Skip to main content
Virology Journal logoLink to Virology Journal
. 2026 Jan 27;23:43. doi: 10.1186/s12985-026-03073-w

Molecular characterization of mumps viruses from the 2022–2023 outbreak reveals circulation of multiple genotypes in Uganda

Phionah Tushabe 1,✉,#, Irene Turyahabwe 1,#, Henry Bukenya 1, James Peter Eliku 1, Francis Aine 1, Joseph Gaizi 1, Mary Nyachwo 1, Molly Birungi 1, Mayi Tibanagwa 1, Rena Patricia Nakyeyune 1, Prossy Namuwulya 1, Mary Bridget Nanteza 1, Josephine Bwogi 1
PMCID: PMC12918529  PMID: 41593743

Abstract

Mumps is a highly contagious viral disease caused by the mumps virus (MuV), a member of the genus Orthorubulavirus in the family Paramyxoviridae. Although effective vaccines exist, mumps vaccination is not yet part of Uganda’s routine immunization program. In 2022 and 2023, Uganda experienced a notable outbreak of mumps, underscoring the need for molecular characterization of the circulating virus strains. This study aimed to identify and genetically characterize the mumps virus strains responsible for the outbreak. Buccal or oropharyngeal swabs were collected from clinically confirmed cases from five districts. The mumps virus was isolated using the WHO Vero cell line. RNA was extracted from the isolates and clinical samples using the Qiagen kit. Real-time PCR testing was conducted and positive samples subjected to Sanger sequencing of the SH gene, a key target for genotypic classification. Phylogenetic analysis was performed using MEGA v12 software, with genotypes assigned based on phylogenetic clustering of study sequences with the 24 WHO mumps reference sequences. The study obtained ten virus isolates and fourteen sequences belonging to three genotypes: D, H and G. This genotypic variation, observed within a relatively small sample size, underscores the potential complexity of mumps virus transmission and evolution within the country. This study presents the first genetic characterization of mumps viruses from Uganda and the findings provide critical genomic baseline data for future mumps virus surveillance in Uganda, contributing to the understanding of mumps virus evolution, transmission dynamics, and potential vaccine introduction strategies.

Keywords: Mumps virus, Molecular epidemiology, Genotyping, Uganda

Introduction

Mumps is a highly contagious viral infection characterized by swelling of the parotid (parotitis) or other salivary gland(s), although up to 30% of infections may be asymptomatic [1, 2]. Parotitis may be unilateral or bilateral and usually lasts about 3 to 7 days with most cases resolving within 10 days. Although generally mild, it poses a significant public health threat due to its potential to cause outbreaks and serious complications including orchitis (inflammation of the testicles), oophoritis (inflammation of the ovaries), mastitis (inflammation of breast tissue), pancreatitis, hearing loss, meningitis, and encephalitis [3]. In Africa, mumps is significantly under-reported, with only a few published cases from Democratic Republic of Congo (DRC) [4], Zambia [5], Tanzania [6], and South Africa [7]. Despite the scarcity of published reports, the World Health Organization (WHO) through the WHO/UNICEF Joint Reporting Form on Immunization (JRF) collects and reports cases and incidences of mumps annually with the African region reporting an incidence of 766 per 1,000,000 total population in 2023 [8]. Unfortunately, no data has been reported from Uganda despite having nationwide outbreaks.

Mumps is caused by the mumps virus (MuV), a member of the genus Orthorubulavirus in the family Paramyxoviridae. Its genome is comprised of a single stranded RNA of 15,384 nucleotides, which encodes two surface glycoproteins; fusion (F) and haemagglutinin - neuraminidase (HN), four core proteins; nucleoprotein (NP), virion/phospho (V/P), matrix (M) and large protein (L), and the putatively membrane associated small hydrophobic (SH) protein [9]. MuV is serologically monotypic although distinct genetic lineages have been described. Genotype assignment for MuV is based on sequence analysis of the entire 316 nucleotides of the highly variable SH gene and 12 genotypes, designated A to N (excluding E and M) are recognized [8, 9].

