Abstract
Myocardial fibrosis serves as a fundamental pathology for the pathogenesis and progression of cardiovascular diseases, characterized primarily by excessive proliferation of cardiac fibroblasts and pathological accumulation of extracellular matrix components. Although Schisandra sphenanthera fruit exhibits diverse pharmacological properties, its therapeutic potential for myocardial fibrosis remains unexplored. In this study, a phenylpropanoid compound designated W-23 (Xanthiumnolic C) was isolated from Schisandra sphenanthera. Structural elucidation was achieved through mass spectrometry (MS), nuclear magnetic resonance (NMR) spectroscopy, and carbon spectrum analysis. The antioxidant and antimyocardial fibrosis activities of Xanthiumnolic C were evaluated in vitro. Xanthiumnolic C demonstrated significant antioxidant activity. In a cellular model of myocardial fibrosis, administration of Xanthiumnolic C significantly suppressed the expression of Vimentin (Vim), α-Smooth Muscle Actin (α-SMA), and proteins associated with the TGF-β/Smad signaling pathway, while concurrently downregulating levels of type I and III collagen. Furthermore, Xanthiumnolic C reduced the mRNA expression of Acta2, FN, Col 1 1a1, Vim, MMP-2, and MMP-9. Collectively, these effects ameliorated myocardial fibrosis, suggesting that Xanthiumnolic C holds promise as a potential therapeutic agent for antimyocardial fibrotic drug development.


1. Introduction
Cardiovascular disease (CVD) is a leading cause of death worldwide. According to the World Health Organization (WHO), 17.9 million people died from cardiovascular disease in 2019, accounting for 32% of the global deaths. Therefore, it is crucial to detect cardiovascular disease as early as possible to initiate treatment with medication. Myocardial fibrosis (MF) is a prevalent physiological and pathological mechanism underlying CVD. The primary characteristics of MF include high mortality rates, complex mechanisms, and rapid onset. Transforming growth factor TGF-β1/Smad is a crucial signaling pathway involved in fiber formation during cardiac fibrosis. It can activate cardiac fibroblasts (CFs) and promote the accumulation of extracellular matrix (ECM) components in the heart. Clinically, various antihypertensive medications, such as captopril, losartan, and dapagliflozin, are employed to mitigate the onset and progression of MF. However, these medications often result in considerable toxicity and side effects, underscoring the urgent need for the development of new anticardiac fibrosis agents. Investigating the pathogenesis of myocardial fibrosis mediated by the TGF-β/Smad signaling pathway is crucial for identifying therapeutic targets and developing antifibrosis strategies.
Perennial and deciduous Schisandra sphenanthera belongs to the Schisandra genus erennial anin the Magnoliaceae family and is fully encountered throughout Northeast and Northwest China. There are approximately 30 distinct varieties of Schisandra sphenanthera plants worldwide, with our country having the largest number. According to clinical pharmaceutical studies, lignans, volatile oils, phenolic acids, alkaloids, flavonoids, and polysaccharides are the active components of Schisandra sphenanthera. These components have various benefits, including liver protection, , immunomodulatory activity, , anti-inflammatory, anti-bacterial, anti-obesity, anti-cancer, anti-diabetic nephropathy, , anti-depressant, anti-anxiety, and enhancement of the reproductive system. It is frequently employed in traditional medicine and in functional foods, which are extensively used in daily dietary health care. Therefore, a current concern in the field of plant resource utilization research in China is the rational development and usage of Schisandra resources, alongside the extraction of its useful components for the treatment of human diseases.
The majority of current research on the Schisandra sphenanthera compound W-23 (Xanthiumnolic C) focuses on its isolation and extraction. There is limited investigation into the compound’s potential for treating cardiac fibrosis. Therefore, this paper examines the antioxidant capacity of compound W-23 (Xanthiumnolic C), which is isolated from the stems of Schisandra sphenanthera. A myocardial fibrosis cell model was developed by stimulating cardiac fibroblasts with TGF-β1 to explore the role of this compound in myocardial fibrosis and its underlying mechanisms. This research provides a theoretical and experimental foundation for the comprehensive utilization of Schisandra sphenanthera as a medicinal resource and for the development of therapies aimed at combating myocardial fibrosis.
2. Materials and Methods
2.1. Materials and Instruments
2.1.1. Experimental Materials
The stems of Schisandra sphenanthera Mount Taibai in the Qinling Mountains, Shaanxi province, P.R. China, in August 2020. The plant specimens were identified by Dr. Zhou Yafu of the Shaanxi Provincial Institute of Botany and are currently preserved in their herbarium.
CFs were generously provided by Xingbo Xu from Georg-August University in Germany.
2.1.2. Experimental Reagents
Methanol, ethyl acetate, and other reagents used are of analytical grade (Tianjin Comio Company), while the water utilized is ultrapure. The total antioxidant capacity (T-AOC), hydroxyl radical scavenging ability, and DPPH free radical scavenging ability were assessed using kits from Grease Biotechnology Co., Ltd. The DMEM medium was sourced from VivaCell, and trypsin was obtained from China Solaibao Company. For whole protein extraction, a kit from Nanjing Kaiji Biological Development Co., Ltd. was employed. The antibodies used include α-SMA, Smad2/3, p-Smad2, and p-Smad3, sourced from Affinit. The PVDF membrane was obtained from Millipore, USA, and DAPI staining solution was provided by Beijing Saiwen Innovation Biotechnology Co., Ltd. Additionally, HiScript III All-in-One RT SuperMix Perfect for qPCR was sourced from Nanjing Novizan Biotechnology Co., Ltd.
2.1.3. Instruments and Equipment
Bruker AV-400 Nuclear Magnetic Resonance Spectrometer (Bruker, Switzerland); Thermo Fisher Q-Exactive Mass Spectrometer (Thermo Fisher, USA); Eyela N-1100 Rotary Evaporator (Tokyo Physical and Chemical Co., Ltd.); column chromatography normal phase silica gel and thin layer chromatography plates (particle sizes: 100–200 mesh, 200–300 mesh, 500–600 mesh; chromatographic plate specification: GF254; Qingdao Ocean Chemical Plant); KQ-250E semipreparative high-performance liquid chromatography (HPLC) was conducted using a Newstyle NP7000 pump equipped with a Newstyle NU3000 detector set to wavelengths of 254 and 210 nm. The separation utilized a YMC-Pack Pro C18 RS column (250 × 20 mm, S-5 μm, 8 nm). Ultrasonic Cleaner (Kunshan Ultrasonic Instrument Co., Ltd.); BT-125D Electronic Analytical Balance (Sartorius, Germany); SHB-II Circulating Water Multi-Purpose Vacuum Pump (Zhengzhou Great Wall Technology Industry and Trade Company); HH-3A Thermostatic Water Bath (Jintan Jingda Instrument Manufacturing Co., Ltd.); 75002401 Centrifuge (Thermo, USA); VLBLATGD2 Microplate Reader (GIO-RAD, USA); Imager600 GE Chemiluminescence Detector (GE, USA).
