Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO

Garrett L Lindsey; Thomas K Hockley; Alejandro Villa Gomez; Andrew C Marshall; William R Brothers; Colin T Finney; Jacob Gross; Archa H Fox; Gene W Yeo; Bruno Melillo; Charles S Bond; Benjamin F Cravatt

doi:10.1016/j.chembiol.2025.12.010

. Author manuscript; available in PMC: 2026 Feb 20.

Published in final edited form as: Cell Chem Biol. 2026 Jan 13;33(2):256–267.e11. doi: 10.1016/j.chembiol.2025.12.010

Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO

Garrett L Lindsey ¹, Thomas K Hockley ^2,⁶, Alejandro Villa Gomez ^2,⁶, Andrew C Marshall ², William R Brothers ³, Colin T Finney ¹, Jacob Gross ⁴, Archa H Fox ⁵, Gene W Yeo ³, Bruno Melillo ¹, Charles S Bond ^2,^*, Benjamin F Cravatt ^1,^7,^*

PMCID: PMC12918760 NIHMSID: NIHMS2132231 PMID: 41534524

SUMMARY

RNA-binding proteins (RBPs) play important roles in mRNA transcription, processing, and translation. Chemical tools are lacking for RBPs, which has hindered efforts to perturb and understand RBP function in cells. We previously described a chloroacetamide compound (R)-SKBG-1 that covalently binds the RBP NONO and stabilizes its interactions with mRNAs, leading to transcriptional remodeling and suppression of cancer cell growth. Here, we report the crystal structure of an (R)-SKBG-1:NONO complex, which confirms covalent modification of cysteine-145 at a pocket proximal to the RNA-binding interface of the protein. We show that this pocket can also be targeted by a lower reactivity chlorofluoroacetamide analog (R, R)-GL-373, which retains the pharmacological properties of (R)-SKBG-1, including blockade of estrogen receptor expression in breast cancer cells, while displaying much greater proteome-wide selectivity. Our findings thus show that NONO can be targeted by covalent ligands with high specificity to pharmacologically suppress pro-tumorigenic gene products in cancer cells.

Graphical abstract

graphic file with name nihms-2132231-f0001.jpg

In brief

Lindsey et al. integrate structural studies with activity-based protein profiling to characterize a druggable pocket proximal to the RNA-binding interface of NONO that can be covalently targeted by low-reactivity chlorofluoroacetamide ligands to remodel the transcriptomes and suppress the growth of cancer cells.

INTRODUCTION

The human genome encodes a broad array of RNA-binding proteins (RBPs) that regulate the processing, maturation, and function of diverse RNA components of the cell. Major roles for RBPs include the splicing,¹ post-transcriptional modification,² and translational control of messenger RNAs (mRNAs),³ the folding and assembly of ribosomal RNA (rRNA)-protein complexes,⁴ and the processing of small nuclear RNAs (snRNAs).⁵

Genetic mutations in RBPs cause many human diseases, underscoring the importance of this protein class for supporting cellular and organismal physiology.^6,7 RBPs also have the potential to serve as drug targets for restoring human health through, for instance, the post-transcriptional regulation of pathogenic or beneficial gene products. In a compelling proof of principle, the small-molecule drug risdiplam stabilizes binding of the U1 small nuclear ribonucleoprotein (snRNP) complex to weak 5′ splice sites to promote exon inclusion and expression of the SMN2 gene to treat spinal muscular atrophy (SMA) caused by deleterious mutations in the related SMN1 gene.⁸ Nonetheless, realizing the broader therapeutic potential of RBPs depends on the identification of chemical probes for additional members of this large protein class, a goal that has been hindered by the limited availability of functional assays for RBPs^9,10 and their perceived poor general druggability.^11,12

We recently discovered by integrated phenotypic screening and activity-based protein profiling (ABPP) a series of electrophilic α-chloroacetamide (CA) compounds that covalently bind the RBP NONO to transcriptionally remodel and impair the growth of human cancer cells.¹³ NONO is a member of the Drosophila behavior/human splicing (DBHS) family of RBPs that includes the paralogs PSPC1 and SFPQ.^14,15 These abundant nuclear proteins form hetero- and homo-dimers to regulate various stages of mRNA processing, transport, maturation, and stability.^14,15 The lead compound (R)-SKBG-1 was found to engage a paralog-restricted cysteine (C145) located in a hinge region between the RRM1 and RRM2 RNA-binding domains of NONO,^16–18 and mechanistic studies supported a model where (R)-SKBG-1 stabilizes NONO binding to mRNAs, including transcripts encoding the androgen receptor and its major splice variants, leading to decreases in their expression in cancer cells.¹³ Consistent with a gain-of-toxic function mechanism that cannot be overcome by the compensatory action of PSPC1 and SFPQ, the pharmacological effects of (R)-SKBG-1 were abrogated in cancer cells genetically disrupted for NONO.¹³

RRM domains are a common RNA-binding structure found in eukaryote proteomes that typically consists of a four-stranded β-sheet from which a series of conserved aromatic residues protrude.¹⁹ The RRM1 domain of DBHS proteins contains this canonical RNA-binding platform, while the RRM2 domain lacks several of the canonical aromatic residues.¹⁶ The arrangement of the RRM1 and RRM2 domains within the quaternary structure of DBHS proteins suggests an atypical mode of RNA binding, involving canonical interactions mediated by RRM1 combined with additional contributions from loops within RRM2. Although the RNA-binding site of NONO has not yet been determined by high-resolution structural biology, small-angle X-ray experiments have shown that the canonical RRM1 domain and part of the unusual RRM2 domain from the partner protomer of the dimer are both involved in interacting with RNA, and that RRM1 swings closer to RRM2 when nucleic acid is bound.¹⁸ Further insights can be gained from the structure of the NONO paralog SFPQ bound to RNA.²⁰ The core region of both proteins share about 70% sequence identity, and the residues involved in contacting RNA are exceptionally well conserved. These conserved residues (allowing for Arg <-> Lys substitution and using NONO numbering) are as follows: from the RRM1 domain—four Phe residues (F77, F104, F111, and F113) and four basic/polar residues (N80, K137, R140, and R142); and from the NOPS domain of the same protomer—one basic residue (K243) – and from the RRM2 domain of the second protomer—two basic residues (R184 and R186)—which together form a “lid”. In SFPQ, an additional contact to a base is made by a non-conserved threonine residue, which is aligned with C145 in NONO (the cysteine that is covalently modified by (R)-SKBG-1).

While (R)-SKBG-1 has provided a valuable initial tool compound for studying NONO function in cells, our understanding of the structural basis for (R)-SKGB-1-NONO interactions remains limited. Additionally, (R)-SKBG-1 covalently modified many other proteins in cancer cells and showed only a narrow window of stereoselective antiproliferative effects compared to the inactive enantiomeric control compound (S)-SKBG-1. These deficiencies likely relate, at least in part, to the high intrinsic reactivity of the CA-reactive group of (R)-SKBG-1. Here, we report the X-ray crystal structure of a (R)-SKBG-1:NONO complex, which revealed a pocket supporting stereoselective reactivity at C145 that is proximal to the predicted RNA-binding interface of NONO. We concurrently discover that NONO can be targeted by an analog of (R)-SKBG-1 bearing a lower reactivity chlorofluoroacetamide (CFA) group. This CFA analog (R, R)-GL-373 displays stereoselective and NONO-dependent transcriptional remodeling and anti-proliferative activity, while exhibiting much greater proteome-wide selectivity compared to (R)-SKBG-1. Among the transcripts suppressed by (R, R)-GL-373 in breast cancer cells was the estrogen receptor (ESR1) mRNA, and we verified near complete loss of ESR1 protein by 24 h post treatment with (R, R)-GL-373. Our findings, taken together, support the presence of a druggable and functional pocket in NONO that can be targeted by low-reactivity electrophilic compounds to control pro-tumorigenic transcriptional pathways in cancer cells.

RESULTS

(R)-SKBG-1-NONO co-crystal structure

We expressed and purified the structured regions of the human NONO homodimer (residues 53–312), NONO/SFPQ heterodimer, and SFPQ homodimer from E. coli as previously reported.^21–23 We then treated purified NONO homodimeric protein (125 μM) with (R)-SKBG-1 (4-fold molar excess, 15 min) prior to crystallization. The X-ray crystal structure of the (R)-SKBG-1:NONO complex was solved at 2.5 Å resolution and has two NONO homodimers in the asymmetric unit (Figure 1A; Table S1). Clear electron density was observed for the (R)-SKBG-1 compound with a covalent adduct to C145 (in mF_o-DF_c, 3.0 σ omit maps) in each of the four protomers. The sites in chain A and chain B allowed building of the complete (R)-SKBG-1 adduct, with chain A having the best-defined electron density, albeit with evidence of dynamic disorder around the sulfonamide-linked methoxyphenyl group (Figure S1A). The structure provided a rationale for the stereoselective reactivity of (R)-SKBG-1 with C145, as there is a hydrogen bond between the backbone nitrogen of this residue and the carbonyl group adjacent to the (R)-SKBG-1 stereocenter (2.9 Å; Figure 1B). This hydrogen bond interaction would not be possible with the (S)-SKBG-1 enantiomer. Additional contacts that may contribute to orienting (R)-SKBG-1 for reaction include a hydrogen bond of the acetamide with Q229 (3.4 Å) and stacking of the phenoxy substituent with the guanidinium moiety of R75 (Figure 1B). The previously reported apo-NONO homodimer structure (PDB 5IFM)¹⁸ showed structural variability across its six homodimers (RMSD 0.6 Å), which is elevated in the (R)-SKBG-1:NONO complex (RMSD 0.8–1.1 Å) due to subtle displacements of helices and loops in the coiled-coil and NOPS domains. These differences are, however, within the range observed for different crystal packing environments of the respective structures (Figure S1B).

Figure 1. — (A) Left, structure of (R)-SKBG-1. Right, 2.5 Å co-crystal structure of (R)-SKBG-1-bound NONO homodimer (PDB: 9NZI), where purple and gray mark the individual NONO subunits and (R)-SKBG-1 is shown in colored CPK spheres. The RNA-binding domains RRM1 and RRM2 are marked, as are the conserved NOPS and COIL domains.

(B) Ligand-binding pocket of NONO highlighting interactions between (R)-SKBG-1 and amino acid residues of NONO. The stereocenter in (R)-SKBG-1 is marked with a red asterisk (*), as are hydrogen bonds (cyan) from the adjacent carbonyl group to the backbone nitrogen of C145 (2.9 Å) and from the acetamide carbonyl to Q229 (3.4 Å). Interactions between phenyl groups in (R)-SKBG-1 and selected sidechains, including conserved phenylalanine residues implicated in RNA interactions (e.g., F77 [4.5 Å], F113 [5.3 Å]) and R75 (3.7 Å), are shown in black.

(C) Microscale thermophoresis data for two FAM-labeled RNA oligonucleotides interacting with a NONO homodimer, NONO-SFPQ heterodimer, or SFPQ homodimer in the presence of increasing concentrations of (R)-SKBG-1 or (S)-SKBG-1. Only the NONO proteins, but not the SFPQ homodimer exhibit a shift to higher RNA-binding affinity in the presence of (R)-SKBG1 (blue circles). (S)-SKBG-1 (red circles) did not alter the RNA-binding affinity of the tested proteins in comparison to untreated protein (gray circles). Data are average values ±SD for three independent experiments.

(D) Superposition of the (R)-SKBG-1-NONO homodimer co-crystal structure (NONO: purple, ligand: black) and a co-crystal structure of SFPQ homodimer bound to RNA (PDB: 7UJ1; SFPQ: gray cartoon and surface, RNA: orange). The inset highlights where (R)-SKBG-1 and RNA independently stack with a conserved phenylalanine residue in NONO (F77) and SFPQ (F300), respectively. T368 is the residue in SFPQ that corresponds to C145 in NONO.

We previously found using enhanced UV crosslinking and immunoprecipitation followed by sequencing (eCLIP-seq)²⁴ that (R)-SKBG-1 stabilizes NONO binding to mRNAs in cells. Here, we evaluated the impact of (R)-SKBG-1 on purified NONO interactions with two GU-rich RNA oligonucleotides by microscale thermophoresis (MST). These experiments revealed that (R)-SKBG-1, but not the inactive enantiomer (S)-SKBG-1, increased the affinity of the NONO homodimer or NONO:SFPQ heterodimer for single-stranded RNA (Figures 1C, S1C, and S1D). In contrast, (R)-SKBG-1 did not alter the RNA affinity of an SFPQ homodimer (Figure 1C), as expected.

Alignment of the (R)-SKBG-1:NONO complex structure with an RNA-bound structure of the SFPQ homodimer (PDB: 7UJ1)²⁰ revealed that (R)-SKBG-1 occupies a site overlapping with RNA in the SFPQ structure (Figure 1D), with the aromatic groups of (R)-SKBG-1 proximal to the sidechains of conserved phenylalanine residues (F77 and F113) in the RRM1 domain of NONO that are implicated in RNA-binding^20,25 (Figure 1B). Considering that our biochemical and cell biological studies indicate (R)-SKBG-1 stabilizes rather than disrupts NONO-RNA interactions, we speculate that during RNA-binding, the aromatic groups of (R)-SKBG-1 adopt a different conformation to that observed in the crystal structure. This would serve to simultaneously free up RRM1 for “canonical” RNA-binding, and position (R)-SKBG-1 for additional productive interactions with RNA to result in the increased binding affinity that we observed by MST. The conformational flexibility of the (R)-SKBG-1 adduct is evidenced by the relatively weaker electron density observed around the aromatic groups. Given the proximity of C145 to the “lid” residues of the RRM2 and NOPS domains described for the SFPQ-RNA ternary structure,²⁰ it is tempting to speculate that the (R)-SKBG-1 adduct serves as an additional large non-canonical lid residue, where the aromatic groups provide additional stacking contacts for RNA.