Despite the availability of an effective vaccine, mumps outbreaks continue to occur globally, affecting both vaccinated and unvaccinated individuals. Complications may occur in the absence of parotitis, and the frequency of complications is lower in vaccinated patients. In Uganda, the mumps vaccine is not part of the routine national immunization schedule despite outbreaks occurring. In addition, there is no information regarding the genotypes and epidemiology of mumps virus strains circulating in the country. This lack of genomic surveillance limits understanding of local transmission dynamics and delays evidence-based decision making for outbreak control and vaccine introduction [2]. This report sought to characterize mumps virus strains following a nationwide outbreak.

Materials and methods

Case identification

Samples were taken from patients who met the standardized case definition criteria [10], which included unilateral or bilateral swelling of the parotid or other salivary glands without apparent cause, lasting for at least 2 days. Demographic and clinical data were collected including age, gender, symptoms, the date of onset of symptoms, and the specimen collection date.

Sample collection and processing

Initially, blood and oropharyngeal samples were collected by the district surveillance focal persons and transported at room temperature via the national samples transportation system to the Uganda Virus Research Institute and stored at + 2–8 °C before testing. Following standardisation of the sample collection methods, trained laboratory staff conducted subsequent sample collections. Buccal swabs were collected as described by the Centres for Disease Control and Prevention [11] and placed into sterile tubes containing growth media (Minimum Essential Medium [MEM] containing 10% foetal bovine serum, 1% 1 M HEPES buffer, 1% 200 mM L-Glutamine, 1.5% sodium bicarbonate (7.5% w/v), antibiotics (100U/mL Penicillin and 100 µg/mL Streptomycin) and fungizone (2.5 µg/mL Amphotericin B)). The tubes were then sealed, mixed briefly, and immediately transported to the laboratory in a specimen carrier with frozen ice packs. At the laboratory, the buccal swabs were processed by vortexing for 60 s within a class II biological safety cabinet and all the material thoroughly extracted from the sponge. The resultant extract for each specimen was aliquoted into two labelled nunc tubes and stored at −80 °C until testing.

RNA extraction and real-time PCR

RNA was extracted from both clinical samples and isolates using the Qiagen Viral RNA Mini Kit following the manufacturer’s guidelines [12]. The detection of the mumps virus N gene was performed using the QuantiTect kit [13] and primers described previously [14]. Briefly, 2 µL of RNA template was added to 18 µL of master mix containing 10 µl of 2X Qiagen RT-PCR mix, 2 µl of primer/probe mix, 0.2 µL of RNAse inhibitor, (at final concentrations of 1X, 0.03 µM, and 0.2 U/µL respectively) and 0.2 µL of QuantiTect RT mix. The quantitative real-time PCR amplification was carried out with an initial reverse transcription step at 50 °C for 20 min, followed by an inactivation step at 95 °C for 15 min and 40 PCR cycles of 95 °C for 5 s and 60 °C for 1 min. All positive samples, with Ct values below 40 were then sequenced.

Virus isolation

Virus isolation was carried out for only the twenty-three buccal swabs. T25 flasks containing healthy WHO Vero cells (WHO) (ECACC 88020401) [15]with 75–80% confluency were used for virus isolation. Briefly, the growth media in the flasks was decanted off, and the cells washed twice with 5 mls of 1X phosphate buffer saline (PBS) to remove dead cells and the cell culture medium. One ml of the buccal swab extract was inoculated onto the flasks and for quality control, 1 ml of FBS was inoculated onto the negative control flask. The inoculated flasks were then placed in an incubator at 37 °C for 1 h and thereafter, observed under a Primovert inverted microscope for signs of toxicity before addition of 4 mls of maintenance media (Minimum Essential Medium [MEM] containing 2% foetal bovine serum, 1% 1 M HEPES buffer, 1% 200mM L-Glutamine, 1.5% sodium bicarbonate (7.5% w/v), antibiotics (100U/mL Penicillin and 100 µg/mL Streptomycin) and fungizone (2.5 µg/mL Amphotericin B). The cultures were incubated at 37 °C and observed daily for cytopathic effect (CPE) for up to 14 days with a blind passage performed after 7 days. Flasks showing characteristic CPE (plaque formation or multinucleated giant cells) were harvested when ≥75% CPE was observed. The harvested flasks were stored at −80 °C until further testing. Only two of the ten isolates were carried on for sanger sequencing; one as a positive control to confirm CPE and the second for a sample whose sequencing had been unsuccessful using the clinical sample.