2.2. Separation and Extraction of Compounds
A total of 35.0 kg of Schisandra sphenanthera stems were dried, crushed, and soaked in an 80% ethanol solution at room temperature five times. The extracts were combined, and the ethanol was removed by vacuum distillation. After allowing the mixture to stand overnight, the sediment was filtered. The filtrate was then extracted with ethyl acetate five times, and the resulting extract was concentrated under reduced pressure to yield 1.24 kg an ethyl acetate extract. This extract was mixed with 1.5 kg of 100–200 mesh silica gel, and 5 kg of silica gel (200–300 mesh) was utilized for silica gel column chromatography. Gradient elution with chloroform/acetone (100:0, 50:1, 40:1, 30:1, 20:1, 10:1, 5:1, 4:1, 3:1, 2:1, 1:1, and 0:100) was performed, and thin-layer chromatography (TLC) was used for monitoring. The combined fractions yielded seven components, designated as F.A. to F.G.
Fr. D (190.0 g) was decolorized by MCI column chromatography with a gradient elution of methanol and water (3:7 to 0:1). TLC monitoring was employed to combine similar components, resulting in four fractions: D1-D4. Subsequently, Fraction D4 (8.0 g) underwent silica gel column chromatography with a petroleum ether and acetone gradient elution (1:1, 1:2, 1:3, 1:4, 0:1). The HPLC liquid phase consisted of a methanol and water system with an RP-18 column, yielding a semipurified compound, W-23 (18 mg).
2.3. Analysis of Antioxidant Activity
2.3.1. Total Antioxidant Capacity (T-AOC)
The T-AOC of the isolated compound W-23 was assessed according to the kit instructions. Allow the solution to stand in the dark for 6 min at room temperature (25 °C), using various concentrations of vitamin C as a standard (the same below). Measure the absorbance value A at 414 nm.
| 1 |
| 2 |
2.3.2. DPPH Free Radical Scavenging Ability
The DPPH radical scavenging ability of compound W-23 was assessed following the kit’s instructions. After allowing the sample to stand for 30 min at room temperature (25 °C) in the dark, centrifuge at 12,000 rpm for 5 min. Measure the absorbance value A at 517 nm.
| 3 |
| 4 |
2.3.3. Hydroxyl Radical Scavenging Ability
The hydroxyl radical scavenging ability of the isolated compound W-23 was assessed according to the kit instructions. The absorbance value A of each tube was measured at 510 nm.
| 5 |
2.4. Determination of Anti-Myocardial Fibrosis Activity In Vitro
2.4.1. CFs Culture and Grouping
CFs were routinely cultured in DMEM supplemented with 10% FBS in a humidified atmosphere of 5% CO2 at 37 °C. Cells were passaged upon reaching 80–90% confluence. Following 1–2 passages of subculturing, CFs stimulated with 10 ng·mL–1 TGF-β1 for 48 h to establish cellular model of MF. All experiments in this study were performed using cells between passages 5 and 10 to ensure phenotypic stability and reproducibility.
2.4.2. Morphological Identification
Following 48 h of incubation with designated treatments according to experimental grouping, CFs were subjected to morphological analysis via inverted fluorescence microscopy.
2.4.3. Determination of Cell Viability
CFs in the logarithmic growth phase were trypsinized and seeded into 96-well plates at a density of 5 × 104 cells per well. Following 24 h of incubation under standard culture conditions (37 °C, 5% CO2), cells achieved full adherence prior to subsequent experimental procedures. Subsequently, divide the cells into the following groups: the blank group (culture medium only), the control group (culture medium + cells), model group (10 ng·mL–1 TGF-β1), the drug group (25, 50, 100, 200, 500 μg·mL–1 Xanthiumnolic C + cells), and the postinduction treatment group (10 ng·mL–1 TGF-β1 + 10, 25, 50, 100, 200, 300, 400 μg·mL–1 Xanthiumnolic C + cells). After administering the drug, incubate for an additional 48 h. At the end of the incubation period, add 10 μL of CCK-8 working solution to each well. Continue the incubation for 3 h, then measure the absorbance at 450 nm.
| 6 |
2.4.4. Measurement of Intracellular ROS
CFs in the logarithmic growth phase were trypsinized, seeded into 6-well plates at a density of 1 × 105cells per well, and allowed to adhere overnight. The cells were then divided into four groups: control group, model group (10 ng·mL–1 TGF-β1), positive control group (10 ng·mL–1 TGF-β1 + 10 μM Captopril), and drug-treated group (10 ng·mL–1 TGF-β1 + 50 μg·mL–1 Xanthiumnolic C). After 48 h of treatment, the medium was removed. The cells were incubated with 1 mL of DCFH-DA (diluted 1:1000 in serum-free medium) at 37 °C for 30 min in the dark. After incubation, the cells were washed three times with serum-free medium. Fluorescence images were captured using a fluorescence microscope.
2.4.5. Western Blotting
The cells were inoculated in 6-well plates, with a cell density of 1 × 105 in each well. After 24 h of culture, the cells were divided into four groups: the control group, the model group (10 ng·mL–1 TGF-β1), the positive control group (10 ng·mL–1 TGF-β1 + 10 μM captopril), and the drug group (10 ng·mL–1 TGF-β1 + 50 μg·mL–1 Xanthiumnolic C). After 48 h of culture, the cells were lysed, and total protein was extracted. Following quantitative analysis, polyacrylamide gel electrophoresis was performed, and the proteins were transferred to a PVDF membrane. The membrane was blocked with 5% skim milk at room temperature for 1 h, and then incubated with antibodies: β-actin, Vim, α-SMA, Smad2/3, P-Smad2, P-Smad3, Collagen I, Collagen III, and FN (Note: all antibody dilution ratio of 1:1500). After incubating on a shaking table for 4 °C 12 h, the membrane was washed four times with 1 × TBST (10 min/time). The corresponding antirabbit or antimouse antibodies were then incubated at room temperature for 1 h and washed four times with TBST. Luminescent solutions A and B were mixed in equal volumes, developed in a chemiluminescence imager, and analyzed quantitatively for protein levels using ImageJ.