Chlorofluoroacetamides engage NONO with improved proteome-wide selectivity

While original CA ligands such as (R)-SKBG-1 engage NONO_C145 with excellent stereoselectivity, the broader proteomic reactivity of these compounds is high,¹³ which limits their utility in some types of cell biology experiments. In considering alternative approaches to covalently engage NONO with less reactive electrophiles, we noted that the hydrogen bond between the backbone N-H of C145 and the C2-carboxamide carbonyl of (R)-SKBG-1, and between the sidechain of Q229 and the CA carbonyl of (R)-SKBG-1 (Figure 1B), together positioned the electrophilic α-carbon center of this compound for reactivity with C145. We accordingly inferred that substitution of the CA group with lower reactivity β-carbon electrophiles like an acrylamide or butynamide might create compounds that are misaligned for covalent engagement of NONO_C145. As an alternative, we considered analogs bearing a CFA, which closely mimics the CA geometry while exhibiting much lower electrophilicity and has emerged as an attractive reactive group for the design of covalent ligands with improved selectivity.^26–28

A full set of CFA stereoisomeric analogs of (R)- and (S)-SKBG-1 was synthesized (Figure 2A, and Data S1) and evaluated for reactivity with NONO by cysteine-directed ABPP^32–35 in the prostate cancer cell line 22Rv1 (20 μM compound, 6 h). Of the four CFA analogs, a single stereoisomer (R, R)-GL-373 showed robust engagement of NONO_C145 (Figure 2B and Data S2). The inactivity of (S, R)-GL-373 indicated that the stereoconfiguration at the CFA center was crucial for reactivity with NONO_C145, as has been observed for CFA ligands targeting other proteins (e.g., SARS-CoV2 protease²⁷). We next generated alkyne analogs of (R, R)- and (S, S)-GL-373—(R, R)- and (S, S)-GL-586, respectively (Figure 2A)—and evaluated the reactivity of these compounds by gel-ABPP in 22Rv1 cells stably expressing WT-NONO or a C145S-NONO mutant. These experiments showed clear stereoselective and site-specific reactivity of (R, R)-586 with WT-NONO with only a handful of additional protein reactivity events being observed across the gel profile (Figure 2C). The (R, R)-GL-586-WT-NONO interaction was blocked by pre-treatment with (R, R)-GL-373 (20 μM, 6 h), but not by other CFA stereoisomers (Figure 2D). Using this competitive gel-ABPP assay, we determined half-maximal target engagement (TE₅₀) values for NONO of 2.2 and 9.0 μM for (R)-SKBG-1 and (R, R)-GL-373, respectively (Figure 2E). We also noted that (R, R)-GL-373 produced a partial stereoselective blockade of a strong ~55 kDa signal (Figure 2D) found in both WT-NONO or a C145S-NONO-expressing 22Rv1 cells (Figure 2C), as well as in cells genetically disrupted for NONO (sgNONO cells; Figure S2). We speculate that this signal corresponds to a combination of endogenous NONO and an additional target of the (R, R)-GL-586 probe.

Despite a modest (~4-fold) reduction in potency, the CFA ligands displayed much better proteome-wide selectivity compared to CA ligands as determined by gel-ABPP experiments performed with (R, R)-GL-586 versus an alkyne analog of (R)-SKBG-1 (compound 14;¹³ Figure 3A) and cysteine-directed ABPP experiments assessing the global reactivity of (R, R)-GL-373 and (R)-SKBG-1 (Figure 3B and Data S2). In the gel-ABPP experiments, the highest concentration tested for (R, R)-GL-586 (20 μM) produced much lower proteome-wide reactivity than the lowest concentration tested for 14 (5 μM) (Figure 3A). In the cysteine-directed ABPP experiments, (R, R)-GL-373 showed strong engagement (>75% blockade of iodoacetamide-desthiobiotin [IA-DTB] reactivity) of only three cysteines (NONO_C145, FAM213_C83/85, and USP48_C409), while (R)-SKBG-1 engaged >20 additional cysteines (Figure 3B and Data S2). The lower proteomic reactivity of the CFA-based NONO ligands correlated with decreased glutathione reactivity compared to CA compounds (Table S2).

Figure 3. — (A) Gel-ABPP data showing concentration-dependent proteome-wide reactivity of alkynes 14 and (R, R)-GL-586 (1 h) in parental 22Rv1 cells or 3XFLAGV5-WT-NONO-expressing 22Rv1 cells. Gel-ABPP experiments were performed as described in Figure 2C. Red asterisks (*) highlight signals corresponding to molecular weight of 3XFLAGV5-NONO. Upper and upper middle images correspond to low and high intensity scans of the gel-ABPP data, respectively. Data are from a single experiment representative of two independent experiments.

(B) Cysteine-directed ABPP data showing global cysteine reactivity profiles for (R)-SKBG-1 and (R, R)-GL-373 (20 μM, 6 h) in parental 22Rv1 cells. Data represent a total of 12,017 quantified cysteines, and areas shaded in gray highlight cysteines displaying substantial engagement (>75% blockade of IA-DTB reactivity) by (R)-SKBG-1 and/or (R, R)-GL-373 (red signals: cysteines engaged by (R)-SKBG-1; purple signals: cysteines engaged by both (R)-SKBG-1 and (R, R)-GL-373). Data are average values from four independent experiments.

(C) Protein-directed ABPP data showing time-dependent engagement of NONO by (R)-SKBG-1 and (R, R)-GL-373 in MCF7 cells. Cells were treated with parent compounds (20 μM) for the indicated times followed by alkyne (R, R)-GL-586 (10 μM, 1 h) and analyzed by protein-directed ABPP as described previously.³² Data are average values ±SD for five-six independent experiments (Welch’s ANOVA with Brown-Forsythe correction, ****adjusted p < 0.0001 for (R)-SKBG-1 24 h vs. DMSO 24 h; ***adjusted p = 0.0009 for (R, R)-GL-373 24 h vs. DMSO 24 h).

(D) Protein-directed ABPP data comparing the stereoselective enrichment of proteins by (R, R)-GL-586 vs. (S, S)-GL-586 (10 μM, 1 h) from MCF7 cells and the competitive blockade of this enrichment by pre-treatment with (R, R)-GL-373 (20 μM, 6 h). Dashed lines mark proteins that showed substantial stereoselective enrichment (log2 > 1.5) by (R, R)-GL-586 and substantial blockade of this enrichment (>75%) by (R, R)-GL-373. Data are average values from a single protein-directed ABPP analysis representative of two protein-directed ABPP analyses each containing at least two independent experiments.

(E and F) Bar graphs showing protein-directed ABPP data for NONO (E) and additional proteins (F) that were stereoselectively enriched by (R, R)-GL-586 and substantially engaged by (R, R)-GL-373. Data are average values ±SD for four-five independent experiments (Welch’s ANOVA with Brown-Forsythe correction, ****adjusted p < 0.0001 for (R)-SKBG-1 vs. (S)-SKBG-1 or (R, R)-GL-373 vs. (S, S)-GL-373).

We also verified stereoselective engagement of NONO by CFA ligands in a second human cancer cell line—the hormone-sensitive breast cancer line MCF7. In these experiments, we compared the time-dependent engagement of NONO by (R)-SKBG-1 and (R, R)-GL-373 by protein-directed ABPP³² using (R, R)-GL-586 as the enrichment probe, which revealed that, while (R)-SKBG-1 engaged NONO more rapidly than (R, R)-GL-373 (2 h time point, Figure 3C and Data S2), both compounds near-completely engaged NONO at later time points, and this engagement was sustained for at least 24 h (Figure 3C and Data S2), consistent with the long half-life reported previously for NONO (>50 h).³⁶ The protein-directed ABPP experiments additionally verified stereoselective engagement of NONO by (R, R)-GL-373 (in comparison to (S, S)-GL-373; Figures 3C–3E and Data S2) along with a handful of additional off-targets (Figure 3D). Interestingly, unlike NONO (Figure 3E), most of these off-targets were strongly engaged by both (R)-SKBG-1 and (S)-SKBG-1 (Figure 3F), suggesting that the reduced intrinsic electrophilicity of the CFA group, while substantially lowering overall proteomic reactivity, might paradoxically enhance the stereoselective liganding of a subset of proteins that are more indiscriminately engaged by higher reactivity CA compounds.

Our data, taken together, demonstrate that NONO_C145 can be stereoselectively and site-specifically engaged by CFA ligands, and these compounds show much lower proteome-wide reactivity in cells than original CA ligands. We next compared the biological effects of (R, R)-GL-373 and (R)-SKBG-1 in cancer cells.

(R, R)-GL-373 exhibits NONO-restricted transcriptomic and growth effects in cancer cells

We previously found that (R)-SKBG-1 remodeled the transcriptomes of cancer cells, and this effect was largely stereoselective (most of the changing genes were not affected by (S)-SKBG-1) and NONO-dependent (most of the changing genes were not affected by (R)-SKBG1 in sgNONO cells).¹³ Here, we evaluated the transcriptomic effects of (R, R)- and (S, S)-GL-373 (20 μM, 6 h) in MCF7 cells by RNA-sequencing (RNA-seq) and found that (R, R)-GL-373 produced profound effects on the MCF7 transcriptome that included substantial (log₂ > 1) decreases in nearly 1,000 genes and a more restricted increase in ~60 genes (Figures 4A and S3, and Data S3). These effects were stereoselective (Figures 4B and S4A and Data S3) and generally not observed in sgNONO cells (Figures 4C, S4B, and S4C, and Data S3). Additionally, the NONO-dependent transcriptomic effects of (R, R)-GL-373 generally aligned with those of (R)-SKBG-1 (5 μM, 6 h) (Figure 4D and Data S3) with the exception of a limited subset of genes that were strongly induced by (R)-SKBG-1, but not (R, R)-GL-373 (Figure 4E). These genes were also induced by (i) (S)-SKBG-1 and (ii) (R)-SKBG-1 in sgNONO cells (Figure 4E, right; Figures S4D and S4E), suggesting they were NONO-independent effects. We noted that several of the genes induced by (R)-SKBG-1, but not (R, R)-GL-373, are also regulated by the KEAP1-NRF2 electrophilic/oxidative stress response pathway.^37–39 We interpret these data to indicate that (R, R)-GL-373 causes much less electrophilic stress compared to (R)-SKBG-1 and, as a consequence, produces a more NONO-restricted impact on cancer cell transcriptomes.

The transcriptomic effects of (R, R)-GL-373 included the downregulation of several cancer-relevant genes, including those encoding the transcription factors ESR1, RXRA, and TRPS1 (Figures 4A–4C). (R, R)-GL-373 also increased the expression of the NONO paralog PSPC1 (Figures 4A, 4B, and 4E), an effect that is also observed in cells genetically disrupted for NONO^13,40 (and has been proposed to reflect a compensatory response to loss of NONO).^15,40 Western blotting experiments performed at 24 h post-treatment confirmed that (R, R)-GL-373 additionally induced stereoselective and NONO-dependent decreases in the abundance of ESR1 and RXRA proteins, as well as increases in PSPC1 (Figures 4F and 4G). These effects were observed across a concentration range of 5–20 μM of (R, R)-GL-373 with near complete loss of ESR1 in MCF7 cells treated with 10 μM (Figure 4F).

Finally, both (R)-SKBG-1 and (R, R)-GL-373 produced stereoselective and NONO-dependent reductions in the proliferation of MCF7 cells (Figure 4H). While (R)-SKBG-1 showed higher potency than (R, R)-GL-373 in these cell growth assays, the anti-proliferative effects of (R, R)-GL-373 showed much greater stereoselectivity and NONO-dependency, likely reflecting the lower general electrophilic stress caused by this compound compared to (R)-SKBG-1.

These data, taken together, indicate that CFA ligands exhibit NONO-dependent effects on the transcriptomes and growth of cancer cells while avoiding the NONO-independent electrophilic stress caused by original CA ligands.

DISCUSSION

RBPs represent an exciting opportunity for chemical biology and drug discovery.^11,12 A substantial portion of the human proteome binds RNA as a primary or secondary function,^2,41 and many RBPs have clear human-disease relevance.⁴² Additionally, drugs such as risdiplam for the treatment of SMA have shown the potential for RBPs to serve as targets that promote therapeutic gene expression.⁸ Nonetheless, most RBPs lack chemical probes, likely reflecting, at least in part, the technical challenges associated with screening this class of proteins, which are often parts of large and dynamic complexes. ABPP and related chemical proteomic methods offer an attractive way to identify ligands for RBPs directly in native cellular environments, as we recently demonstrated with the discovery of CAs that covalently bind NONO to remodel the transcriptomes of cancer cells.¹³ However, the structural bases for CA binding to NONO, as well as the potential to advance this interaction into more selective chemical probes, have remained important open questions.

The (R)-SKBG-1-NONO co-crystal structure provides clear evidence of a small molecule-binding pocket proximal to the RRM1 and RRM2 RNA-binding domains. Our biochemical data measuring NONO binding affinity for RNAs also support previous cell-based (eCLIP) experiments¹³ that covalent binding of (R)-SKBG-1 to this pocket enhances NONO-RNA interactions. How precisely this outcome is achieved remains unclear. Limited structural information is available on DBHS protein-RNA complexes, and the only available structure of RNA-bound SFPQ homo-dimers²⁰ would suggest that (R)-SKBG-1 might disrupt NONO-RNA interactions. On the other hand, the various structures of DBHS proteins show highest variability in the pose of the RRM1 domain,¹⁵ and it is possible that (R)-SKBG-1 reactivity with C145 strengthens RNA binding to NONO by resembling a productive conformation for RNA interactions. A structure of a ternary covalent ligand:NONO:RNA complex may be required to more fully understand how small molecule reactivity with C145 strengthens NONO-RNA interactions.

The (R)-SKBG-1-NONO structure also revealed a well-aligned binding pose for C145 reactivity with the CA α-carbon of (R)-SKBG-1, which inspired the generation of a less electrophilic CFA analog (R, R)-GL-373. While (R, R)-GL-373 showed some loss (~4-fold) in potency for engaging NONO, the much greater proteome-wide selectivity of this interaction resulted in profound NONO-dependent remodeling of breast cancer cell transcriptomes without the induction of general electrophile stress caused by (R)-SKBG-1. These data thus provide further evidence for the utility of the CFA as a tempered reactive group in the development of covalent chemical probes.^26–28,43 We should acknowledge, however, that the cellular activity of (R, R)-GL-373 likely benefited from the long half-life of NONO, which allowed for near-complete and sustained engagement of C145 over a 24 h time period (Figure 3C). Shorter half-life proteins may require higher potency CFA compounds to achieve similar levels of engagement in cells. (R, R)-GL-373 also exhibited stereoselective reactivity with a handful of proteins beyond NONO, which reinforces the importance of performing additional control experiments in NONO-disrupted (sgNONO) cells to verify on-target (NONO dependent) activities, as we demonstrated herein for the transcriptomic and cell growth effects of (R, R)-GL-373.