Sanger sequencing of the SH gene

For genotype determination, the SH gene was amplified using primers SH1 (5’ AGTAGTGTCGATGATCTCAT 3’) and SH2R (5’ GCTCAAGCCTTGATCATTGA 3’) at 20 µM as described previously [16]. Briefly, 5 µL of RNA was added to 45 µL of master mix containing 25 µL of 2X SuperScript reaction mix, 0.5 µL per primer, 0.5 µL of RNAse inhibitor (at final concentrations of 1X, 0.2 µM each, and 0.2 U/µL respectively) and 2 µL of SuperScript enzyme mix. Amplification was carried out at 55 °C for 30 min, 94 °C for 2 min, followed by 40 PCR cycles of 94 °C for 15 s, 55 °C for 30 s, and 68 °C for 30 s. This was followed by holding steps of 68 °C for 5 min and 4 °C until visualization on a 2% agarose gel.

All samples that had visible and correct sized bands following gel electrophoresis had their PCR products cleaned up using the ChargeSwitch PCR cleanup kit according to the manufacturer’s instructions [17]. Sequencing was conducted with the ABI v3.1 BigDye sequencing kit following the manufacturer’s instructions [18]. The sequencing reaction products were purified using Agencourt magnetic beads [19] and loaded onto an ABI 3500xL genetic analyser [18].

Phylogenetic analysis

The SH sequences obtained were analysed using Sequencher version 5.4.6 [20] and genotypes assigned based on phylogenetic clustering of study sequences with the 24 WHO mumps reference sequences [21]. Select SH sequences belonging to genotypes D, H and G as of May 16, 2024, were downloaded from GenBank, and together with the study and mumps reference sequences were aligned using the ClustalW method in MEGA v12 [22]. A maximum-likelihood phylogenetic tree was generated using the Tamura-Nei substitution model, bootstrap support values were calculated from 1,000 replicates, and the tree was subsequently visualized and annotated in MEGA v12 [22].

Results

Forty-five samples: twenty-three buccal and twenty-two oropharyngeal swab samples were collected from five districts (Kabale, Oyam, Obongi, Wakiso and Masindi) in Uganda. One patient experienced onset of disease in Rubanda district however the sample was collected from Kabale district. The twenty-two oropharyngeal swabs were collected by district surveillance focal persons from Obongi, Wakiso and Masindi districts prior to standardization of the sample collection procedures. The remaining twenty-three buccal swabs from Oyam and Kabale districts were collected by the EPI laboratory staff following the standardized and recommended protocol.

Patient demographics

Of the forty-five patients, only twenty-three patients (51.1%) investigated by the laboratory staff had complete clinical data. Of these, 18 (78.3%) were female. These patients were aged 60 to 192 months (mean 126.2 months, SD 30.1 months). The onset of symptoms among these patients occurred in either July or November 2023.

PCR results

Of the forty-five samples tested, twenty-five (25/45; 55.5%) samples were positive on real-time RT-PCR. Of these, fifteen (15/25; 60%) were buccal swabs and ten (10/25; 40%) were oropharyngeal swabs. These were subjected to genotyping of the SH gene. Thirteen samples (buccal swabs) had strong bands, four samples (one buccal and three oropharyngeal swabs) had weak bands, and seven samples (oropharyngeal swabs) were negative on gel electrophoresis. The buccal swab with the weak band was successfully cultured, and its isolate used for Sanger sequencing. In total, seventeen samples (17/25; 68%) were positive and subsequently subjected to sequencing. Fourteen sequences were obtained, all buccal swab samples. To note, an isolate from one of the successfully sequenced buccal swabs was used as a positive control and its sequence submitted instead of that from the clinical sample. The clinical and demographic information for these fourteen patients is shown in Table 1.

Table 1.