2.4.6. Immunofluorescence
The cells were inoculated after being placed in a 6-well plate, with a density of 1 × 105 cells per well. Following 24 h of culture, the cells were divided into three groups: the control group, the model group (10 ng·mL–1 TGF-β1), and the drug group (10 ng·mL–1 TGF-β1 + 50 μg·mL–1 Xanthiumnolic C). After an additional 48 h of culture, the cells were washed three times with PBS. They were then fixed with 4% paraformaldehyde for 20 min, followed by three washes with PBS. The cell slides were removed and allowed to dry. The cells were permeabilized with 0.5% Triton X-100 for 15 min, blocked with 5% BSA for 1 h, and then incubated with the primary antibody for 12 h (Note: all primary antibodies for immunofluorescence were diluted at a ratio of 1:500). After incubation, the cells were washed three times with PBS, followed by incubation with a fluorescent secondary antibody for 1 h. Subsequently, DAPI was added and allowed to stand for 10 min. The slides were placed on a glass slide with 10 μL of antifluorescence quencher, fixed with nail polish, and photographed under a microscope.
2.4.7. Real-Time Quantitative PCR Analysis
After culturing the CFs in groups, total RNA was extracted from the cells using the TRIzol method. The concentration of the RNA was determined, and complementary DNA (cDNA) was generated through reverse transcription. Using the mRNA expression levels of Acta 2, Vim, FN, Col 1 1a1, MMP-2, and MMP-9 as templates, reverse transcription polymerase chain reaction (RT-PCR) was conducted to amplify the target genes. GADPH was chosen as the internal reference gene. Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the primer sequences are presented in Table .
1. Primer Sequences.
| Gene | Primer sequences(5′→3′) |
|---|---|
| GADPH | F: GCAAATTCAACGGCACAGTCAAG |
| R: TCGCTCCTGGAAGATGGTGATG | |
| Col 1 1a1 | F: AGGCGAACAAGGTGACAGAGG |
| R: GGAGAACCAGGAGAACCAGGAG | |
| FN | F: CTTGGTGGCTGTGAAAGGGAAC |
| R: CTCGGTGTTGTAAGGTGGAATGG | |
| MMP-2 | F: CCATGCGGAAGCCAAGATGTG |
| R: GGTTTCAGGGTCCAGGTCAGG | |
| MMP-9 | F: AATAAAGACGACATAGACGGCATCC |
| R: AGTTGTGGTGGTGGCTGGAG | |
| Vim | F: CTGCTGGAAGGCGAGGAGAG |
| R: TCAACCGTCTTAATCAGGAGTGTTC | |
| Acta 2 | F: CATCAGGGAGTAATGGTTGGAATGG |
| R: GTTCTATCGGATACTTCAGCGTCAG |
2.5. Statistical Analysis
Excel and GraphPad Prism 9.5.0 (GraphPad Software Inc., La Jolla, CA, USA) software were utilized for data analysis and graphing. All data are presented as means ± standard deviation (x ± s), with all measurements repeated at least three times. Data that conform to a normal distribution will be analyzed using one-way ANOVA, with pairwise comparisons conducted using t tests. Data that do not conform to a normal distribution will be analyzed using nonparametric tests. p < 0.05 is considered statistically significant.
3. Result
3.1. Structural Identification of Compounds
Compound W-23: White solid, HR-ESI-MS [M + Na] + m/z 579.2200; calculated value: m/z 579.2206, speculated that the molecular formula is C30H36O10Na.
1H NMR (500 MHz, Methanol-d4) δ 7.00 (1H, d, J = 11.7 Hz, H-5′), 6.99 (1H, br.s, H-2′), 6.94 (1H, br.s, H-2), 6.90 (2H, d, J = 8.2 Hz, −6′), 6.84 (H, d, J = 8.6 Hz, H-6), 6.81 (1H, br.s, H-5), 6.72 (1H, s, H-5), 6.71 (1H, s, H-6″), 5.50 (1H, d, J = 6.0 Hz, H-7′), 4.81 (2H, d, J = 6.0 Hz, H-7), 4.41–4.33 (1H, m, H-8), 3.85 (3H, s, 3-OCH3), 3.84–3.80 (1H, m, H-9′), 3.78 (3H, s, 5-OCH3), 3.79–3.75 (1H, m, H-9′ and 9), 3.75 (1H, s, 3′-OCH3), 3.57 (3H, t, J = 6.6 Hz, H-9″), 3.49–3.39 (1H, m, H-9), 2.62 (3H, t, J = 7.9 Hz, H-7″), 1.98–1.67 (3H, m, H-8″).13C NMR (125 MHz, Methanol-d4) δ 151.9 (C-3′), 148.9 (C-4′), 148.65 (C-3), 147.5 (C-4″), 146.9 (C-4), 145.2 (C-3″), 137.5 (C-1′), 137.0 (C-1″), 134.0 (C-1), 129.7 (C-5″), 121.0 (C-6), 119.3 (C-6′), 118.9 (C-5′), 117.9 (C-6″), 115.6 (C-5), 114.1 (C-2″), 111.8 (C-2), 111.1 (C-2′), 88.6 (C-7′), 86.2 (C-8), 74.1 (C-7), 65.0 (C-9′), 62.2 (C-9″), 62.2 (C-9), 56.7 (3-OCH3), 56.4 (3′-OCH3), 56.3 (3″-OCH3), 55.5 (C-8′), 35.8 (C-8″), 32.9 (C-7″).
Based on the spectral data analysis presented above, along with the literature reports , W-23 has been identified as Xanthiumnolic C. Its chemical structure is illustrated in Figure .
1.

Structural diagram of W-23.
3.2. Antioxidant Activity
As shown in Figure , compound Xanthiumnolic C exhibits antioxidant properties, as well as the ability to scavenge DPPH free radicals and hydroxyl radicals. The total antioxidant and hydroxyl radical scavenging capacities of the compounds were higher than those of vitamin C and demonstrated a trend of initially increasing and then decreasing with rising concentration. In contrast, the DPPH free radical scavenging ability of the compound was slightly lower than that of vitamin C. As the concentration of the compound increased, the DPPH free radical scavenging activity also showed a trend of initially increasing and then decreasing.
2.
Results of antioxidant activity determination for compound Xanthiumnolic C. (A) Effect of Xanthiumnolic C on TGF-β1-induced ROS production. (B) The total antioxidant capacity of the compound. (C) The hydroxyl radical scavenging ability of the compound. (D) The DPPH free radical scavenging ability of the compound.