Looking forward, we are intrigued by the impact of covalent NONO ligands on the expression of breast cancer-relevant transcription factors like ESR1 and TRPS1, which mirror the previously reported effects of NONO ligands on androgen receptor expression in prostate cancer cells.¹³ From a translational perspective, these findings suggest that targeting NONO may offer a way to suppress lineage drivers in breast and prostate cancer that is complementary to the targeted protein degradation strategies under investigation in the clinic.^44,45 However, the current NONO ligands, including (R, R)-GL-373, suppress a large swath of transcripts, which results in a more general antiproliferative effect.¹³ Using the (R)-SKBG-1-NONO co-crystal structure as a guide, we speculate that it may be possible to develop ligands with improved transcript selectivity by, for instance, modifying the structures of these compounds to interface more directly with RNA. Finally, we also anticipate that the tempered reactivity and greater proteomic specificity displayed by (R, R)-GL-373 will facilitate addressing fundamental mechanistic questions that include the following: (1) how do NONO ligands promote such a rapid loss of transcripts in cancer cells? (2) What features do these transcripts share in common that confer sensitivity to NONO ligands? (3) How do cells exposed to NONO ligands upregulate paralogous DBHS proteins? (4) What cellular factors confer sensitivity or resistance to NONO ligands? Considering the diverse transcriptional and post-transcriptional roles performed by DBHS proteins in human cells, we believe the development of (R, R)-GL-373 will serve as a useful tool for studying the functions of this important family of RBPs.

Limitations of the study

Given that our (R)-SKBG1:NONO co-crystal structure lacks RNA, we can only speculate, at this stage, on how covalent ligands strengthen NONO interactions with RNA. While our MST experiments support that (R)-SKBG-1 increases NONO-binding affinity for multiple RNAs, the precise structural mechanism underlying this outcome remains poorly defined. Specifically, how ligands reacting with C145 of NONO influence conformational dynamics within the RRM1 domain and strengthen the NONO-RNA interface has yet to be resolved. Future efforts to determine a ternary ligand:NONO:RNA structure hold promise to provide more detailed mechanistic insights.

Despite exhibiting substantial improvements in proteome-wide selectivity, CFA ligands, such as (R, R)-GL-373, still show only low-μM engagement of NONO. While this degree of potency does not hinder the use of (R, R)-GL-373 in cell biological studies, improvements will be needed before such CFA ligands can be applied to study NONO function in vivo. From a translational perspective, covalent NONO ligands suppress the expression of key cancer drug targets like ESR1, but this effect is also accompanied by decreases in a large array of other transcripts that will likely limit the cell type-specificity of the antiproliferative activity of NONO ligands. Whether NONO ligands can be optimized to show transcript-restricted activity remains an important unanswered question.

RESOURCE AVAILABILITY

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contacts, Benjamin F. Cravatt (cravatt@scripps.edu) and Charles S. Bond (charles.bond@uwa. edu.au).

Materials availability

All chemical probes and other elaborated electrophilic compounds generated in this study are available from the lead contact with a completed materials transfer agreement.

Data and code availability

Crystallographic data have been deposited at the Protein DataBank and are publicly available as of the date of publication. The PDB accession number is PDB: 9NZI and is listed in the key resources table. Proteomics data have been deposited at PRIDE and are publicly available as of the date of publication. The dataset identifier is PRIDE: PXD064685 and is listed in the key resources table. Processed proteomics data are provided in Data S2. RNA-seq data have been deposited at the NCBI Gene Expression Omnibus (GEO) and are publicly available as of the date of publication. The accession number is GEO: GSE299099 and is listed in the key resources table. Processed RNA-seq data are provided in Data S3. All other data reported in this study are available from the lead contact upon request.
This article does not report original code.
Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

KEY RESOURCES TABLE

REAGENT or RESOURCES	SOURCE	IDENTIFIER
Antibodies
Rabbit anti- ESR1 Receptor	Cell Signaling Tech	Cat#:8644S; RRID: AB_2617128
RXRA Rabbit Poly Ab	Proteintech	Cat#: 21218-1-AP; RRID: AB_10693633
Mouse anti- NONO	BD Biosciences	Cat#: 611278; RRID: AB_398807
Rabbit anti- NONO	Bethyl Laboratories	Cat#: A300-587A; RRID: AB_495510
Anti-GAPDH HRP	Santa Cruz Biotechnology	Cat#: sc-47724 HRP; RRID: AB_3716894
Mouse anti- PSPC1	Sigma-Aldrich	Cat#: SAB4200503; RRID: N/A
Mouse anti- FLAG	Sigma-Aldrich	Cat#: F1804; RRID: AB_262044
HRP-labeled anti-mouse	Cell Signaling Tech	Cat#: 7076; RRID: AB_330924
HRP-labeled anti-rabbit	Cell Signaling Tech	Cat#: 7074; RRID: AB_2099233
Bacterial and virus strains
One Shot Stbl3 Chemically Competent E. coli	Thermo Scientific	Cat#: C737303
ccdB Survival T1	Invitrogen	Cat#: 11828029
Chemicals, peptides, and recombinant proteins
RPMI-1640 media	Corning	Cat#: 15-040-CV
DMEM media	Corning	Cat#: 15-013-CV
Glutamax	Life Technologies	Cat#: 35050061
Penicillin-Streptomycin	Lonza	Cat#: 17-603E
Fetal bovine serum	Omega Scientific	Cat#: FB-21
PEI MAX Linear MW 40,000	Polysciences	Cat#: 24765-1
RNAiMax	ThermoFisher	Cat#: 13778030
Fugene 6	Promega	Cat#: E2691
Polybrene	Santa Cruz	Cat#: 134220
Blasticidin	Fisher Scientific	Cat#: 50712728
Puromycin	Sigma-Aldrich	Cat#: P8833
Pierce ECL Western Blotting Substrate	ThermoFisher	Cat#: 32106
SuperSignal West Femto PLUS Chemiluminescent Substrate	ThermoFisher	Cat#: PI34095
Novex 10% Tris-Glycine Mini Gels	Life Technologies	Cat#: XP00105BOX
Nitrocellulose western blotting membrane, 0.45 mM	GE Healthcare Amersham	Cat#: 10600002
Complete+Ultra Mini EDTA-Free Protease Inhibitor Cocktail Tablets	Roche	Cat#: 05892791001
DMSO	Corning	Cat#: 25-950-CQC
Carbenicillin	Fisher	Cat#: NC0753434
Chloramphenicol	Sigma-Aldrich	Cat#: C0378
Spectinomycin	Sigma-Aldrich	Cat#: S4014
Desthiobiotin polyethyleneoxide iodoacetamide	Santa Cruz Biotechnology	Cat#: sc-300424
Urea	Fisher Scientific	Cat#: M1084871000
Iodoacetamide	Sigma-Aldrich	Cat#: I1149-25G
Dithiothreitol (DTT)	Fisher Bioreagents	Cat#: BP172-25
Tris(benzyltriazolylmethyl)amine (TBTA)	TCI	Cat#: T2993
Copper(II) sulfate, anhydrous	Sigma-Aldrich	Cat#: 451657-10G
Tris(2-carboxyethyl)phosphine HCl (TCEP)	Sigma-Aldrich	Cat#: 75259
Biotin-PEG4-azide	Chempep	Cat#: 271606
Sequencing grade modified trypsin	Promega	Cat#: V5111
Lys-C, Mass Spec Grade	Promega	Cat#: VA1170
Streptavidin agarose resin	Fisher Scientific	Cat#: 20353
Tween 20	Fisher Bioreagents	Cat#: BP337-500
Triton X-100	EMD Millipore	Cat#: TX1568
Nonidet P40 substitute (Igepal CA-630)	USB Corporation	Cat#: 19628
EPPS	Sigma-Aldrich	Cat#: E0276
Calcium carbonate	Fisher	Cat#: C77
SDS	Fisher	Cat#: BP166
K₂CO₃	Fisher	Cat#: P208
Triethylammonium bicarbonate buffer	Sigma-Aldrich	Cat#: T7408-500ML
TMT10plex^™	ThermoFisher	Cat#: 90406
TMTpro^™ 16plex tag	ThermoFisher	Cat#: A44520
Acetonitrile	VWR Intl	Cat#: BJAS017-0100
Hydroxylamine solution	Sigma-Aldrich	Cat#: 467804-10ML
Formic acid, ~98%, for mass spectrometry	Honeywell Fluka	Cat#: 94318-250ML-F
Bovine serum albumin	Sigma-Aldrich	Cat#: A2153
Sep-Pak C18 cartridges	Waters	Cat#: WAT054955
Spin Columns, Desalting, Pierce Peptide	ThermoFisher	Cat#: PI89852
Power Blotter Select Transfer Stacks. Nitrocellulose	Thermo Scientific	Cat#: PB3210
SuperSignal West Pico PLUS Chemiluminescent Substrate T	Thermo Scientific	Cat#: 34580
Extraction disks, C18 sorbent (for Stage-tip)	3M empore	Cat#:143863
Critical commercial assays
Micro BCA Protein Assay Kit	Thermo Scientific	Cat#: 23235
Cell Titer Glo	Promega	Cat#: 134220
Deposited data
Crystallography	This paper	PDB: 9NZI
Proteomics	This paper	PRIDE: PXD064685
RNA-Sequencing	This paper	GEO: GSE299099
Oligonucleotides
Primers used in this study	IDT	Methods below
Software and algorithms
MO.Affinity Analysis Software	Nanotemper	https://shop.nanotempertech.com/software/analysis-software/
MOLREP	Version 11.0/22.07.2010/	https://www.ccp4.ac.uk/html/molrep.html
CCP4 Suite	Version 9	https://www.ccp4.ac.uk/download/#os=macos
COOT	GTK4: 1.1.14	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
PHENIX	Version 1.21	https://phenix-online.org/
RAW Converter	Version 1.1.0.22; 2004 release	http://fields.scripps.edu/rawconv/
Integrated Proteomics Pipeline (IP2) and ProLuCID	Integrated Proteomics Applications	http://goldfish.scripps.edu/
Prism (v10.4.1)	GraphPad Software	http://www.graphpad.com/scientific-software/prism/
STAR aligner (v2.7.9a)	Cold Spring Harbor Laboratory	https://github.com/alexdobin/STAR
R (v2025.05.0 + 496)	R Core Team	https://www.r-project.org/
Salmon (v1.3.0)	Stony Brook University	https://github.com/COMBINE-lab/salmon
DESeq2 (v1.30.1)	European Molecular Biology Laboratory	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Other
Quikchange	Agilent	Cat#: 200521
Gateway Vector Conversion System	Invitrogen	Cat#: 11828029
NEBNext Ultra RNA Library Prep	NEB	Cat#: E7770S
RNeasy Plus kit	QIAGEN	Cat#: 74034
QIAshredder columns	QIAGEN	Cat#: 79654
QIAprep Spin Miniprep kit	QIAGEN	Cat#: 27104
PierceTM BCA Protein Assay Kit	ThermoFisher	Cat#: 23225

Open in a new tab

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines

22Rv1 (CVCL_1045, Male, Prostate carcinoma) and MCF7 (CVCL_0031, Female, Breast adenocarcinoma) cells were obtained from ATCC and grown and maintained in RPMI 1640 media (Thermo Fisher Scientific) containing 10% (v/v) FBS (Omega Scientific), 100 U/mL penicillin-streptomycin (GE Life Sciences), and Glutamax [22Rv1] or DMEM (Thermo Fisher Scientific) containing 10% (v/v) FBS (Omega Scientific), Glutamax, and 100 U/mL penicillin-streptomycin (GE Life Sciences) [MCF7] at 37°C with 5% CO₂. All cell lines were obtained directly from ATCC, were not further authenticated after purchase, and were routinely inspected for mycoplasma contamination.

METHOD DETAILS

Crystallography

Truncated versions of NONO (residues 53–312) homodimer, SFPQ (276–535) homodimer and NONO/SFPQ heterodimer were expressed, purified and concentrated for crystallography and microscale thermophoresis (MST) experiments as described.^21–23

For crystallization, NONO homodimer (3.7 mg/mL) was incubated with 4x molar excess of (R)-SKBG-1 (100 μM in DMSO) for 15 min at room temperature. Sitting drop vapor diffusion screens (ProPlex Screen MD1–38, SG1 Screen MD1–88, Pact Premier, JGSG Plus (Molecular Dimensions), Natrix 1 & 2 (Hampton Research) were set up in Intelli-Plate 96–3 (Art Robbins) plates using an Art Robbins Phenix liquid handling robot (reservoir 80 μL, protein:reservoir ratios 1:1, 2:1, 1:2), incubated at 20°C and observed using Formulatrix RockImager. Diffraction quality crystals were obtained from conditions optimized to 0.1 M HEPES, 28% PEG 2000 monomethyl ether. Crystals were cryoprotected by addition of 10% glycerol, harvested and cryopreserved for data collection at the MX2 beamline of the Australian Synchrotron.⁴⁶ Complete data to 2.5 Å, reduced with XDS⁴⁷ yielded a dataset suitable for structure solution and refinement (details in Table S1). The structure was solved by molecular replacement (MOLREP),⁴⁸ CCP4 Suite⁴⁹ using a NONO homodimer model derived from chains A and B of PDB entry 5IFM.¹⁸ Subsequent rounds of model fitting, refinement and validation in COOT⁵⁰ and PHENIX,⁵¹ including geometric parameters for the C145-linked SKBG-1 (ELBOW),⁵² yielded a final model with two NONO homodimers in the asymmetric unit and an R factor of 22.5% and R-free of 26.2%. The validated structure was deposited in the PDB with code 9NZI.

Microscale thermophoresis assay (MST)

For MST experiments, RNA oligonucleotides (5′–6 FAM–TGUGUGUGGCCGU–3′ and 5′–6 FAM–TUGUGCCGUCU–3′) were purchased from IDT. NONO homodimer, SFPQ homodimer and NONO/SFPQ heterodimer were incubated with a 4x excess (per protein monomer) of (-R)-SKBG-1 (100 μM in DMSO), (S)-SKBG-1 or DMSO only. MST was carried out in triplicate on a dilution series of protein in the presence of 200 nM RNA using a Monolith NT.155 instrument, and data analyzed using MO. Affinity (NanoTemper). To test the significance of order of addition of SKBG-1 and RNA, measurements were carried out on series of simples of identical composition, but with RNA added first.