Characteristics of the patients with successful mumps virus characterization

Sequence ID Sex Age (months) District of onset Date of onset of parotitis Accession number
MuVs/Kabale.UGA/30.23/3 Female 84 Kabale 27-07-2023 PX126613
MuVs/Kabale.UGA/30.23/2 Female 156 Kabale 27-07-2023 PX126612
MuVi/Kabale.UGA/29.23 Male 120 Kabale 20-07-2023 PX126609
MuVs/Kabale.UGA/30.23/1 Female 132 Kabale 26-07-2023 PX126611
MuVi/Kabale.UGA/30.23 Male 84 Kabale 25-07-2023 PX126610
MuVs/Rubanda.UGA/30.23 Female 60 Rubanda 26-07-2023 PX126622
MuVs/Oyam.UGA/47.23/6 Female 132 Oyam Missing PX126620
MuVs/Oyam.UGA/47.23/5 Male 120 Oyam 23-11-2023 PX126619
MuVs/Oyam.UGA/47.23/2 Female 108 Oyam 21-11-2023 PX126616
MuVs/Oyam.UGA/47.23/4 Male 156 Oyam 22-11-2023 PX126618
MuVs/Oyam.UGA/47.23 Female Missing Oyam 20-11-2023 PX126614
MuVs/Oyam.UGA/47.23/7 Female 192 Oyam Missing PX126621
MuVs/Oyam.UGA/47.23/3 Female 133 Oyam 21-11-2023 PX126617
MuVs/Oyam.UGA/47.23/1 Female Missing Oyam 20/11/2023 PX126615

Virus isolation results

A total of ten (10/23; 43.5%) viruses were successfully isolated. These showed the characteristic mumps virus CPE within 4–14 days of sample inoculation (Fig. 1).

Fig. 1.

Fig. 1

Cytopathic effect observed in WHO Vero cells following inoculation with extract from suspected mumps patient, showing the formation of distinct viral plaques characteristic of mumps virus infection

Phylogenetic analyses

Fourteen (14) sequences with 316 nucleotides each were obtained, and phylogenetic analysis yielded 3 genotypes, D, G and H. Eleven sequences belonged to genotype D, 2 sequences belonged to genotype G and 1 sequence belonged to genotype H. Genotypes G and H clustered with viruses circulating in Europe while genotype D viruses formed an independent monophyletic cluster with sequences from North America despite presence of sequences from Africa (Fig. 2).

Fig. 2.

Fig. 2

A maximum likelihood tree showing mumps genotypes obtained from Uganda (with black diamonds), mumps reference sequences and selected sequences of similar genotypes obtained. The tree was inferred in MEGA v12 using the Tamura–Nei substitution model, with bootstrap support values calculated from 1,000 replicates and rooted using MuVi/Pennsylvania.USA/13.63/A VAC. Bootstrap values greater than 70% are shown at the nodes

Geographical distribution of mumps viruses in Uganda

Oyam district in Northern Uganda had genotypes D, G and H while Kabale district found in Southern Uganda had genotypes D and G (Fig. 3).

Fig. 3.

Fig. 3

Map of Uganda showing distribution of the mumps virus genotypes obtained

Discussion

This study presents the first genetic characterization of mumps viruses from Uganda revealing the notable genetic diversity of circulating strains. The inability to successfully obtain genotypes from oropharyngeal swab samples collected in Obongi, Wakiso and Masindi districts could be due to several reasons including poor sample collection procedures, specimen quality, timing of collection of specimens, storage and handling of specimens. Despite Sanger sequencing being attempted for the oropharyngeal samples with weak bands on electrophoresis, it was unsuccessful, possibly due to RNA degradation considering that their Ct values were 31 and 34. Optimization was done for the sample with Ct value 31, however, the quality of the resulting chromatograms was unacceptable. For successful mumps virus detection with RT-PCR testing, it is recommended to collect buccal swab specimens within 3 days of parotitis onset and after massaging the parotid gland for approximately 30 s [23].

Phylogenetic analysis of the study sequences identified three distinct mumps virus genotypes D, G and H that clustered with sequences from Europe (genotypes G and H) and North America (genotype D). Interpretation of these clustering patterns should however be made cautiously as the scarcity of representative sequences from the African region limits the extent to which transmission patterns can be confidently inferred. That said, this diversity, observed within a limited sample size, shows the potential complexity of mumps virus transmission and evolution within the country. Co-circulation of different genotypes has similarly been reported in India [24], China [25], Spain [26] and USA [27], highlighting that the existence of various strains within outbreaks is not uncommon and indicates either numerous introductions or concurrent transmission chains.