3.3. Cell Viability
The experimental results are presented in Figure A. After 48 h of intervention with varying concentrations of Xanthiumnolic C, the proliferation of CFs was significantly enhanced (p < 0.05). When the concentration of the compound ranged from 0 to 50 μg·mL–1, cell viability increased progressively with higher concentrations, peaking at 50 μg·mL–1. However, when the concentration exceeded 50 μg·mL–1, cell viability began to decline as the concentration of the compound increased. Further CCK-8 assay showed that TGF-β1 induction increased cell proliferation compared to the control group. This effect was abolished by the addition of 50 μg·mL–1 Xanthiumnolic C, which restored proliferation to a level similar to that of the control group (Figure B).
3.
Cell viability following treatment with various concentrations of Xanthiumnolic C. (A) Effect of Xanthiumnolic C on cell viability. (B) Effect of Xanthiumnolic C on the viability of CFs stimulated by TGF-β1.
3.4. Morphological Identification of CFs
Microscopic analysis revealed that Xanthiumnolic C intervention effectively attenuated TGF-β1-induced morphological alterations in CFs. As illustrated in Figure A, control group cells maintained typical polygonal morphology. In contrast, TGF-β1-stimulated cells (Figure B) exhibited significant elongation and spindle-shaped transformation characteristic of myofibroblast transdifferentiation. Both the positive control group (Figure C) and Xanthiumnolic C-treated group (Figure D) demonstrated substantial reversal of this pathological morphology, with cells regaining near-normal features. These findings indicate that compound Xanthiumnolic C has a mitigating effect on the morphology of CFs induced by TGF-β1.
4.

Effect of compound Xanthiumnolic C on the morphology of CFs induced by TGF-β1. (A) The cell morphology of the control group. (B) The cell morphology of the model group. (C) The cell morphology of the positive control group. (D) The cell morphology of the drug group (200× magnification).
3.5. Vim and TGF-Β1/Smad Signaling Pathway-Related Protein Expression
The impact of the compound Xanthiumnolic C intervention on the expression of Vim and the TGF-β1/Smad signaling pathway-related proteins during TGF-β1-induced CFs was investigated using Western blot analysis. The results are presented in Figure . TGF-β1-induced CFs exhibited an increased capacity to upregulate the expression of Vim, TGF-β1, Smad 2/3, P-Smad2, and P-Smad3 protein expression in the model group compared to the control group (p < 0.05). Following treatment with 50 μg·mL–1 Xanthiumnolic C, there was a significant decrease in the protein expressions of Vim, TGF-β1, Smad 2/3, P-Smad2, and P-Smad3 (p < 0.05). These results indicate that the expression of Vim and TGF-β1/Smad signaling pathway proteins was successfully activated after CFs were induced by TGF-β1, and that the intervention with 50 μg·mL–1 Xanthiumnolic C inhibited the activation of these proteins, thereby mitigating the progression of myocardial fibrosis.
5.
Effect of compound Xanthiumnolic C on the expression of Vim and the TGF-β/Smad signaling pathway proteins following TGF-β1-induced CFs (A). The bar chart illustrates the fold change of Vim/β-actin (B), TGF-β1/β-actin (C), Smad2/3/β-actin (D), P-Smad2/β-actin (E), and P-Smad3/β-actin (F) (n = 3). Compared with the model group, *P < 0.05, **P < 0.01; compared with the control group, # P < 0.05, ## P < 0.01.
3.6. Collagen I and Collagen III Protein Expression
The effect of compound Xanthiumnolic C treatment on the expression of Collagen I and Collagen III proteins following TGF-β1 induction was investigated using Western blot analysis. Figure presents the findings. The model group exhibited a significant increase (p < 0.05) in the expression of Collagen I and Collagen III proteins compared to the control group. After the intervention with 50 μg·mL–1 Xanthiumnolic C, there was a significant (p < 0.05) decrease in the expression of Collagen I and Collagen III proteins. Therefore, after CFs were induced by TGF-β1, the expression of Collagen I and Collagen III proteins was activated, and the 50 μg·mL–1 Xanthiumnolic C intervention inhibited this activation, thereby reducing the occurrence of myocardial fibrosis.
6.
Effect of compound Xanthiumnolic C on the expression of Collagen I and Collagen III proteins in CFs induced by TGF-β1 (A). The bar graph illustrates the fold change of Collagen I/β-actin (B) and Collagen III/β-actin (C) (n = 3). Compared with the model group, *P < 0.05, **P < 0.01; compared with the control group, # P < 0.05, ## P < 0.01. Note: Group 1 is the control group; Group 2 is the TGF-β1 model group; Group 3 is the TGF-β1 + captopril positive control group; Group 4 is the TGF-β1 + 50 μg·mL–1compound Xanthiumnolic C administration group. Compared with the model group, *P< 0.05, **P< 0.01; compared with the control group, # P < 0.05, ## P < 0.01.
3.7. The Expression of α-SMA
Using Western Blot analysis, we evaluated the impact of compound Xanthiumnolic C on TGF-β1-induced α-SMA protein expression. The results are presented in Figure A,B. The model group exhibited a significant increase (p < 0.05) in α-SMA protein levels compared to the control group. Following the intervention with 50 μg·mL–1 Xanthiumnolic C, we observed a significant decrease (p < 0.05) in α-SMA protein expression. Immunofluorescence results are shown in Figure C, where a notable increase in green fluorescence of α-SMA was detected in the model group compared to the control group. However, the green fluorescence of α-SMA was significantly weaker in the treatment group compared to the positive control group. These experimental results indicate that 50 μg·mL–1 Xanthiumnolic C effectively inhibits the expression of α-SMA induced by TGF-β1.
7.
Effect of compound Xanthiumnolic C on the expression of (A) α-SMA protein in CFs induced by TGF-β1. (B) The bar graph displays the fold change of α-SMA/β-actin (n = 3). Panel C shows the effect of 50 μg·mL–1 Xanthiumnolic C on the expression of α-SMA protein in CFs induced by TGF-β1(400×). Compared with the model group, *P < 0.05, **P < 0.01; compared with the control group, # P < 0.05, ## P < 0.01.
3.8. The Expression of FN
Western blot analysis was conducted to examine the effect of compound Xanthiumnolic C on FN protein expression following TGF-β1 induction. The results, presented in Figure A,B, indicate a significant increase in FN protein expression (p < 0.05). Notably, after treatment with 50 μg·mL–1 Xanthiumnolic C, there was a significant decrease in FN protein expression (p < 0.05). Figure C displays the immunofluorescence results; compared to the control group, the FN red fluorescence in the model group was significantly enhanced. In contrast, when compared to the positive control group and the drug group, the FN red fluorescence was significantly diminished. These findings suggest that 50 μg·mL–1 Xanthiumnolic C effectively inhibits FN protein expression induced by TGF-β1.