Plasmid amplification and purification

All plasmids were amplified in Stbl3 cells (ThermoFisher) using vendor’s procedures and purified by miniprep (QIAGEN), except for the pRK5 and pLenti6.2-ccdB-3xFLAG-V5 Gateway destination vectors, which were amplified in ccdB Survival T1 cells (Invitrogen).

Mutagenesis

Site-directed mutagenesis was performed on the pDONR 223-NONO construct from the Human ORFome V8.1 Library (Dharmacon) using the Quikchange mutagenesis kit (Agilent). All mutations were verified by DNA sequencing. Primers for mutagenesis (mutated nucleotide in bold and underlined).

NONO-C145S-fwd (T→A): GTGTGCGCTTTGCCAGCCATAGTGCATCC
NONO-C145S-rev: GATGCACTATGGCTGGCAAAGCGCACAC
NONO-PAM-mutation-fwd (C→G): ACCAGGAGAGAAGACGTTCACCCAACGAAGC
NONO-PAM-mutation-rev: GCTTCGTTGGGTGAACGTCTTCTCTCCTGGT
NONO-gateway-STOP-fwd (C→A): CAAACAAACGTCGCCGATACTAACCAACTTTCTTGTACAAAG
NONO-gateway-STOP-rev: CTTTGTACAAGAAAGTTGGTTAGTATCGGCGACGTTTGTTTG

Plasmids for stable expression

The desired pDONR 223-NONO construct was cloned into pLenti6.2-ccdB-3xFLAG-V5 (Addgene #87071) using the gateway vector conversion system (Invitrogen). Final plasmids contain a CMV promoter followed by a Gateway cloning linker, a start methionine, the NONO ORF without stop codon, a C-terminal FLAG tag, and a second Gateway cloning linker. All gene constructs were verified by DNA sequencing.

NONO knockout by CRISPR/Cas9

NONO knockout cells were generated using previously described protocols.⁵³ In brief, non-targeting control sgRNAs or sgRNAs targeting NONO (described below) were designed (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design), and cloned into Lenti-CRISPR v2 plasmid (Addgene). 1 μg sgRNA-encoding plasmids were co-transfected with ΔVPR envelope (0.9 μg) and CMV VSV-G (0.1 μg) packaging plasmids into 2.5 × 106 HEK293T cells using the Fugene 6 transfection reagent (Promega). Virus-containing supernatants were collected forty-eight hours after transfection, passed through a 0.45 μM filter, and used to infect target cells in the presence of 10 μg/mL polybrene (Santa Cruz). Twenty-four hours post-infection, fresh media was added to the target cells, which were allowed to recover for an additional twenty-four hours. Puromycin (1 μg/mL) was then added to cells Following 10 days of puromycin selection, NONO expression in NONO sgRNA cells was determined by Western blot (see STAR Methods below) compared to control sgRNA transfected cells.

Non-targeting sgRNA (sequences are 5′–3′).

Lenti-CRISPRv2: sgCRISPR-CTRL1-fwd: GCGAGGTATTCGGCTCCGCG
Lenti-CRISPRv2: sgCRISPR-CTRL1-rev: CGCGGAGCCGAATACCTCGC

sgRNAs targeting NONO (sequences are 5′–3′).

Lenti-CRISPRv2: NONO-1-fwd: CTGGACAATATGCCACTCCG
Lenti-CRISPRv2: NONO-1-rev: CGGAGTGGCATATTGTCCAG

Generation of 22Rv1 NONO C-FLAG WT or C145S cell line

1 μg pLenti6.2-NONO-C-FLAG-encoding plasmid (WT or C145S) with a silent PAM site mutation was co-transfected with ΔVPR envelope (0.9 μg) and CMV VSV-G (0.1 μg) packaging plasmids into 2.5 × 10⁶ HEK293T cells using the Fugene 6 transfection reagent (Promega). Virus-containing supernatants were collected forty-eight hours after transfection, passed through a 0.45 μM filter, and used to infect target cells in the presence of 10 μg/mL polybrene (Santa Cruz). Twenty-four hours post-infection, fresh media was added to the target cells, which were allowed to recover for an additional twenty-four hours. Blasticidin (10 μg/mL) was then added to cells. Following 10 days of blasticidin selection, NONO-FLAG expression was determined by Western blot (see STAR Methods below) compared to empty vector transfected cells. Endogenous NONO was then knocked out by CRISPR/Cas9 using NONO sgRNA as described above.

Western blot analysis

For western blot protein analysis, cells (5 × 10⁵ cells/treatment) were seeded in 2 mL media in a 6 well plate for 24 h. Media was then aspirated and replaced with 2 mL media containing the indicated compounds or 0.1% DMSO for the indicated times. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 3 min, 4°C). Cell pellets were flash-frozen in liquid N₂ and stored at −80°C until further analysis. On the day of the analysis, the cell pellets were thawed on ice, re-suspended in cold PBS (100–150 μL), and lysed by sonication using a Branson Sonifier SFX250 (Branson Ultrasonics, catalog #101-063-965). Sonication was performed with a microtip probe at 10% amplitude, using pulsed mode (1 s on/1 s off) for 2 cycles of 8 pulses each, while samples were kept on ice. Protein concentrations for all the samples were measured by BCA assay (ThermoFisher) and adjusted to 2 mg/mL, 4x loading buffer was added, and the samples were heated at 95°C for 5 min, followed by a 1 min spin at 20,000g. The proteins were resolved using SDS-PAGE (10% acrylamide gel) and transferred to 0.2 μm Power Blotter Select Transfer Stacks, nitrocellulose, mini (invitrogen). The membrane was blocked with 5% milk in Tris-buffered saline (20 mM Tris-HCl 7.6, 150 mM NaCl) with 0.1% tween 20 (TBST) buffer at RT for 1 h or at 4°C overnight), washed with TBST, and incubated with primary antibodies in 5% milk in TBST at 4°C overnight (at 1:10000, 1:5000, or 1:2000 depending on the antibody). Following another TBST wash (3 × 3 min), the membrane was incubated with secondary antibody (1:1000 in 5% milk in TBST) at RT for 1 h. The membrane was washed with TBST (3 × 3 min), developed with Femto (for RXRA, ESR1, or PSPC1) or standard (for NONO, FLAG, and GAPDH) ECL western blotting detection reagent kit (Thermo Scientific), and chemiluminescence was imaged on a ChemiDoc MP system (Bio-Rad). Relative band intensities were quantified using Image Lab software (Biorad).

Gel-based ABPP

5 × 10⁵ 22Rv1 cells stably expressing 3X-FLAG-V5 (WT or C145S), were seeded into a 6 well plate and allowed to adhere overnight at 37°C. Once at 80–90% confluence, cells were then treated with DMSO (0.1%) or the indicated compound for 6 h in situ, followed by treatment with (R, R)-GL-586 or #14 alkyne at the indicated concentration (otherwise 10 μM) probe in situ for 1 h at 37°C. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 5 min, 4°C). Cell pellets were flash-frozen in liquid N₂ and stored at −80°C until further analysis. On the day of the analysis, the cell pellets were thawed on ice, re-suspended in cold PBS (with Roche cOmplete, mini, EDTA-free Protease Inhibitor Cocktail, 1 tablet in 10 mL PBS) and lysed by sonication with Branson probe sonicator (2 × 15 pulses; 10% power output). Protein concentrations for all the samples were measured by BCA assay (Thermofischer) and adjusted to 2 mg/mL. Rhodamine-azide (1 μL/reaction, 1.25 mM in DMSO), CuSO₄ (1 μL/reaction, 50 mM in H₂O), TBTA (3 μL/reaction, 1.7 mM in DMSO/t-BuOH (1:4, v/v)) and tris(2-carboxyethyl) phosphine (TCEP) (1 μL/reaction, 50 mM in H₂O, freshly prepared) were premixed. 6 μL of this click reagent mixture was immediately added to 50 μL of each alkyne probe-labeled sample and incubated for 1 h at room temperature. The reactions were quenched by adding 4X SDS–PAGE loading buffer. The quenched samples were loaded on a 10% acrylamide gel for separation by SDS-PAGE. Samples were visualized by in-gel fluorescence scanning using the ChemiDoc MP system (Bio-Rad) and fluorescent band intensity was quantified with Image Lab software (Bio-Rad).

Cysteine-directed ABPP

Cysteine-directed activity based-protein profiling (ABPP) was performed as previously described.³² 22Rv1 cells (2 million cells in 10 cm dish) were plated and given time to adhere to the plate. Once plates were about 80–90% confluent the cells were treated with DMSO or indicated probes. Cells were washed with ice-cold DPBS (3x), followed by resuspension in DPBS and lysed by probe-sonication (2 × 15 pulses; 10% power output). The total protein content of whole-cell lysates was measured using a Pierce BCA protein assay kit and the samples were normalized to 2 mg/mL and 500 μL. Samples were treated with 5 μL of 10 mM IA-DTB (in DMSO) for 1 h at RT with vortexing every 20 min. Proteins were precipitated by the addition of cold methanol (600 μL), chloroform (200 μL) and HPLC-grade water (100 μL), followed by vortexing and centrifugation at 16,000×g for 10 min. Without disrupting the protein disk, both the top and bottom layers were aspirated, and the protein disk was sonicated again in 500 μL of methanol and centrifuged at 16,000×g for 10 min. After the methanol was completely aspirated, protein pellets were immediately processed or frozen at −80°C. Pellets were resuspended in 90 μL of denaturing/reducing buffer (9 M urea, 10 mM DTT, 50 mM triethylammonium bicarbonate (TEAB) pH 8.5). The samples were reduced by heating at 65°C for 20 min, followed by alkylation with 10 μL of 500 mM iodoacetamide at 37°C for 30 min. The samples were then centrifuged at 16,000×g for 2 min to pellet any insoluble precipitate and probe-sonicated once more to ensure complete resuspension, and then diluted with 300 μL of 50 mM TEAB pH 8.5 to reach a final urea concentration of 2 M. Trypsin (4 μL of 0.25 μg/μL in trypsin resuspension buffer with 25 mM CaCl₂) was added to each sample and digested at 37°C overnight. Digested samples were then diluted with 300 μL of enrichment buffer (50 mM TEAB pH 8.5, 150 mM NaCl, 0.2% NP-40) containing streptavidin-agarose beads (50 μL of 50% slurry/sample) and were rotated at RT for 2 h. The samples were centrifuged (2,000×g, 2 min) and the entire content transferred to BioSpin columns and washed (3 × 1 mL wash buffer, 3 × 1 mL DPBS, 3 × 1 mL water). Enriched peptides were eluted from the beads with 300 μL of 50% acetonitrile with 0.1% formic acid and dried using a SpeedVac at 46°C. Enriched peptides were resuspended in 100 μL EPPS buffer (200 mM, pH 8.0) with 30% acetonitrile, vortexed and water bathsonicated. The samples were TMT-labelled by the addition of 3 μL of 20 mg/mL (in dry acetonitrile) of corresponding TMT¹⁰ plex tag for 1.5 h at RT with vortexing every 30 min. TMT labeling was quenched by the addition of hydroxylamine (3 μL 5% solution in H₂O) and incubated for 15 min at RT. Samples were then acidified with 5 μL formic acid, combined and dried using a SpeedVac. Samples were desalted with a Sep-Pak column and then high-pH-fractionated by HPLC (described in the following section) into a 96-well plate and recombined into 12 fractions (total).

HPLC fractionation

Desalted samples were resuspended in 500 mL buffer A (5% acetonitrile, 0.1% formic acid in milliQ water) and fractionated with Agilent HPLC into a 96 deep-well plate containing 20 mL of 20% formic acid to acidify the eluting peptides, as previously reported.28 The peptides were eluted onto a capillary column (ZORBAX 300Extend-C18, 3.5 mm) and separated at a flow rate of 0.5 mL/min using the following gradient: 100% buffer A from 0 to 2 min, 0%–13% buffer B from 2 to 3 min, 13%–42% buffer B from 3 to 60 min, 42%–100% buffer B from 60 to 61 min, 100% buffer B from 61 to 65 min, 100%–0% buffer B from 65 to 66 min, 100% buffer A from 66 to 75 min, 0%–13% buffer B from 75 to 78 min, 13%–80% buffer B from 78 to 80 min, 80% buffer B from 80 to 85 min, 100% buffer A from 86 to 91 min, 0%–13% buffer B from 91 to 94 min, 13%–80% buffer B from 94 to 96 min, 80% buffer B from 96 to 101 min, and 80%–0% buffer B from 101 to 102 min (buffer A: 10 mM aqueous NH4HCO3; buffer B: acetonitrile). The plates were evaporated to dryness using SpeedVac and peptides resuspended in 80% acetonitrile, with 0.1% formic acid and combined to a total of 12 fractions (e.g., fraction1 = well 1A+ 1B.1H, fraction 2 = well 2A+2B.2H) (3 × 300 mL/column). Samples were SpeedVac to dryness and the resulting 12 fractions were re-suspended in buffer A (5% acetonitrile, 0.1% formic acid) and analyzed by mass spectrometry.

