitors (Calbiochem, Darmstadt, Germany). The lysates were sonicated, centrifuged, and the supernatants were mixed with Laemmli sample buffer. Samples were then subjected to SDS/PAGE and transferred to a PVDF membrane. This membrane was incubated with primary antibodies, followed by HRP‐conjugated secondary antibodies, and detected using a chemiluminescence reagent (Thermo Scientific, Waltham, MA, USA). The anti‐GAPDH antibody was used as a loading control.

Detection of potential substrates using extracts from HepG2 cells

The detection of crosslinked substrate was performed as reported previously [10]. The extracts of HepG2 cells (10–20 μg) were incubated in a reaction mixture containing 100 mm Tris–HCl (pH 8.0), 1 mm dithiothreitol (DTT), and 5 mm CaCl₂ with each biotinylated substrate peptide (pepK5 and pepT26; membrane‐impermeable) and pentylamine (BPA). In the pull‐down assay for these biotinylated substrates, these samples were purified by reaction with SoftLink™ Soft Release Avidin Resin (Promega) after the crosslinking reaction with endogenous TGs in the extracts. The reaction products were then subjected to SDS/PAGE and blotted on a PVDF membrane. The biotinylated peptide‐incorporated proteins were detected using peroxidase‐conjugated streptavidin and a chemiluminescence reagent. Mutant peptides in which Gln residues were exchanged with asparagine residues (pepK5QN and pepT26QN) were used as negative controls.

Preparation of recombinant mouse K18 and K8 proteins

cDNA for mouse K18 and K8 was synthesized from total RNA extracted from mouse liver tissues using the FavorPrep Tissue Total RNA Mini Kit (FAVORGEN Biotech Corp., Pingtung, Taiwan), followed by DNase I treatment (Takara Bio, Shiga, Japan) to remove genomic DNA. Reverse transcription was performed using PrimeScript Reverse Transcriptase (Takara Bio) according to the manufacturer's instructions. The resulting cDNAs for K18 and K8 were cloned into expression vectors and subsequently transformed into Escherichia coli strains BL21(DE3)pLysS and BL21(DE3)pLysE, respectively. Transformed bacteria were cultured in LB medium containing 30 μg·mL⁻¹ kanamycin and 34 μg·mL⁻¹ chloramphenicol at 37 °C. Protein expression was induced by IPTG to a final concentration of 1 mm during the logarithmic growth phase, followed by incubation for 3 h at 37 °C. After incubation, proteins were extracted using a urea‐containing lysis buffer composed of 8 M Urea, 10 mm Tris–HCl (pH 8.0), 150 mm NaCl, 1 mm β‐mercaptoethanol, and 10 mm Imidazole. The proteins were then purified using TALON® metal affinity resin.

Animal experiments and ethics statement

C57BL/6J male mice (8–12 weeks) were purchased from Japan SLC Inc (Shizuoka, Japan) and housed in groups of three to four mice per cage with food and water available ad libitum. The surgical laparotomy and BDL were performed as reported previously [10]. Briefly, the common bile duct was double ligated and cut between the ligatures. Mice were perfused with PBS to remove the blood in the liver, and pieces of the livers were stored for use in other experiments. Animal experiments were conducted at Nagoya University, complying with the national guidelines for the care and use of laboratory animals. All animal experiments were approved by the animal care and use committee of Nagoya University (no.: P240004). All animal experiments were performed under anesthesia, and all efforts were made to minimize suffering.

Immunoprecipitation

Liver tissue from BDL‐treated mice was homogenized in cold lysis buffer (10 mm Tris‐Cl, pH 8.0; 150 mm NaCl; 1% Triton X‐100; 0.5 mm EDTA; 1 mm β‐mercaptoethanol; protease inhibitors). The homogenate was sonicated and centrifuged at 12 000 rpm for 5 min at 4 °C, and the supernatant, designated as liver tissue extract, was collected. This extract (1 mg of total protein) was diluted to 1 mL with volume up buffer (10 mm Tris‐Cl, pH 8.0; 150 mm NaCl; 0.1% Triton X‐100; 0.5 mm EDTA; 1 mm β‐mercaptoethanol; protease inhibitors) and mixed with 10 μL of Protein G Sepharose 4 Fast Flow (GE Healthcare, Chicago, IL, USA) adjusted to a 50% slurry. After centrifugation at 12 000 g for 20 s, the supernatant was incubated with either polyclonal anti‐K18 antibody (Proteintech, Rosemont, IL, USA) or 2 μg of rabbit nonimmune IgG, and stirred at 4 °C for 1 h. Subsequently, 10 μL of Protein G Sepharose 4 Fast Flow adjusted to a 50% slurry was added and the mixture was stirred for another hour at 4 °C. Postincubation, the supernatant was removed by centrifugation at 12 000  g for 20 s and washed three times with volume up buffer. The proteins were then eluted with 1× nonreducing SDS sample buffer (62.5 mm Tris–HCl, pH 6.8; 2% SDS; 10% glycerol; 0.0025% BPB; 5 mm EDTA), separated by SDS/PAGE, and detected by western blotting. The relevant bands were excised from a Coomassie brilliant blue (CBB)‐stained gel. Further processing and mass spectrometry analysis (ESI‐qIT/MS) were conducted [42], and the data were analyzed using Thermo Scientific™ Proteome Discoverer™ 2.2 and Perseus software (version 1.6.2.3).

Statistics

The paired Student's t‐test was used to evaluate the differences between two groups of datasets. P‐values less than 0.05 (*) and 0.01 (**) were considered statistically significant compared with the control sample.

Conflict of interest

The authors declare no conflicts of interest.

Author contributions

H.T. and K.H. designed the research. H.N., C.M.Y., and K.K. performed the research. H.T. analyzed the data and wrote the paper.

Data availability statement

All data supporting the findings of this study are available within the article.