8.
Effect of compound Xanthiumnolic C on the expression of (A) FN protein in CFs induced by TGF-β1. (B) The bar graph illustrates the fold change of FN/β-actin (n = 3). Panel C shows the effect of 50 μg·mL–1 Xanthiumnolic C on the expression of FN protein in CFs induced by TGF-β1 (400×). Compared with the model group, *P < 0.05, **P < 0.01; compared with the control group, # P < 0.05, ## P < 0.01.
3.9. RT-qPCR Determination of Fibrosis-Related Factor mRNA Levels
As shown in Figure , the RT-qPCR results indicated that the mRNA mass concentrations of Acta 2, Vim, FN, Col 1 1a1, MMP-2, and MMP-9 in CFs were significantly increased (p < 0.05) following TGF-β1 induction compared to the control group. However, after the intervention with 50 μg·mL–1 Xanthiumnolic C, the mRNA mass concentrations of Acta 2, Vim, FN, Col 1 1a1, MMP-2, and MMP-9 were all significantly reduced (p < 0.05).
9.
Panels A–F illustrate the effect of compound Xanthiumnolic C on the mRNA expression levels of Acta 2, Vim, FN, Col I 1a1, MMP-2, and MMP-9 in CFs induced by TGF-β1 (n = 3). Compared with the model group, *P < 0.05, **P < 0.01; compared with the control group, # P < 0.05, ## P < 0.01.
4. Discussion
Cardiomyocytes, fibroblasts, endothelial cells, macrophages, and smooth muscle cells are the five major cell types in the heart. When the heart experiences stress or injury, CFs transdifferentiate into myofibroblasts, resulting in fibrosis that adversely affects cardiac structure and function. MF are characterized by the secretion of ECM components. ECM is a complex assembly of proteins that serves as a structural scaffold for multicellular organisms. It plays crucial roles in human development, intercellular communication, cell adhesion, cell proliferation, tissue homeostasis, and tissue repair. , ECM components include collagen I, III, and fibronectin (FN), as well as various contractile proteins, such as α-smooth muscle actin (α-SMA; gene ACTA), vimentin (Vim), focal adhesion proteins, and cell surface receptors, including TGF-β receptors and angiotensin receptors.
TGF-β1 family is expressed in various organs and plays an essential role in myocardial injury, repair, and fibrosis. Research has demonstrated that TGF-β1 can drive CFs to differentiate into myofibroblasts, thereby facilitating ECM remodeling. This study confirmed that, following TGF-β1 stimulation, CFs underwent an elongated morphology, with significant increases in the protein levels of Vim, Col I, and Col III. Additionally, α-SMA protein was highly expressed, as indicated by the green fluorescence. The concentrations of Acta 2, FN, Col I 1a1, and Vim mRNA were markedly elevated and the intensity of these markers was significantly enhanced. FN protein also showed high expression, with a notable increase in red fluorescence intensity. These findings reinforce the role of TGF-β1 in promoting fibrosis and inducing ECM remodeling in the heart.
Growing interest exists in plant-derived compounds for their therapeutic potential in preventing, diagnosing, and treating human diseases. Schisandra sphenanthera, documented since the Shennong Bencaojing for its astringent, qi-invigorating, and cardiotonic properties, shows particular promise against myocardial fibrosis. Pharmacological studies confirm its multiorgan protective effects: Schisandra sphenanthera bee pollen extracts exhibit antioxidant and cardioprotective activity in isoproterenol-induced myocardial infarction models, while seed decoctions inhibit bleomycin-induced pulmonary fibrosis by suppressing M2 macrophage polarization. Notably, the Schisandra lignan schisantherin A attenuates liver fibrosis in vivo and in vitro by mediating TGF-β1/TAK1/MAPK and NF-κB pathway crosstalk. The findings of this research showed that the morphology of CFs was alleviated after treatment with compound Xanthiumnolic C, which was extracted from the stems of Schisandra sphenanthera at a concentration of 50 μg·mL–1 in a TGF-β1-induced cell fibrosis model. Furthermore, TGF-β1 stimulation markedly upregulated collagen deposition, Xanthiumnolic C intervention effectively suppressed this aberrant expression. These findings collectively indicate the compound’s potent antifibrotic activity in CFs.
Epidemiological evidence suggests that diets with antioxidant plants or fruits can significantly reduce the risk of various diseases associated with oxidative stress. Excessive ROS production leads to oxidative stress, which is a significant factor in the development of MF. Studies have demonstrated that Mangiferin exerts a cardioprotective effect in experimental autoimmune myocarditis by reducing oxidative stress and improving histopathological changes and overall myocardial function. According to studies on the antioxidant properties of sophoridine, it has demonstrated significant antiarrhythmic potential in experiments conducted with zebrafish. In this study, the T-AOC, DPPH free radical, and hydroxyl radical scavenging abilities of Xanthiumnolic C were evaluated. This compound demonstrated significant antioxidant potential, and it is speculated that it may also possess cardioprotective properties.
The TGF-β1/Smad signaling pathway is the most extensively studied among the various cell signaling pathways currently being studied in relation to cardiac fibrosis. The primary isoform of TGF-β in cardiac tissue is TGF-β1. This isoform can activate its downstream mediators Smad2 and Smad3, leading to their phosphorylation. Phosphorylated Smad2/3 then translocates to the nucleus, where it initiates pro-fibrotic transcription and stimulates the activation of CFs and the production of extracellular matrix components. , Research has shown that isorhamnetin can inhibit the formation of hypertrophic scars in common fibrotic skin disorders by blocking the TGF-β1/Smad and TGF-β1/CREB3L1 signaling pathways. Additionally, bicyclol has been found to prevents scar formation in both classical and nonclassical fibrosis by inhibiting TGF-β1 signaling. The results of this study indicate that compared to the control group, the expression of proteins associated with the TGF-β1/Smad signaling pathway was significantly increased in the model group. Furthermore, in the TGF-β1/Smad group treated with 50 μg·mL–1 of Xanthiumnolic C, the expression of signaling pathway-related proteins was significantly reduced compared to the model group. This suggests that the Schisandra compound Xanthiumnolic C may alleviate TGF-β1-induced myocardial fibrosis by inhibiting the expression of the TGF-β1/Smad signaling pathway.