Protein-directed ABPP

Protein-directed ABPP was performed as previously described.³² MCF7 cells were treated with DMSO or an indicated concentration of compounds for 6 h (unless otherwise stated) followed by an alkyne probe (10 μM, 1 h). Cells were washed with ice-cold DPBS (3x). Cell pellets were resuspended in DPBS and lysed by probe-sonication (2 × 15 pulses; 10% power output). Proteome was normalized to 2 mg/mL in 500 mL (Pierce BCA protein assay), and the alkyne probe labeled proteins were treated with 55 μL of click MS-Master-mix [30 μL of 1.7 mM TBTA in 4:1 t-BuOH:DMSO, 10 μL of 50 mM CuSO₄ in H2O, 10 μL of freshly prepared 50 mM Tris(2-carboxyethyl)phosphine in H2O, 10 μL of 10 mM Biotin-PEG4-azide]. Proteins were precipitated with cold methanol (600 μL), chloroform (200 μL) and water (100 μL), vortexed, and then centrifuged at 16,000×g for 10 min. The top and bottom layers were aspirated, and the protein-disk was washed with 1 mL ice-cold MeOH and the protein disk was then sonicated in 500 μL of ice-cold methanol and pelleted at 16,000×g for 10 min. After the methanol was completely aspirated, protein pellets were immediately processed or stored at −80°C. Pellets were resuspended in 500 μL freshly prepared 8 M urea in DPBS, followed by the addition of 10 μL of 10 wt % SDS. Samples were then pulse-sonicated until clear (~15 pulses). The samples were reduced with 25 μL of 200 mM dithiothreitol (DTT) at 65°C for 15 min, followed by alkylation with 25 μL of 400 mM iodoacetamide at 37°C for 30 min in the dark. Then, 65 μL of 20 wt % SDS was added, and the samples were transferred to a 15-mL tube in a total volume of 6 mL with DPBS (0.2% final SDS). Washed streptavidin beads (Thermo, #20353; 100 μL of 50% slurry/sample) were then added and proteins were enriched for 1.5 h at RT with rotation. After incubation, the beads were pelleted (2 min at 2,000×g) and washed with 0.2% wt % SDS in DPBS (2 × 10 mL), DPBS (1 × 5 mL), HPLC-grade water (2 × 1 mL) and 200 mM 4-(2- hydroxyethyl)-1-piperazinepropanesulfonic acid (EPPS; 1 mL, pH 8.0). Enriched proteins were digested on-bead overnight with 200 μL of trypsin mix (2 M urea, 1 mM CaCl2, 10 μg/mL trypsin (Promega, #V5111), 200 mM EPPS, pH 8.0). The beads were pelleted at 2,000×g, the supernatant was collected and then diluted with 100 μL acetonitrile (30% final). Samples were then labeled with 6 μL 20 mg/mL (in dry acetonitrile) TMTpro 16plex tag (Thermo, #A44520) or TMT10plex (Thermo, #90406) for 1.5 h at RT (vortexed every 30 min). TMT labeling was quenched by the addition of hydroxylamine (6 μL 5% solution in H₂O) and incubated for 15 min at RT. Samples were then acidified with 20 μL formic acid, combined and dried using a SpeedVac at 46°C. Samples were desalted with a Sep-Pak column Vac 1 cc (50 mg) (Waters, #WAT054955) and then high pH fractionated into ten fractions using Pierce peptide desalting spin columns (Thermo, #89852) and an acetonitrile/NH4HCO3 (10 mM) gradient for high-pH spin column fractionation (described in the following section) and analyzed by mass spectrometry.

High-pH spin column fractionation

Thirty high-pH elution buffers were freshly prepared for peptide fractionation using increasing concentrations of acetonitrile (ACN) in 10 mM aqueous ammonium bicarbonate (NH₄HCO₃). Each eluent was prepared in low-bind microcentrifuge tubes by mixing the appropriate volumes of ACN and 10 mM NH₄HCO₃ to a final volume of 1 mL per fraction. The ACN concentrations ranged from 7.5% to 95%, increasing in 2.5% increments. For each sample, one high-pH reversed-phase spin column was equilibrated. To begin, the white bottom cap of the spin column was removed, and the red top cap was loosely tightened. The spin column was placed into a 2.0 mL microcentrifuge tube and centrifuged at 5,000×g for 2 min to pack the resin and remove the storage solution. Next, each column was washed twice with 300 μL of 100% acetonitrile (MeCN), centrifuging at 5,000×g for 2 min each time and discarding the flow-through. This was followed by two washes with 300 μL of water containing 0.1% formic acid, using the same centrifugation conditions. The column was then considered equilibrated. Dried, TMT-labeled peptide samples were resuspended in 300 μL of buffer A and loaded onto the equilibrated column. The sample was centrifuged at 2,000×g for 2 min, and the flow-through was collected, re-applied to the column, and centrifuged again at 2,000×g for 2 min to maximize peptide retention. The column was washed by transferring it to a fresh 2.0 mL microcentrifuge tube and adding 300 μL of water, followed by centrifugation at 2,000×g for 2 min. To remove excess TMT reagent, 300 μL of 5% MeCN in 10 mM aqueous ammonium bicarbonate (NH₄HCO₃) was added to the column, and the sample was centrifuged at 2,000×g for 2 min. Peptides were eluted into fresh 1.5 mL microcentrifuge tubes using the pre-prepared high-pH eluent mixtures (100 μL per fraction, 300 μL for the final elution), spinning at 2,000 × g for 1 min per elution. A total of 30 individual fractions were collected. Every 10th fraction was combined to yield 10 final pooled fractions (e.g., fractions 1, 11, and 21 were combined). Combined fractions were dried using a SpeedVac concentrator and analyzed by mass spectrometry.

TMT LC-MS analysis

Fractions were resuspended in buffer A (5% acetonitrile, 0.1% formic acid in water) and analyzed by liquid chromatography-tandem mass spectrometry using an Orbitrap Fusion Tribrid Mass Spectrometer (Thermo Scientific) coupled to an UltiMate 3000 Series Rapid Separation LC system and autosampler (Thermo Scientific Dionex). The peptides were eluted onto a capillary column (75-μm-inner-diameter fused silica, packed with C18 (Waters, Acquity BEH C18, 1.7 μm, 25 cm) or an EASY-Spray HPLC column (Thermo, #ES902, #ES903) using an Acclaim PepMap 100 (Thermo, #164535) loading column, and separated at a flow rate of 0.25 μL min-1. Peptides were separated across a 10 min gradient of 5%, 150 min gradient of 5–20%, 20 min 20–45%, and then 5 min 45–95% acetonitrile (0.1% formic acid) in H2O (0.1% formic acid) followed by column equilibration. Data were acquired using an MS3-based TMT method on Orbitrap Fusion or Eclipse Tribrid mass spectrometers.

Fusion instruments:

The scan sequence began with an MS1 master scan (Orbitrap analysis, resolution 120,000, 400–1,700 m/z, RF lens 60%, maximum injection time 50 ms) with dynamic exclusion enabled (repeat count 1, duration 15 s). The top precursors were then selected for MS2/MS3 analysis. MS2 analysis consisted of quadrupole isolation (isolation window 0.7) of precursor ion followed by collision-induced dissociation in the ion trap (collision energy 35%, maximum injection time 120 ms). Following the acquisition of each MS2 spectrum, synchronous precursor selection enabled the selection of up to 10 MS2 fragment ions for MS3 analysis. MS3 precursors were fragmented by higher energy collisional dissociation (HCD) and analyzed using the Orbitrap (collision energy 55, maximum injection time 120 ms, resolution 50,000). For MS3 analysis, we used charge state-dependent isolation windows. For charge state z = 2, the MS isolation window was set at 1.2; for z = 3–6 the MS isolation window was set at 0.7.

Eclipse Tribrid instrument:

The scan sequence began with an MS1 master scan (Orbitrap analysis, resolution 120,000, 400–1,700 m/z, RF lens 30%, maximum injection time 50 ms) with dynamic exclusion enabled (repeat count 1, duration 30 s). The top precursors were then selected for MS2/MS3 analysis. MS2 analysis consisted of quadrupole isolation (isolation window 0.7) of precursor ion followed by higher-energy collisional dissociation (HCD) in the ion trap (collision energy 36%, maximum injection time 120 ms). Following the acquisition of each MS2 spectrum, synchronous precursor selection enabled the selection of up to 10 MS2 fragment ions for MS3 analysis. MS3 precursors were fragmented by HCD and analyzed using the Orbitrap (collision energy 55%, maximum injection time 120 ms, resolution 30,000). For MS3 analysis, we used charge state dependent isolation windows. For charge state z = 2, the MS isolation window was set at 1.2; for z = 3 the MS isolation window was set at 0.7; for z = 4–6, the MS isolation window was set at 0.4.

MS data processing

Raw files were uploaded to the Integrated Proteomics Pipeline (IP2, version 6.7.1) available at http://ip2.scripps.edu/ip2/mainMenu.html and MS2 and MS3 files were extracted from the raw files using RAW Converter (version 1.1.0.22) available at http://fields.scripps.edu/rawconv/ and searched using the ProLuCID algorithm using a reverse concatenated, non-redundant variant of the Human UniProt database (release 2016–07). Cysteine residues were searched with a static modification for carboxyamidomethylation (+57.02146 Da). N-termini and lysine residues were also searched with a static modification corresponding to the TMT tag (+229.1629 Da for 10-plex and - +304.2071 Da for 16-plex). Peptides were required to be at least six amino acids long. ProLuCID data were filtered through DTASelect (version 2.0) to achieve a spectrum false-positive rate below 1%. We included a keratin filter. The MS3-based peptide quantification was performed with reporter ion mass tolerance set to 20 ppm with the Integrated Proteomics Pipeline (IP2).

Data analysis – Cysteine-directed ABPP

The census output files from Integrated Proteomics Pipeline 2 (IP2, v.6.7.1) were further processed to calculate cysteine engagement ratios (probe vs. DMSO) by dividing each TMT reporter ion intensity by the average intensity for the DMSO channels. Peptide-spectra matches were grouped based on protein ID and the cysteine residue number. Peptides with summed reporter ion intensities <10000, coefficient of variation for DMSO channels >0.5 were excluded from analysis. TMT ion intensities were median normalized per TMT channel. Two independent replicates of 10-plex experiments in 22Rv1 cells were analyzed together (total n = 2–4 per treatment condition). Data were averaged from all replicates.

Data analysis – Protein-directed ABPP

The census output files from IP2 were further processed to calculate enrichment engagement ratios (probe vs. probe) by dividing each TMT reporter ion intensity by the sum of intensity for all the channels. Each spectrum-peptide match was grouped based on protein ID, excluding peptides with summed reporter ion intensities <10,000, coefficient of variation of >0.5, <2 unique peptides per protein ID.

RNA-seq – Sample preparation

MCF7 cells (1 × 10⁶ cells/treatment) were seeded in 2 mL media in a 6 well cm plate for 24 h. Media was then aspirated and replaced with 2 mL media containing the indicated compounds or 0.1% DMSO for 6 h. Following this incubation period, the cells were washed in cold DPBS, scraped, harvested and pelleted in 1.5 mL tubes (2000 g, 3 min, 4°C). Cell pellets were flash-frozen in liquid N₂ and stored at −80°C until further analysis. Total RNA from thawed cells was isolated using RNeasy Plus Kit (QIAGEN) with QIAshredder columns for cell lysis (QIAGEN) according to the manufacturer’s protocol and stored at −80°C until further analysis. RNA concentration was measured by Nanodrop and 1–2 μg were used for sequencing.

RNA-seq – Library preparation with polyA selection and HiSeq sequencing

Library preparations and sequencing reactions were conducted at GENEWIZ, LLC. (South Plainfield, NJ, USA) as follows: Extracted RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies) and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies). RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB). Briefly, mRNAs were first enriched with Oligo(dT) beads. Enriched mRNAs were fragmented for 15 min at 94°C. First strand and second strand cDNAs were subsequently synthesized. cDNA fragments were end repaired and adenylated at 3′ ends, and universal adapters were ligated to cDNA fragments, followed by index addition and library enrichment by limited-cycle PCR. The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies) and quantified by using Qubit 2.0 Fluorometer (Invitrogen) as well as by quantitative PCR (KAPA Biosystems). The sequencing libraries were clustered on 2 lanes of a flowcell. After clustering, the flowcell was loaded on the Illumina HiSeq instrument (4000 or equivalent) according to manufacturer’s instructions. The samples were sequenced using a 2 × 150 bp Paired End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from Illumina HiSeq was converted into fastq files and de-multiplexed using Illumina’s bcl2fastq 2.17 software. One mismatch was allowed for index sequence identification.

RNA-seq – Data processing and quantification

Raw RNA-seq reads were processed using the nf-core/rnaseq pipeline (v3.13.2),⁵⁴ which includes quality control with FastQC, adapter trimming, and alignment to the human reference genome (GRCh38) using STAR Salmon. Aligned reads were quantified at the gene level using featureCounts (v2.0.6) from the Subread package, with annotations derived from GENCODE release v29. Default parameters were used, and count matrices were generated for downstream differential expression analysis.

RNA-seq – Data analysis

Raw read counts were generated using FeatureCounts (v2.0.1) from aligned BAM files. Differential expression analysis was performed using the DESeq2 package (v1.40.1) in R (v4.3.1). Samples were initially collected in biological triplicate for each condition. However, quality control analysis revealed that two samples in different treatment groups behaved as outliers. These replicates were removed from the analysis to avoid skewing downstream results. To avoid unbalanced statistics, a principal component analysis based on variance-stabilizing transformation (VST) was used to remove one replicate in each group of triplicates that clustered separately from the other two. Final differential expression analysis was therefore performed using two biological replicates per condition. DESeq2’s standard pipeline was used, including size factor estimation, dispersion estimation, and negative binomial model fitting. Wald tests were used to determine statistical significance, and Benjamini-Hochberg correction was applied to control the false discovery rate (FDR). Genes with an adjusted p-value <0.01 were considered significantly differentially expressed.

Cell growth inhibition assays

Cells were seeded at 5000 cells per well (100 μL) in 96-well clear-bottom, white-wall plates. 100 μL of medium containing DMSO or compounds (2 × final concentrations) were added and cultured for 5 days (replacing media + compound every 48 h). On the day of reading, media was removed and replaced with 100 μL of fresh media before adding 100 μL CellTiterGlo reagent (Promega) for 30 min. Luminescence was then measured on a Clariostar plate reader (BMG Labtech). Relative cell growth was determined by normalizing the luminescence reading to the DMSO treated control.

Synthesis and characterization of compounds

Small molecules, including (R, R)-GL-373, its stereoisomers ((S, S)-GL-373, (R, S)-GL-373, (S, R)-GL-373), and alkyne-containing analogs ((R, R)-GL-586 and (S, S)-GL-586), were synthesized by adapting previously reported procedures.¹³ Detailed synthetic procedures and analytical data are provided in the STAR Methods (below) and Data S1.