Majority of the sequences in this study belonged to Genotype D. This genotype has previously been reported in an outbreak in Zambia [5] suggesting potential regional circulation in parts of Sub-Saharan Africa. The Uganda genotype D sequences shared a high similarity forming a closely related sub-cluster. This indicates limited genetic variation within this genotype and points to a recent, localized transmission. In contrast, Genotypes G and H were each represented by two and one sequence respectively. The predominance of genotype D shown in this study contrasts findings from elsewhere that report genotype G prevalent [2, 26, 28]. This, however, can be attributed to the fact these reports are from a select number of countries. In Canada, genotype G was predominantly detected in 96% of specimens with other genotypes more likely to be detected in cases that had reported travel or were linked to imported cases [29]. In Pakistan, all eleven samples sequenced belonged to genotype G albeit with unique lineage specific variations [30]. And, although China has reported genotype F predominance, they have also reported local mumps outbreaks caused by genotype G strains [31]. In Africa, Gabon reported a single genotype G sequence in a vaccinated child [32]. The limited detection of genotype G in the Ugandan outbreak suggests that, although globally predominant, it played a minor role in local transmission. However, it is possible that genotype G was circulating more widely than observed but was under-represented due to the small number of samples tested.

Mumps virus molecular data in Africa remains limited with only a handful of reports [5, 32]. The Uganda sequences thus contribute to the global mumps virus databases, enhancing our understanding of the virus evolution and geographic distribution. This will allow for better tracking of virus strains across regions and over time and ultimately contributing to more effective global public health strategies. This study, however, had one major limitation that is the sequences analysed were from a small number of samples from two districts in the country. Thus, the study likely underestimates the full diversity of genotypes circulating within the broader population. A larger, more geographically expansive sample set could reveal additional genotypes or sub-lineages within the identified genotypes that remain undetected in this analysis, providing a more comprehensive picture of mumps virus circulation within the country.

Conclusion

This study presents the first molecular characterization of mumps viruses in Uganda, identifying three distinct genotypes (D, G, and H) within the sampled population. Although the study was based on a relatively small sample size and limited geographic scope, these findings provide a crucial genomic baseline for future mumps virus surveillance in the country. The observed genotypic diversity suggests the circulation of multiple transmission chains, emphasizing the need for country-wide genomic surveillance to capture the full extent of mumps virus circulation and evolution. The study highlights the importance of integrating virus sequencing into Uganda’s public health infrastructure, not only for mumps but for other vaccine-preventable diseases, to enhance outbreak monitoring, response, and control strategies.

Acknowledgements

We acknowledge UKSHA and CDC Atlanta for the technical support. CDC Atlanta is additionally acknowledged for providing the authors with mumps specific primers. We thank Bettina Bankamp and Raydel Anderson for technical guidance during this study.We thank the Uganda National Expanded Program on Immunization (UNEPI) Surveillance team at the Ministry of Health (MoH) and the WHO, Uganda Country office for the support they provided towards the study. Additionally, we thank the health teams from the five districts (Kabale, Oyam, Obongi, Wakiso and Masindi) as well as the patients and their parents or guardians for participating in this study.

Author contributions

P.T., I.T., J.E.P., P.N., M.B.N., and J.B. conceptualised the idea, M.B.N designed the data collection tool, I.T., J.G., N.M., and H.B. did the investigations, P.T., I.T., H.B. and F.A. did the laboratory analyses, P.T., I.T. and J.B. analysed the data, M.B., M.T. and R.P.N. managed the data, P.T., I.T., H.B. and R.P.N prepared Figs. 1, 2 and 3, P.T., I.T., H.B. and J.B. drafted the manuscript. All authors reviewed the manuscript.

Funding

Research was supported using funds from Government of Uganda to Uganda Virus Research Institute.

Data availability

All mumps virus sequences generated during this study are available in GenBank under the accession numbers PX126609-PX126622.

Declarations

Ethics approval and consent to participate

Ethical approval was not required for this study because the samples were collected as part of routine public health surveillance activities. No additional sampling was undertaken for research purposes, and all samples were anonymised prior to analysis.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Phionah Tushabe and Irene Turyahabwe contributed equally to this work.

References

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All mumps virus sequences generated during this study are available in GenBank under the accession numbers PX126609-PX126622.


Articles from Virology Journal are provided here courtesy of BMC

RESOURCES