Matrix metalloproteinases (MMPs) play a crucial role in the degradation and synthesis of ECM, which is essential for maintaining tissue homeostasis. MMPs are involved in long-term remodeling processes, including embryogenesis, inflammation, tumor invasion, angiogenesis, and wound healing. MMP-2 and MMP-9 are highly expressed in fibrotic cells and can serve as markers of early myocardial fibrosis. Studies have indicated that by focusing on oxidative stress and regulating the activity of matrix metalloproteinases and their tissue inhibitors, Echinops cephalotes reduces the damage caused by cardiac ischemia-reperfusion injury. The RT-qPCR results of this study indicated that the concentrations of MMP-2 and MMP-9 mRNA were significantly increased following TGF-β1 induction. Furthermore, the expression of MMP-2 and MMP-9 was notably inhibited after treatment with the Xanthiumnolic C. These findings suggest that the compound may mitigate the damage caused by myocardial fibrosis by regulating the activity of matrix metalloproteinases and their tissue inhibitors.
In summary, Xanthiumnolic C exhibits significant antioxidant potential, and its mechanism for alleviating myocardial fibrosis may be linked to the inhibition of proteins associated with the TGF-β1/Smad signaling pathway, as well as a reduction in myocardial collagen synthesis. The findings of this study provide an experimental basis and data support for the clinical application of Schisandra sphenanthera in the treatment of cardiovascular diseases, and serve as a reference for the development of Schisandra sphenanthera as a novel therapeutic agent. However, the in vivo application of Xanthumnolic C may be limited by challenges such as rapid clearance and low bioavailability. To address this, future studies could explore delivery systems, such as nanocarriers by antioxidative nanoreactors, to enhance stability and enable targeted therapy. Xanthiumnolic C mitigates TGF-β1-induced myocardial fibrosis may also involve additional molecular mechanisms that require further investigation. Future research should focus on elucidating these pathways, optimizing delivery platforms, and our results need to be confirmed through additional in vivo and in vitro experiments at a later stage.
Acknowledgments
The authors thank the College of Life Sciences, Ningxia University, for providing the necessary facilities and research environment. The authors gratefully acknowledge the financial support from the National Natural Science Foundation of China and the Key Research and Development Program of Ningxia Region.
#.
G.Z. and R.J. contributed equally to this work. All authors contributed to the revision of the study. G.Z. and R.J.: Validation, Investigation, Data curation, WritingOriginal draft. P.N.: Data curation and WritingReviewing. X.S.: Validation, Formal analysis, Writin–Reviewing and Editing. M.B.: WritingReviewing and Editing, Supervision. All authors have read and approved the final version of the manuscript.
This research was funded by the National Natural Science Foundation of China (no. 31860583) and the Key Research and Development Program of Ningxia Region (2025FRG05013).
The authors declare no competing financial interest.
References
- Cardiovascular Diseases (CVDs); 2025, https://www.who.int/en/news-room/fact-sheets/detail/cardiovascular-diseases-(cvds).
- Ren Z., Zhang Z., Ling L., Liu X., Wang X.. Drugs for treating myocardial fibrosis. Front. Pharmacol. 2023;14:1221881. doi: 10.3389/fphar.2023.1221881. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walton K. L., Johnson K. E., Harrison C. A.. Targeting TGF-β mediated SMAD signaling for the prevention of fibrosis. Front. Pharmacol. 2017;8:461. doi: 10.3389/fphar.2017.00461. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Egan B. M., Pohl F., Anderson X., Williams S. C., Gregory A. I., Hunt P., Wang Z., Chiu C.-H., Scharf A., Mosley M.. et al. The ACE inhibitor captopril inhibits ACN-1 to control dauer formation and aging. Development. 2024;151(3):dev202146. doi: 10.1242/dev.202146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yan X. Y., Cai Z. H., Zhao P. Q., Wang J. D., Fu L. N., Gu Q., Fu Y. J.. Application of a novel and green temperature-responsive deep eutectic solvent system to simultaneously extract and separate different polar active phytochemicals from Schisandra sphenanthera (Turcz.) Baill. Food Res. Int. 2023;165:112541. doi: 10.1016/j.foodres.2023.112541. [DOI] [PubMed] [Google Scholar]
- Zhang F., Zhai J., Weng N., Gao J., Yin J., Chen W.. A comprehensive review of the main lignan components of Schisandra sphenanthera (north Wu wei zi) and Schisandra sphenanthera (south Wu wei zi) and the lignan-induced drug-drug interactions based on the inhibition of cytochrome P450 and P-glycoprotein activities. Front. Pharmacol. 2022;13:816036. doi: 10.3389/fphar.2022.816036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Luan F., Zou J., Zhang X., Zeng J., Peng X., Li R., Shi Y., Zeng N.. The extraction, purification, structural features, bioactivities, and applications of Schisandra chinensis polysaccharides: A review. Int. J. Biol. Macromol. 2024;262:130030. doi: 10.1016/j.ijbiomac.2024.130030. [DOI] [PubMed] [Google Scholar]
- Wang R., Liu F., Chen P., Li S., Gu Y., Wang L., Chen C., Yuan Y.. Gomisin D alleviates liver fibrosis through targeting PDGFRβ in hepatic stellate cells. Int. J. Biol. Macromol. 2023;235:123639. doi: 10.1016/j.ijbiomac.2023.123639. [DOI] [PubMed] [Google Scholar]
- Li B., Xiao Q., Zhang J., Wang Y., Liu J., Zhang B., Liu H.. Exploring the active compounds and potential mechanism of the anti-nonalcoholic fatty liver disease activity of the fraction from Schisandra sphenanthera fruit extract based on multi-technology integrated network pharmacology. J. Ethnopharmacol. 2023;301:115769. doi: 10.1016/j.jep.2022.115769. [DOI] [PubMed] [Google Scholar]