General considerations

All NMR spectra were recorded at 298 K unless otherwise noted. ¹H NMR spectra were recorded on Bruker Avance III 400, Avance III HD 400, Avance Neo 400 spectrometers (¹H, 400 MHz). ¹³C NMR spectra were recorded on a ZKNJ QOne Quantum-I Plus 400 spectrometer (¹³C, 101 MHz). ¹⁹F NMR spectra were recorded on a Bruker AV Neo 399 MHz spectrometer (¹⁹F, 376 MHz). ¹H NMR data are reported as follows: chemical shift (δ), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet; br = broad), coupling constants, and integration. Chemical shifts are reported in parts per million (ppm) using the appropriate solvent as reference.⁵⁵ Analytical supercritical fluid chromatography (SFC) was performed on a Shimadzu LC system (flow rate: 3 mL/min, back pressure: 100 Bar, column temperature: 35°C) equipped with a polydiode array detector. Mass measurements for high-resolution mass spectrometry (HRMS) were performed on a Waters Xevo G2-XS TOF calibrated against sodium formate clusters and using a LeuEnk lockmass. Expected monoisotopic masses were calculated using MassLynx 4.1 and the m/z values for calibrant and lockmass were MassLynx-default values.

Synthesis of (-R, R)-GL-373

graphic file with name nihms-2132231-f0002.jpg

Lithium (R)-4-(tert-butoxycarbonyl)piperazine-2-carboxylate (S2)

To a solution of S1 (2.00 g, 8.19 mmol, 1.0 equiv) in MeOH (20 mL) were added LiOH·H₂O (515 mg, 12.3 mmol, 1.5 equiv) and H₂O (2 mL). The mixture was stirred at 25°C for 12 h. On completion, the reaction mixture was concentrated under reduced pressure to give S2 (1.95 g, quant.) as a yellow solid, which was used in the next step without further purification.

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)piperazine-1-carboxylate (S3)

To a precooled (0°C) solution of S2 (300 mg, 1.27 mmol, 1.0 equiv) and 4-methoxybenzylamine (192 mg, 1.40 mmol, 1.1 equiv) in DMF (5 mL) were added PyBOP (991 mg, 1.91 mmol, 1.5 equiv) and triethylamine (386 mg, 3.81 mmol, 3.0 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was concentrated under reduced pressure to give a residue, which was purified by reverse-phase-HPLC (A: H₂O (10 mM NH₄HCO₃), B: acetonitrile; gradient: B%: 0%–100%, 20 min) and purified by prep-HPLC (column: Waters Xbridge Prep OBD C18 150*40 mm*10 um; mobile phase: [H₂O (0.05% NH₃·H₂O)-acetonitrile]; gradient: 29%–59% B over 15.0 min) to give S3 (0.30 g, 68% yield) as a white solid.

¹H NMR (400 MHz, CDCl₃) δ 7.19 (d, J = 8.2 Hz, 2H), 7.11–6.94 (m, 1H), 6.86 (d, J = 8.8 Hz, 2H), 4.37 (d, J = 5.8 Hz, 2H), 4.14–4.06 (m, 1H), 3.84–3.73 (m, 1H), 3.80 (s, 3H), 3.35 (dd, J = 9.3, 3.6 Hz, 1H), 3.01 (t, J = 11.4 Hz, 1H), 2.91 (d, J = 12.3 Hz, 2H), 2.76 (t, J = 11.4 Hz, 1H), 1.45 (s, 9H), 1 exchangeable proton not observed.

LC-MS m/z calc. for C₁₈H₂₈N₃O₄ [M + H]⁺ 350.2 found 350.2.

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S4)

To a precooled (0°C) solution of S3 (0.30 g, 859 μmol, 1.0 equiv) and triethylamine (261 mg, 2.58 mmol, 3.0 equiv) in dichloromethane (10 mL) was added (4-methoxyphenyl)sulfonyl chloride (266 mg, 1.29 mmol, 1.5 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was concentrated under reduced pressure. The resulting residue was purified by flash column chromatography (SiO₂, petroleum ether/EtOAc = 5:1 to 2:1) to give S4 (0.35 g, 78% yield) as a white solid.

¹H NMR (400 MHz, CDCl₃) δ 7.75 (d, J = 9.0 Hz, 2H), 7.15 (d, J = 8.6 Hz, 2H), 6.97 (d, J = 9.0 Hz, 2H), 6.85 (d, J = 8.7 Hz, 2H), 6.82–6.76 (m, 1H), 4.63–4.51 (m, 1H), 4.48–4.25 (m, 3H), 3.87 (s, 3H), 3.80 (s, 3H), 3.80–3.57 (m, 2H), 3.32–3.21 (m, 1H), 2.91–2.58 (m, 2H), 1.41 (s, 9H).

LC-MS m/z calc. for C₂₅H₃₄N₃O₇S [M + H]⁺ 520.2 found 520.2.

(R)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S5)

To a solution of S4 (1.00 g, 1.92 mmol) in dioxane (2 mL) was added HCl (2 M solution in dioxane, 5 mL, 5.2 equiv). The mixture was stirred at 20°C for 2 h. On completion, the reaction mixture was concentrated in vacuo to give S5·HCl (750 mg, 90% w/w [dioxane], 77% yield) as a white solid, which was used in the next step without further purification.

¹H NMR (400 MHz, CD₃OD) δ 8.45 (t, J = 4.4 Hz, 1H), 7.80 (d, J = 8.9 Hz, 2H), 7.19 (d, J = 8.7 Hz, 2H), 7.04 (d, J = 9.0 Hz, 2H), 6.88 (d, J = 8.7 Hz, 2H), 4.76 (d, J = 4.5 Hz, 1H), 4.33–4.15 (m, 2H), 4.00 (dd, J = 14.5, 3.8 Hz, 1H), 3.88 (s, 3H), 3.79 (s, 3H), 3.72–3.59 (m, 3H + dioxane), 3.34 (m, 1H), 3.07 (dd, J = 13.2, 4.6 Hz, 1H), 2.96 (td, J = 12.8, 4.1 Hz, 1H).

LC-MS m/z calc. for C₂₀H₂₆N₃O₅S [M + H]⁺ 420.2 found 420.2.

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-373)

To a precooled (0°C) solution of S5·HCl (160 mg, 90% w/w [dioxane], 316 μmol, 1.0 equiv), DIPEA (181 mg, 1.40 mmol, 4.4 equiv) and (R)-chlorofluoroacetic acid (59.2 mg, 526 μmol, 1.7 equiv) in dichloromethane (2 mL) was added HATU (267 mg, 702 μmol, 2.2 equiv). The mixture was stirred at 0°C for 1 h. On completion, the reaction mixture was concentrated in vacuo. The residue was purified by prep-TLC (SiO₂, petroleum ether/EtOAc = 2:1) and prep-HPLC (column: Waters xbridge 150*25 mm 10 μm; mobile phase: A: H₂O (10 mM NH₄HCO₃), B: acetonitrile; gradient: 30%–60% B over 15.0 min) to give (R, R)-GL-373 (80.0 mg, 49% yield) as a white amorphous solid.

Note: NMR spectra are consistent with a 7:3 mixture of rotamers.

¹H NMR (400 MHz, CDCl₃): δ 7.73 (d, J = 9.0 Hz, 2H), 7.20–7.07 (m, 2H), 7.04–6.93 (m, 3H), 6.92–6.76 (m, 2.7H), 6.35 (d, ²J_HF = 50.4 Hz, 0.3H), 4.84 (d, J = 13.7 Hz, 0.3H), 4.56–4.41 (m, 1.7H), 4.41–4.19 (m, 2H), 4.11 (d, J = 13.7 Hz, 0.7H), 3.99–3.65 (m, 7.3H), 3.55–3.38 (m, 0.3H), 3.31–3.07 (m, 1H), 2.99 (dd, J = 14.1, 4.2 Hz, 0.7H), 2.77 (dd, J = 14.0, 4.5 Hz, 0.3H), 2.65 (t, J = 12.3 Hz, 0.7H).

¹⁹F NMR (376 MHz, CDCl₃): δ 142.93, 139.69.

¹³C NMR (101 MHz, CDCl₃) δ 167.32, 167.18, 163.79, 163.59, 161.90, 161.68, 159.14, 130.11, 129.41, 129.30, 129.12, 128.93, 115.04, 114.75, 114.21, 114.08, 97.15, 95.48, 94.69, 92.91, 56.03, 55.77, 55.73, 55.30, 50.79, 43.59, 43.54, 43.44, 43.25, 42.50, 42.25, 41.95, 41.12.

HRMS m/z calc. for C₂₂H₂₆ClFN₃O₆S [M + H]⁺ 514.1215 found 514.1217.

Synthesis of stereoisomers of (R, R)-GL-373

(S)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, S)-GL-373). (S, S)-GL-373 was prepared from ent-S5⋅HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.

Note: NMR spectra are consistent with a 7:3 mixture of rotamers.

¹H NMR (400 MHz, CDCl₃) δ 7.74 (d, J = 8.9 Hz, 2H), 7.18–7.09 (m, 2H), 7.06–6.89 (m, 3.3H), 6.88–6.75 (m, 2.4H), 6.35 (d, ²J_HF = 50.4 Hz, 0.3H), 4.85 (d, J = 13.7 Hz, 0.3H), 4.56–4.42 (m, 1.7H), 4.42–4.20 (m, 2H), 4.12 (d, J = 13.7 Hz, 0.7H), 4.00–3.67 (m, 7.3H), 3.45 (t, J = 12.3 Hz, 0.3H), 3.30–3.09 (m, 1H), 2.99 (dd, J = 14.0, 4.2 Hz, 0.7H), 2.85–2.73 (m, 0.3H), 2.65 (t, J = 12.3 Hz, 0.7H).

¹⁹F NMR (376 MHz, CDCl₃): δ 142.84, 139.64.

¹³C NMR (101 MHz, CDCl₃) δ 167.28, 167.09, 163.81, 161.89, 161.67, 159.16, 130.12, 129.87, 129.33, 129.16, 128.95, 115.06, 114.77, 114.22, 97.22, 94.82, 56.07, 55.82, 55.39, 55.27, 43.49, 42.51, 41.84, 41.10.

HRMS m/z calc. for C₂₂H₂₆ClFN₃O₆S [M + H]⁺ 514.1215 found 514.1219.

(R)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, R)-GL-373). (S, R)-GL-373 was prepared from S5·HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.

Note: NMR spectra are consistent with a 9:1 mixture of rotamers.

¹H NMR (400 MHz, CDCl₃) δ 7.75 (d, J = 9.0 Hz, 2H), 7.17–6.93 (m, 6H), 6.89–6.81 (m, 2H), 6.34 (d, ²J_HF = 50.7 Hz, 0.1H), 4.82 (d, J = 13.7 Hz, 0.1H), 4.45 (d, J = 3.7 Hz, 1H), 4.41–4.20 (m, 4H), 3.95–3.83 (m, 4H), 3.79 (s, 3H), 3.11 (ddd, J = 15.1, 12.1, 3.4 Hz, 1H), 2.81 (dd, J = 14.0, 4.0 Hz, 1H), 2.45 (td, J = 13.1, 3.5 Hz, 1H).

¹⁹F NMR (376 MHz, CDCl₃): δ 147.73, 141.33.

¹³C NMR (101 MHz, CDCl₃) δ 167.23, 167.13, 163.83, 162.95, 162.70, 159.19, 159.08, 130.47, 129.93, 129.26, 129.21, 129.08, 128.90, 115.15, 114.83, 114.27, 91.11, 91.04, 88.64, 88.59, 56.06, 56.01, 55.89, 55.74, 55.40, 55.26, 43.56, 43.41, 42.86, 42.77, 40.42, 40.32.

HRMS m/z calc. for C₂₂H₂₆ClFN₃O₆S [M + H]⁺ 514.1215 found 514.1209.

(S)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, S)-GL-373). (R, S)-GL-373 was prepared from ent-S5·HCl and (R)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-373.

Note: NMR spectra are consistent with a 9:1 mixture of rotamers.

¹H NMR (400 MHz, CDCl₃) δ 7.75 (d, J = 8.9 Hz, 2H), 7.17–6.93 (m, 6H), 6.84 (d, J = 8.6 Hz, 2H), 6.35 (d, ²J_HF = 50.6 Hz, 0.1H), 4.82 (d, J = 13.7 Hz, 0.1H), 4.53–4.43 (m, 1H), 4.41–4.18 (m, 4H), 3.94–3.83 (m, 4H), 3.79 (s, 3H), 3.11 (ddd, J = 15.0, 12.1, 3.4 Hz, 1H), 2.81 (dd, J = 14.0, 4.0 Hz, 1H), 2.45 (td, J = 12.8, 3.5 Hz, 1H).

¹⁹F NMR (376 MHz, CDCl₃): δ 147.73, 141.34.

¹³C NMR (101 MHz, CDCl₃) δ 167.23, 167.14, 163.82, 162.95, 162.70, 159.19, 130.47, 129.26, 129.22, 129.08, 128.90, 115.14, 114.84, 114.26, 91.11, 91.04, 88.63, 56.06, 56.01, 55.88, 55.74, 55.40, 55.27, 43.56, 43.41, 42.87, 42.78, 40.43.

HRMS m/z calc. for C₂₂H₂₆ClFN₃O₆S [M + H]⁺ 514.1215 found 514.1212.

Synthesis of alkyne-containing analogs of (R, R)-GL-373

graphic file with name nihms-2132231-f0003.jpg

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)piperazine-1-carboxylate (S6)

To a solution of S2 (300 mg, 1.27 mmol, 1 equiv) and 4-ethynylbenzylamine (234 mg, 1.40 mmol, 1.1 equiv) in DMF (5 mL) were added DIPEA (492 mg, 3.81 mmol, 3.0 equiv) and HATU (724 mg, 1.91 mmol, 1.5 equiv). The mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was diluted with H₂O (20 mL) and extracted with EtOAc (20 mL × 3). The combined organic layers were dried over Na₂SO₄, filtered and concentrated under reduced pressure to give a residue and purified by reversed-phase HPLC (A: H₂O (10 mM NH₄HCO₃), B: acetonitrile; gradient: B: 30–50%, 20 min) to give S6 (150 mg, 77% purity) as a yellow solid. Further purification by reversed-phase HPLC (A: H₂O (10 mM formic acid), B: acetonitrile; gradient: B: 30–50%, 20 min) gave S6·HCO₂H (100 mg, 20% yield) as a white solid.