- Lin R. D., Mao Y. W., Leu S. J., Huang C. Y., Lee M. H.. The immuno-regulatory effects of Schisandra sphenanthera and its constituents on human monocytic leukemia cells. Molecules. 2011;16(6):4836–4849. doi: 10.3390/molecules16064836. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Qi J., Lv C., Guo J., Li Y., Sima M., Luo R., Xiang H., Xia X., Zhou Y., Wang T.. Schisandra sphenanthera (Turcz.) Baill. polysaccharide inhibits influenza A virus in vitro and in vivo. FEBS Open Bio. 2023;13(10):1831–1843. doi: 10.1002/2211-5463.13690. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li H., Dong A., Li N., Ma Y., Zhang S., Deng Y., Chen S., Zhang M.. Mechanistic study of Schisandra sphenanthera fruit mixture based on network pharmacology, molecular docking and experimental validation to improve the inflammatory response of DKD through AGEs/RAGE signaling pathway. Drug Des., Dev. Ther. 2023:613–632. doi: 10.2147/DDDT.S395512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhang Z., Zhao Y., Cai J., Wang T., Song Y., Lu J., Du H., Wang W., Zhao Y., Guo L.. Optimized extraction, identification and anti-biofilm action of Wu Wei Zi (Fructus Schisandrae Chinensis) extracts against Vibrio parahaemolyticus. Molecules. 2023;28(5):2268. doi: 10.3390/molecules28052268. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jang M., Choi S.-I.. Schisandrin C isolated from Schisandra sphenanthera fruits inhibits lipid accumulation by regulating adipogenesis and lipolysis through AMPK signaling in 3T3-L1 adipocytes. J. Food Biochem. 2022;46(12):e14454. doi: 10.1111/jfbc.14454. [DOI] [PubMed] [Google Scholar]
- Gong J. E., Kim J. E., Lee S. J., Choi Y. J., Jin Y. J., Choi Y. W., Choi S. I., Hwang D. Y.. Anti-Cancer Effects of α-Cubebenoate Derived from Schisandra sphenanthera in CT26 Colon Cancer Cells. Molecules. 2022;27(3):737. doi: 10.3390/molecules27030737. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ma Y., Deng Y., Li N., Dong A., Li H., Chen S., Zhang S., Zhang M.. Network pharmacology analysis combined with experimental validation to explore the therapeutic mechanism of Schisandra sphenanthera Mixture on diabetic nephropathy. J. Ethnopharmacol. 2023;302:115768. doi: 10.1016/j.jep.2022.115768. [DOI] [PubMed] [Google Scholar]
- Jiang H., Feng S., Zhang P., Wang J., Jiang Y., Zhang H., Song X., Huang W., Xie Y., Deng C.. Petroleum ether extract of Schisandra sphenanthera prevents hyperglycemia and insulin resistance in association with modulation of sweet taste receptors and gut microbiota in T2DM rats. J. Ethnopharmacol. 2024;331:118300. doi: 10.1016/j.jep.2024.118300. [DOI] [PubMed] [Google Scholar]
- Wang J., Zheng A., Lin F., Zhang X., Shi K., Yan T., Jia Y.. Schisandra sphenanthera lignans regulate and cooperate with endogenous cannabinoid systems to ameliorate intestinal barrier injury associated with depression. Phytomedicine. 2024;133:155929. doi: 10.1016/j.phymed.2024.155929. [DOI] [PubMed] [Google Scholar]
- Liu J., Wang X., Li J., Yang X., Wei X., Wang Y., Lv Y., Yu J., Jin C., Wang C.. Study on the anti-anxiety effect of jujube kernel-Schisandra sphenanthera compatibility and the intestinal absorption characteristics of index components. J. Chin. Herb. Med. 2022;53(16):5093–5106. [Google Scholar]
- Yu W. J., Chen C. Z., Peng Y. X., Li Z., Gao Y., Liang S., Yuan B., Kim N. H., Jiang H., Zhang J. B.. Schisanhenol improves early porcine embryo development by regulating the phosphorylation level of MAPK. Theriogenology. 2021;175:34–43. doi: 10.1016/j.theriogenology.2021.08.019. [DOI] [PubMed] [Google Scholar]
- Fan W., Fan L., Peng C., Zhang Q., Wang L., Li L., Wang J., Zhang D., Peng W., Wu C.. Traditional uses, botany, phytochemistry, pharmacology, pharmacokinetics and toxicology of Xanthium strumarium L.: A review. Molecules. 2019;24(2):359. doi: 10.3390/molecules24020359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kaźmierczak-Barańska J., Boguszewska K., Adamus-Grabicka A., Karwowski B. T.. Two Faces of Vitamin CAntioxidative and Pro-Oxidative Agent. Nutrients. 2020;12:1501. doi: 10.3390/nu12051501. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baliyan S., Mukherjee R., Priyadarshini A., Vibhuti A., Gupta A., Pandey R. P., Chang C. M.. Determination of antioxidants by DPPH radical scavenging activity and quantitative phytochemical analysis of Ficus religiosa. Molecules. 2022;27(4):1326. doi: 10.3390/molecules27041326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Niu P., Tan X., Zhou X., Xu X., Zhang G., Peng L., Bai M.. Novel polysaccharide identified from Cortinarius purpurascens demonstrated anti-fibrosis effects in cardiac fibroblasts. Food Biosci. 2023;56:103157. doi: 10.1016/j.fbio.2023.103157. [DOI] [Google Scholar]
- Kim T. I., Shin B., Kim G. J., Choi H., Lee C. S., Woo M. H., Oh D. C., Son J. K.. DNA topoisomerase inhibitory activity of constituents from the fruits of Illicium verum. Chem. Pharm. Bull. 2017;65(12):1179–1184. doi: 10.1248/cpb.c17-00466. [DOI] [PubMed] [Google Scholar]
- Ma Q., Guan Y., Sang Z., Wei R.. Anti-inflammatory phenylpropanoid derivatives from the aerial parts of Oenanthe javanica. Chem. Nat. Compd. 2021;57:752–756. doi: 10.1007/s10600-021-03466-z. [DOI] [Google Scholar]
- Wang L. I., Yu P., Zhou B., Song J., Li Z., Zhang M., Guo G., Wang Y., Chen X., Han L., Hu S.. Single-cell reconstruction of the adult human heart during heart failure and recovery reveals the cellular landscape underlying cardiac function. Nat. Cell Biol. 2020;22(1):108–119. doi: 10.1038/s41556-019-0446-7. [DOI] [PubMed] [Google Scholar]
- Travers J. G., Kamal F. A., Robbins J., Yutzey K. E., Blaxall B. C.. Cardiac fibrosis: the fibroblast awakens. Circ. Res. 2016;118(6):1021–1040. doi: 10.1161/CIRCRESAHA.115.306565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Walker C., Mojares E., Del Río Hernández A.. Role of extracellular matrix in development and cancer progression. Int. J. Mol. Sci. 2018;19(10):3028. doi: 10.3390/ijms19103028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Karamanos N. K., Theocharis A. D., Piperigkou Z., Manou D., Passi A., Skandalis S. S., Vynios D. H., Orian-Rousseau V., Ricard-Blum S., Schmelzer C. E.. A guide to the composition and functions of the extracellular matrix. FEBS J. 2021;288(24):6850–6912. doi: 10.1111/febs.15776. [DOI] [PubMed] [Google Scholar]