¹H NMR (400 MHz, CDCl₃) δ 8.12 (s, 1H, formate), 7.45 (d, J = 8.0 Hz, 2H), 7.35–7.26 (m, 1H), 7.21 (d, J = 7.9 Hz, 2H), 4.43 (d, J = 5.9 Hz, 2H), 4.07 (dd, J = 13.5, 3.7 Hz, 1H), 3.95–3.68 (m, 1H), 3.68–3.43 (m, 4H), 3.31–2.88 (m, 3H), 2.81 (ddd, J = 12.8, 9.7, 3.4 Hz, 1H), 1.45 (s, 9H).

LC-MS m/z calc. for C₁₅H₁₈N₃O₃ [M-tBu+2H]⁺ 288.1 found 288.2.

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S7)

To a precooled (0°C) solution of S6·HCO₂H (100 mg, 0.257 mmol) in dichloromethane (5 mL) were added triethylamine (84.9 mg, 0.839 mmol, 3.3 equiv) and 4-methoxysulfonyl chloride (116 mg, 0.559 mmol, 2.2 equiv). The mixture was stirred at 0°C for 1 h. On completion, the reaction mixture was concentrated under reduced pressure to give a residue, which was purified by flash silica gel chromatography (SiO₂, hexanes/EtOAc = 7:3 to 1:1) to give S7 (40 mg, 26% yield) as a white solid.

¹H NMR (400 MHz, CDCl₃) δ 7.76 (d, J = 8.9 Hz, 2H), 7.45 (d, J = 8.2 Hz, 2H), 7.19 (d, J = 7.9 Hz, 2H), 6.98 (d, J = 8.9 Hz, 2H), 6.95–6.90 (m, 1H), 4.65–4.34 (m, 4H), 3.88 (s, 3H), 3.84–3.59 (m, 2H), 3.33–3.21 (m, 1H), 3.07 (s, 1H), 2.85–2.61 (m, 2H), 1.41 (s, 9H).

LC-MS m/z calc. for C₂₇H₃₂N₃O₆S [M + H]⁺ 514.2 found 514.1.

(R)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S8)

To a solution of S7 (200 mg, 389 μmol) in dioxane (1 mL) was added HCl/dioxane (4 M, 2 mL) and the resulting mixture was stirred at 25°C for 1 h. On completion, the reaction mixture was concentrated to give compound S8·HCl (160 mg, quant.) as a yellow solid, which was used in the next step without further purification.

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-586)

To a precooled (0°C) solution of (R)-chlorofluoroacetic acid (26.1 mg, 232 μmol), HATU (147 mg, 387 μmol) and DIEA (75.0 mg, 580 μmol) in dichloromethane (10 mL) was added S8·HCl (80.0 mg, 193 μmol) and the mixture was stirred at 0°C for 2 h. On completion, the reaction mixture was partitioned between ethyl acetate (60 mL) and brine (40 mL). Then, the aqueous layer was extracted with ethyl acetate (40 mL × 3). The organic layers were combined, dried over sodium sulfate, filtered and concentrated under reduced pressure to give a residue, which was purified by prep-TLC (SiO₂, petroleum ether/EtOAc = 2:1) and prep-HPLC (column: Waters Xbridge 150*25 mm* 5 um; mobile phase: A: H₂O (10 mM NH₄HCO₃), B: acetonitrile; gradient: B: 40%–70% over 9 min) to give (R, R)-GL-586 (26.0 mg, 26% yield) as a white solid.

Note: NMR spectra are consistent with a 3:2 mixture of rotamers.

¹H NMR (400 MHz, CD₃OD) δ 7.82–7.69 (m, 2H), 7.42 (d, J = 8.2 Hz, 2H), 7.23 (d, J = 7.9 Hz, 2H), 7.01 (t, J = 9.6 Hz, 2H), 6.91 (d, ²J_HF = 49.2 Hz, 0.6H), 6.84 (d, ²J_HF = 49.1 Hz, 0.4H), 4.70 (d, J = 13.7 Hz, 0.6H), 4.61–4.48 (m, 1H), 4.40–4.16 (m, 2.4H), 4.08 (br d, J = 13.7 Hz, 0.4H), 3.94 (d, J = 13.8 Hz, 0.6H), 3.87 (s, 3H), 3.83–3.71 (m, 1.6H), 3.70–3.58 (m, 0.4H), 3.46 (s, 1H), 3.39 (dd, J = 14.1, 4.7 Hz, 0.4H), 3.24 (ddd, J = 14.6, 9.9, 5.6 Hz, 0.6H), 3.09 (dd, J = 13.7, 4.7 Hz, 0.6H), 3.00 (t, J = 13.0 Hz, 0.4H), 1 exchangeable proton not observed.

HRMS m/z calc. for C₂₃H₂₄ClFN₃O₅S [M + H]⁺ 508.1109 found 508.1108.

(S)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, S)-GL-586)

(S, S)-GL-586 was prepared from ent-S8·HCl and (S)-chlorofluoroacetic acid following a procedure analogous to that used for the synthesis of (R, R)-GL-586.

Note: NMR spectra are consistent with a 3:2 mixture of rotamers.

¹H NMR (400 MHz, MeOD) δ 7.81–7.70 (m, 2H), 7.42 (d, J = 8.0 Hz, 2H), 7.23 (d, J = 7.9 Hz, 2H), 7.01 (t, J = 9.8 Hz, 2H), 6.91 (d, ²J_HF = 49.2 Hz, 0.6H), 6.84 (d, ²J_HF = 49.1 Hz, 0.4H), 4.70 (d, J = 13.7 Hz, 0.6H), 4.58–4.50 (m, 1H), 4.40–4.16 (m, 2.4H), 4.12–4.04 (m, 0.4H), 3.95 (br d, J = 13.8 Hz, 0.6H), 3.87 (s, 3H), 3.84–3.71 (m, 1.6H), 3.70–3.57 (m, 0.4H), 3.46 (s, 1H), 3.39 (dd, J = 14.0, 4.6 Hz, 0.4H), 3.24 (ddd, J = 14.7, 10.0, 5.6 Hz, 0.6H), 3.09 (dd, J = 13.7, 4.7 Hz, 0.6H), 3.05–2.91 (m, 0.4H), 1 exchangeable proton not observed.

HRMS m/z calc. for C₂₃H₂₄ClFN₃O₅S [M + H]⁺ 508.1109 found 508.1118.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis was performed using GraphPad Prism version 9 for Windows (GraphPad Software, La Jolla California USA, https://www.graphpad.com/). Statistical values including the n and statistical significance are reported in the Figure legends. All details are included in figure legends.

ADDITIONAL RESOURCES

No additional resources were used in this study.

Supplementary Material

NIHMS2132231-supplement-4.xlsx^{(37.8MB, xlsx)}

NIHMS2132231-supplement-3.xlsx^{(6.4MB, xlsx)}

NIHMS2132231-supplement-2.pdf^{(2.1MB, pdf)}

NIHMS2132231-supplement-1.pdf^{(1.3MB, pdf)}

Supplemental information can be found online at https://doi.org/10.1016/j.chembiol.2025.12.010.

Highlights.

Co-crystal structure reveals how covalent ligands stereoselectively bind NONO
Chlorofluoroacetamides bind NONO with high proteomic selectivity
CFA ligands remodel cancer cell transcriptomes in a NONO-dependent manner
CFA ligands suppress cancer cell growth in a NONO-dependent manner

SIGNIFICANCE.

RBPs are a large and diverse class of proteins that contribute to virtually all steps of the transcriptional and post-transcriptional regulation of gene expression. Chemical tools are lacking for RBPs, which often form dynamic complexes in cells that are challenging to reconstitute for conventional small-molecule screening. ABPP and related chemical proteomic methods offer a potentially powerful way to discover small molecule ligands for RBPs, as we have shown in the identification of covalent ligands targeting the RBP NONO. Here, we describe the structural characterization of a ligandable pocket in proximity to the RNA-binding domain of NONO that offers mechanistic hypotheses for covalent compound-induced stabilization of NONO-RNA interactions. In developing CFA ligands for NONO, we further show the potential for targeting this RBP with highly selective covalent probes that lead to the global remodeling of cancer cell transcriptomes and suppression of cancer cell growth without causing general oxidative stress associated with higher reactivity electrophilic compounds. In summary, our findings provide a powerful new chemical tool to study NONO-mediated regulation of the transcriptome and, through doing so, highlight the broader potential for chemical proteomics to address the ligandability of RBPs.

ACKNOWLEDGMENTS

This work was supported by the NIH (R35 CA231991; R01 CA238249) and delivered as part of the eDyNAmiC team supported by the Cancer Grand Challenges partnership funded by the Cancer Research UK (CGCATF-2021/100012 + CGCATF-2021/100021) and the National Cancer Institute (OT2CA278688 + OT2CA278692). This research was undertaken in part using the MX2 beamline at the Australian Synchrotron, part of ANSTO, and made use of the Australian Cancer Research Foundation (ACRF) detector. Australian Research Council (DP220103667 to C.S.B. and A.H.F.; LE120100092, LE140100096, and LE230100156 to C.S.B.; DE240101210 to A.C.M.; FT180100204 to A.H.F.), the National Health and Medical Research Council of Australia (APP1147496 to C.S.B. and A.H.F.) and the Cancer Research Trust (the Australian Centre for RNA Therapeutics in Cancer, A.H.F. and C.S.B.).

Footnotes

DECLARATION OF INTERESTS

B.F.C. is an advisor to Vividion Therapeutics and on the Advisory Board of Cell Chemical Biology.