- Frantz C., Stewart K. M., Weaver V. M.. The extracellular matrix at a glance. J. Cell Sci. 2010;123(24):4195–4200. doi: 10.1242/jcs.023820. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Souders C. A., Bowers S. L. K., Baudino T. A.. Cardiac fibroblast: the renaissance cell. Circ. Res. 2009;105(12):1164–1176. doi: 10.1161/CIRCRESAHA.109.209809. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schuster R., Younesi F., Ezzo M., Hinz B.. The role of myofibroblasts in physiological and pathological tissue repair. Cold Spring Harbor Perspect. Biol. 2023;15(1):a041231. doi: 10.1101/cshperspect.a041231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frangogiannis N. G.. Transforming growth factor-β in myocardial disease. Nat. Rev. Cardiol. 2022;19(7):435–455. doi: 10.1038/s41569-021-00646-w. [DOI] [PubMed] [Google Scholar]
- Bekedam F. T., Smal R., Smit M. C., Aman J., Vonk-Noordegraaf A., Bogaard H. J., Goumans M. J., De Man F., Llucià-Valldeperas A.. Mechanical stimulation of induced pluripotent stem cell derived cardiac fibroblasts. Sci. Rep. 2024;14(1):9795. doi: 10.1038/s41598-024-60102-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chen S., Qin F., Yang Y., Zhao Y., Xiao S., Li W., Akihisa T., Jantrawut P., Ji J., Zhang J.. Extraction, purification, structural characterization, and bioactivities of the genus Schisandra polysaccharides: A review. Int. J. Biol. Macromol. 2024;262:130257. doi: 10.1016/j.ijbiomac.2024.130257. [DOI] [PubMed] [Google Scholar]
- Dai Q., Zhao S., Li W., Liu K., Tao X., Liu C., Yao H., Mu F., Chen S., Li J., Wei P., Gao F., Xi M.. Pharmacodynamics and mechanism of Astragali radix and Anemarrhenae rhizoma in treating chronic heart failure by inhibiting complement activation. Rejuvenation Res. 2024;27(2):61–74. doi: 10.1089/rej.2023.0068. [DOI] [PubMed] [Google Scholar]
- Shen Z., Geng Q., Huang H., Yao H., Du T., Chen L., Wu Z., Miao X., Shi P.. Antioxidative and Cardioprotective Effects of Schisandra chinensis Bee Pollen Extract on Isoprenaline-Induced Myocardial Infarction in Rats. Molecules. 2019;24(6):1090. doi: 10.3390/molecules24061090. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Guo Z., Li S., Zhang N., Kang Q., Zhai H.. Schisandra Inhibit Bleomycin-Induced Idiopathic Pulmonary Fibrosis in Rats via Suppressing M2Macrophage Polarization. BioMed Res. Int. 2020;2020(1):5137349. doi: 10.1155/2020/5137349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H., Che J., Cui K., Zhuang W., Li H., Sun J., Chen J., Wang C.. Schisantherin A ameliorates liver fibrosis through TGF-β1mediated activation of TAK1/MAPK and NF-κB pathways in vitro and in vivo. Phytomedicine. 2021;88:153609. doi: 10.1016/j.phymed.2021.153609. [DOI] [PubMed] [Google Scholar]
- Kumar N., Goel N.. Phenolic acids: Natural versatile molecules with promising therapeutic applications. J. Biotechnol. Rep. 2019;24:e00370. doi: 10.1016/j.btre.2019.e00370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou S., Haoxiang C., Chensi G., Tingting W., Ziluan F.. Evaluation of Schisandra sphenanthera extract on anti-fatigue activity in mice. J. Food Biosci. 2023;56:103129. doi: 10.1016/j.fbio.2023.103129. [DOI] [Google Scholar]
- Popa A., Usatiuc L., Scurtu I. C., Murariu R., Cofaru A., Pop R., Tabaran F. A., Gherman L. M., Valean D., Bolundut A. C.. et al. Assessing the Anti-Inflammatory and Antioxidant Activity of Mangiferin in Murine Model for Myocarditis: Perspectives and Challenges. Int. J. Mol. Sci. 2024;25(18):9970. doi: 10.3390/ijms25189970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun S., Shi F., Zhao G., Zhang H.. Multi-faceted potential of sophoridine compound’s anti-arrhythmic and antioxidant effects through ROS/CaMKII pathway. Heliyon. 2024;10:e37542. doi: 10.1016/j.heliyon.2024.e37542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saadat S., Noureddini M., Mahjoubin-Tehran M., Nazemi S., Shojaie L., Aschner M., Maleki B., Abbasi-Kolli M., Rajabi Moghadam H., Alani B., Mirzaei H.. Pivotal role of TGF-β/Smad signaling in cardiac fibrosis: non-coding RNAs as effectual players. Front. Cardiovasc. Med. 2021;7:588347. doi: 10.3389/fcvm.2020.588347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hanna A., Humeres C., Frangogiannis N. G.. The role of Smad signaling cascades in cardiac fibrosis. Cell. Signalling. 2021;77:109826. doi: 10.1016/j.cellsig.2020.109826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wu J., Song Y., Wang J., Wang T., Yang L., Shi Y., Song B., Yu Z.. Isorhamnetin inhibits hypertrophic scar formation through TGF-β1/Smad and TGF-β1/CREB3L1 signaling pathways. Heliyon. 2024;10:e33802. doi: 10.1016/j.heliyon.2024.e33802. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chan B. Y. H., Roczkowsky A., Cho W. J., Poirier M., Sergi C., Keschrumrus V., Churko J. M., Granzier H., Schulz R.. MMP inhibitors attenuate doxorubicin cardiotoxicity by preventing intracellular and extracellular matrix remodelling. Cardiovasc. Res. 2021;117(1):188–200. doi: 10.1093/cvr/cvaa017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fallah M., Rakhshan K., Nikbakht F., Maleki-Ravasan N., Tahghighi A., Azizi Y.. Cardioprotective effects of the aqueous extract of Echinops cephalotes on myocardial ischemia-reperfusion in rats by modulation of MMP-2, MMP-9, TIMP, and oxidative stress. Biomed. Pharmacother. 2024;176:116927. doi: 10.1016/j.biopha.2024.116927. [DOI] [PubMed] [Google Scholar]
- Wen P., Dirisala A., Guo H., Liu X., Kobayashi S., Kinoh H., Anada T., Tanaka M., Kataoka K., Li J.. Engineering durable antioxidative nanoreactors as synthetic organelles for autoregulatory cellular protection against oxidative stress. J. Controlled Release. 2025;382:113683. doi: 10.1016/j.jconrel.2025.113683. [DOI] [PubMed] [Google Scholar]