REFERENCES

1.Licatalosi DD, and Darnell RB (2010). RNA processing and its regulation: global insights into biological networks. Nat. Rev. Genet 11, 75–87. 10.1038/nrg2673. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Hentze MW, Castello A, Schwarzl T, and Preiss T (2018). A brave new world of RNA-binding proteins. Nat. Rev. Mol. Cell Biol 19, 327–341. 10.1038/nrm.2017.130. [DOI] [PubMed] [Google Scholar]
3.Gebauer F, Preiss T, and Hentze MW (2012). From cis-regulatory elements to complex RNPs and back. Cold Spring Harb. Perspect. Biol 4, a012245. 10.1101/cshperspect.a012245. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Kressler D, Hurt E, and Bassler J (2010). Driving ribosome assembly. Biochim. Biophys. Acta 1803, 673–683. 10.1016/j.bbamcr.2009.10.009. [DOI] [PubMed] [Google Scholar]
5.Matera AG, Terns RM, and Terns MP (2007). Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nat. Rev. Mol. Cell Biol 8, 209–220. 10.1038/nrm2124. [DOI] [PubMed] [Google Scholar]
6.Cooper TA, Wan L, and Dreyfuss G (2009). RNA and disease. Cell 136, 777–793. 10.1016/j.cell.2009.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Gebauer F, Schwarzl T, Valcárcel J, and Hentze MW (2021). RNA-binding proteins in human genetic disease. Nat. Rev. Genet 22, 185–198. 10.1038/s41576-020-00302-y. [DOI] [PubMed] [Google Scholar]
8.Ratni H, Ebeling M, Baird J, Bendels S, Bylund J, Chen KS, Denk N, Feng Z, Green L, Guerard M, et al. (2018). Discovery of Risdiplam, a Selective Survival of Motor Neuron-2 (SMN2) Gene Splicing Modifier for the Treatment of Spinal Muscular Atrophy (SMA). J. Med. Chem 61, 6501–6517. 10.1021/acs.jmedchem.8b00741. [DOI] [PubMed] [Google Scholar]
9.Xiang JS, Schafer DM, Rothamel KL, and Yeo GW (2024). Decoding protein-RNA interactions using CLIP-based methodologies. Nat. Rev. Genet 25, 879–895. 10.1038/s41576-024-00749-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Heindel AJ, Brulet JW, Wang X, Founds MW, Libby AH, Bai DL, Lemke MC, Leace DM, Harris TE, Hafner M, and Hsu KL (2023). Chemoproteomic capture of RNA binding activity in living cells. Nat. Commun 14, 6282. 10.1038/s41467-023-41844-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Mir C, Garcia-Mayea Y, and LLeonart ME (2022). Targeting the “undruggable”: RNA-binding proteins in the spotlight in cancer therapy. Semin. Cancer Biol 86, 69–83. 10.1016/j.semcancer.2022.06.008. [DOI] [Google Scholar]
12.Julio AR, and Backus KM (2021). New approaches to target RNA binding proteins. Curr. Opin. Chem. Biol 62, 13–23. 10.1016/j.cbpa.2020.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Kathman SG, Koo SJ, Lindsey GL, Her HL, Blue SM, Li H, Jaensch S, Remsberg JR, Ahn K, Yeo GW, et al. (2023). Remodeling oncogenic transcriptomes by small molecules targeting NONO. Nat. Chem. Biol 19, 825–836. 10.1038/s41589-023-01270-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Takeiwa T, Ikeda K, Horie K, and Inoue S (2024). Role of RNA binding proteins of the Drosophila behavior and human splicing (DBHS) family in health and cancer. RNA Biol 21, 1–17. 10.1080/15476286.2024.2332855. [DOI] [Google Scholar]
15.Knott GJ, Bond CS, and Fox AH (2016). The DBHS proteins SFPQ, NONO and PSPC1: a multipurpose molecular scaffold. Nucleic Acids Res 44, 3989–4004. 10.1093/nar/gkw271. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Passon DM, Lee M, Rackham O, Stanley WA, Sadowska A, Filipovska A, Fox AH, and Bond CS (2012). Structure of the heterodimer of human NONO and paraspeckle protein component 1 and analysis of its role in subnuclear body formation. Proc. Natl. Acad. Sci. USA 109, 4846–4850. 10.1073/pnas.1120792109. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Schell B, Legrand P, and Fribourg S (2022). Crystal structure of SFPQ-NONO heterodimer. Biochimie 198, 1–7. 10.1016/j.biochi.2022.02.011. [DOI] [PubMed] [Google Scholar]
18.Knott GJ, Chong YS, Passon DM, Liang XH, Deplazes E, Conte MR, Marshall AC, Lee M, Fox AH, and Bond CS (2022). Structural basis of dimerization and nucleic acid binding of human DBHS proteins NONO and PSPC1. Nucleic Acids Res 50, 522–535. 10.1093/nar/gkab1216. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Clery A, Blatter M, and Allain FH (2008). RNA recognition motifs: boring? Not quite. Curr. Opin. Struct. Biol 18, 290–298. 10.1016/j.sbi.2008.04.002. [DOI] [PubMed] [Google Scholar]
20.Wang J, Sachpatzidis A, Christian TD, Lomakin IB, Garen A, and Konigsberg WH (2022). Insight into the Tumor Suppression Mechanism from the Structure of Human Polypyrimidine Splicing Factor (PSF/SFPQ) Complexed with a 30mer RNA from Murine Virus-like 30S Transcript-1. Biochemistry 61, 1723–1734. 10.1021/acs.biochem.2c00192. [DOI] [PubMed] [Google Scholar]
21.Knott GJ, Panjikar S, Thorn A, Fox AH, Conte MR, Lee M, and Bond CS (2016). A crystallographic study of human NONO (p54(nrb)): overcoming pathological problems with purification, data collection and noncrystallographic symmetry. Acta Crystallogr. D Struct. Biol 72, 761–769. 10.1107/S2059798316005830. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Lee PW, Marshall AC, Knott GJ, Kobelke S, Martelotto L, Cho E, McMillan PJ, Lee M, Bond CS, and Fox AH (2022). Paraspeckle subnuclear bodies depend on dynamic heterodimerisation of DBHS RNA-binding proteins via their structured domains. J. Biol. Chem 298, 102563. 10.1016/j.jbc.2022.102563. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Lee M, Sadowska A, Bekere I, Ho D, Gully BS, Lu Y, Iyer KS, Trewhella J, Fox AH, and Bond CS (2015). The structure of human SFPQ reveals a coiled-coil mediated polymer essential for functional aggregation in gene regulation. Nucleic Acids Res 43, 3826–3840. 10.1093/nar/gkv156. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Van Nostrand EL, Pratt GA, Shishkin AA, Gelboin-Burkhart C, Fang MY, Sundararaman B, Blue SM, Nguyen TB, Surka C, Elkins K, et al. (2016). Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat. Methods 13, 508–514. 10.1038/nmeth.3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Fox AH, Bond CS, and Lamond AI (2005). P54nrb forms a heterodimer with PSP1 that localizes to paraspeckles in an RNA-dependent manner. Mol. Biol. Cell 16, 5304–5315. 10.1091/mbc.e05-06-0587. [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Shindo N, Fuchida H, Sato M, Watari K, Shibata T, Kuwata K, Miura C, Okamoto K, Hatsuyama Y, Tokunaga K, et al. (2019). Selective and reversible modification of kinase cysteines with chlorofluoroacetamides. Nat. Chem. Biol 15, 250–258. 10.1038/s41589-018-0204-3. [DOI] [PubMed] [Google Scholar]
27.Yamane D, Onitsuka S, Re S, Isogai H, Hamada R, Hiramoto T, Kawanishi E, Mizuguchi K, Shindo N, and Ojida A (2022). Selective covalent targeting of SARS-CoV-2 main protease by enantiopure chlorofluoroacetamide. Chem. Sci 13, 3027–3034. 10.1039/d1sc06596c. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Yamane D, Tetsukawa R, Zenmyo N, Tabata K, Yoshida Y, Matsunaga N, Shindo N, and Ojida A (2023). Expanding the Chemistry of Dihaloacetamides as Tunable Electrophiles for Reversible Covalent Targeting of Cysteines. J. Med. Chem 66, 9130–9146. 10.1021/acs.jmedchem.3c00737. [DOI] [PubMed] [Google Scholar]
29.Rostovtsev VV, Green LG, Fokin VV, and Sharpless KB (2002). A stepwise Huisgen cycloaddition process: copper(I)-catalyzed regiose lective “ligation” of azides and terminal alkynes. Angew. Chem., Int. Ed. Engl 41, 2596–2599. . [DOI] [PubMed] [Google Scholar]
30.Tornoe CW, Christensen C, and Meldal M (2002). Peptidotriazoles on solid phase: [1,2,3]-triazoles by regiospecific copper(i)-catalyzed 1,3-dipolar cycloadditions of terminal alkynes to azides. J. Org. Chem 67, 3057–3064. 10.1021/jo011148j. [DOI] [PubMed] [Google Scholar]
31.Speers AE, Adam GC, and Cravatt BF (2003). Activity-Based Protein Profiling in Vivo Using a Copper(I)-Catalyzed Azide-Alkyne [3 + 2] Cycloaddition. J. Am. Chem. Soc 125, 4686–4687. 10.1021/ja034490h. [DOI] [PubMed] [Google Scholar]
32.Njomen E, Hayward RE, DeMeester KE, Ogasawara D, Dix MM, Nguyen T, Ashby P, Simon GM, Schreiber SL, Melillo B, and Cravatt BF (2024). Multi-tiered chemical proteomic maps of tryptoline acrylamide-protein interactions in cancer cells. Nat. Chem 16, 1592–1604. 10.1038/s41557-024-01601-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Vinogradova EV, Zhang X, Remillard D, Lazar DC, Suciu RM, Wang Y, Bianco G, Yamashita Y, Crowley VM, Schafroth MA, et al. (2020). An Activity-Guided Map of Electrophile-Cysteine Interactions in Primary Human T Cells. Cell 182, 1009–1026.e29. 10.1016/j.cell.2020.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Weerapana E, Wang C, Simon GM, Richter F, Khare S, Dillon MBD, Bachovchin DA, Mowen K, Baker D, and Cravatt BF (2010). Quantitative reactivity profiling predicts functional cysteines in proteomes. Nature 468, 790–795. 10.1038/nature09472. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Backus KM, Correia BE, Lum KM, Forli S, Horning BD, González-Páez GE, Chatterjee S, Lanning BR, Teijaro JR, Olson AJ, et al. (2016). Proteome-wide covalent ligand discovery in native biological systems. Nature 534, 570–574. 10.1038/nature18002. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Schwanhausser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, Chen W, and Selbach M (2011). Global quantification of mammalian gene expression control. Nature 473, 337–342. 10.1038/nature10098. [DOI] [PubMed] [Google Scholar]
37.Morgenstern C, Lastres-Becker I, Demirdöǧen BC, Costa VM, Daiber A, Foresti R, Motterlini R, Kalyoncu S, Arioz BI, Genc S, et al. (2024). Biomarkers of NRF2 signalling: Current status and future challenges. Redox Biol 72, 103134. 10.1016/j.redox.2024.103134. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Brennan MS, Matos MF, Richter KE, Li B, and Scannevin RH (2017). The NRF2 transcriptional target, OSGIN1, contributes to monomethyl fumarate-mediated cytoprotection in human astrocytes. Sci. Rep 7, 42054. 10.1038/srep42054. [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Feng L, Zhao K, Sun L, Yin X, Zhang J, Liu C, and Li B (2021). SLC7A11 regulated by NRF2 modulates esophageal squamous cell carcinoma radiosensitivity by inhibiting ferroptosis. J. Transl. Med 19, 367. 10.1186/s12967-021-03042-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Li S, Li Z, Shu FJ, Xiong H, Phillips AC, and Dynan WS (2014). Double-strand break repair deficiency in NONO knockout murine embryonic fibroblasts and compensation by spontaneous upregulation of the PSPC1 paralog. Nucleic Acids Res 42, 9771–9780. 10.1093/nar/gku650. [DOI] [PMC free article] [PubMed] [Google Scholar]
41.Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM, et al. (2012). Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393–1406. 10.1016/j.cell.2012.04.031. [DOI] [PubMed] [Google Scholar]
42.Gerstberger S, Hafner M, and Tuschl T (2014). A census of human RNA-binding proteins. Nat. Rev. Genet 15, 829–845. 10.1038/nrg3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Miura C, Shindo N, Okamoto K, Kuwata K, and Ojida A (2020). Fragment-Based Discovery of Irreversible Covalent Inhibitors of Cysteine Proteases Using Chlorofluoroacetamide Library. Chem. Pharm. Bull 68, 1074–1081. 10.1248/cpb.c20-00547. [DOI] [Google Scholar]
44.Tripathi A, Chhabra A, Rizvi S, and Tyagi RK (2025). Selective steroid receptor modulators, degraders and PROTACs: Therapeutic strategies in management of endocrine-related cancers. Mol. Cell. Endocrinol 605, 112569. 10.1016/j.mce.2025.112569. [DOI] [PubMed] [Google Scholar]
45.Liu L, Shi L, Wang Z, Zeng J, Wang Y, Xiao H, and Zhu Y (2022). Targeting Oncoproteins for Degradation by Small Molecule-Based Proteolysis-Targeting Chimeras (PROTACs) in Sex Hormone-Dependent Cancers. Front. Endocrinol 13, 839857. 10.3389/fendo.2022.839857. [DOI] [Google Scholar]
46.Aragao D, Aishima J, Cherukuvada H, Clarken R, Clift M, Cowieson NP, Ericsson DJ, Gee CL, Macedo S, Mudie N, et al. (2018). MX2: a high-flux undulator microfocus beamline serving both the chemical and macromolecular crystallography communities at the Australian Synchrotron. J. Synchrotron Radiat 25, 885–891. 10.1107/S1600577518003120. [DOI] [PMC free article] [PubMed] [Google Scholar]
47.Kabsch W (2010). Xds. Acta Crystallogr. D Biol. Crystallogr 66, 125–132. 10.1107/S0907444909047337. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Vagin A, and Teplyakov A (2010). Molecular replacement with MOLREP. Acta Crystallogr. D Biol. Crystallogr 66, 22–25. 10.1107/S0907444909042589. [DOI] [PubMed] [Google Scholar]
49.Collaborative Computational Project Number 4 (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallogr. D Biol. Crystallogr 50, 760–763. 10.1107/S0907444994003112. [DOI] [PubMed] [Google Scholar]
50.Emsley P, Lohkamp B, Scott WG, and Cowtan K (2010). Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr 66, 486–501. 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Afonine PV, Grosse-Kunstleve RW, Echols N, Headd JJ, Moriarty NW, Mustyakimov M, Terwilliger TC, Urzhumtsev A, Zwart PH, and Adams PD (2012). Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D Biol. Crystallogr 68, 352–367. 10.1107/S0907444912001308. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Moriarty NW, Grosse-Kunstleve RW, and Adams PD (2009). electronic Ligand Builder and Optimization Workbench (eLBOW): a tool for ligand coordinate and restraint generation. Acta Crystallogr. D Biol. Crystallogr 65, 1074–1080. 10.1107/S0907444909029436. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, and Zhang F (2014). Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Science 343, 84–87. 10.1126/science.1247005. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, Garcia MU, Di Tommaso P, and Nahnsen S (2020). The nf-core framework for community-curated bioinformatics pipelines. Nat. Biotechnol 38, 276–278. 10.1038/s41587-020-0439-x. [DOI] [PubMed] [Google Scholar]
55.Fulmer GR, Miller AJM, Sherden NH, Gottlieb HE, Nudelman A, Stoltz BM, Bercaw JE, and Goldberg KI (2010). NMR Chemical Shifts of Trace Impurities: Common Laboratory Solvents, Organics, and Gases in Deuterated Solvents Relevant to the Organometallic Chemist. Organometallics 29, 2176–2179. 10.1021/om100106e. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS2132231-supplement-4.xlsx^{(37.8MB, xlsx)}

NIHMS2132231-supplement-3.xlsx^{(6.4MB, xlsx)}

NIHMS2132231-supplement-2.pdf^{(2.1MB, pdf)}

NIHMS2132231-supplement-1.pdf^{(1.3MB, pdf)}

Data Availability Statement

Crystallographic data have been deposited at the Protein DataBank and are publicly available as of the date of publication. The PDB accession number is PDB: 9NZI and is listed in the key resources table. Proteomics data have been deposited at PRIDE and are publicly available as of the date of publication. The dataset identifier is PRIDE: PXD064685 and is listed in the key resources table. Processed proteomics data are provided in Data S2. RNA-seq data have been deposited at the NCBI Gene Expression Omnibus (GEO) and are publicly available as of the date of publication. The accession number is GEO: GSE299099 and is listed in the key resources table. Processed RNA-seq data are provided in Data S3. All other data reported in this study are available from the lead contact upon request.
This article does not report original code.
Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.

KEY RESOURCES TABLE

REAGENT or RESOURCES	SOURCE	IDENTIFIER
Antibodies
Rabbit anti- ESR1 Receptor	Cell Signaling Tech	Cat#:8644S; RRID: AB_2617128
RXRA Rabbit Poly Ab	Proteintech	Cat#: 21218-1-AP; RRID: AB_10693633
Mouse anti- NONO	BD Biosciences	Cat#: 611278; RRID: AB_398807
Rabbit anti- NONO	Bethyl Laboratories	Cat#: A300-587A; RRID: AB_495510
Anti-GAPDH HRP	Santa Cruz Biotechnology	Cat#: sc-47724 HRP; RRID: AB_3716894
Mouse anti- PSPC1	Sigma-Aldrich	Cat#: SAB4200503; RRID: N/A
Mouse anti- FLAG	Sigma-Aldrich	Cat#: F1804; RRID: AB_262044
HRP-labeled anti-mouse	Cell Signaling Tech	Cat#: 7076; RRID: AB_330924
HRP-labeled anti-rabbit	Cell Signaling Tech	Cat#: 7074; RRID: AB_2099233
Bacterial and virus strains
One Shot Stbl3 Chemically Competent E. coli	Thermo Scientific	Cat#: C737303
ccdB Survival T1	Invitrogen	Cat#: 11828029
Chemicals, peptides, and recombinant proteins
RPMI-1640 media	Corning	Cat#: 15-040-CV
DMEM media	Corning	Cat#: 15-013-CV
Glutamax	Life Technologies	Cat#: 35050061
Penicillin-Streptomycin	Lonza	Cat#: 17-603E
Fetal bovine serum	Omega Scientific	Cat#: FB-21
PEI MAX Linear MW 40,000	Polysciences	Cat#: 24765-1
RNAiMax	ThermoFisher	Cat#: 13778030
Fugene 6	Promega	Cat#: E2691
Polybrene	Santa Cruz	Cat#: 134220
Blasticidin	Fisher Scientific	Cat#: 50712728
Puromycin	Sigma-Aldrich	Cat#: P8833
Pierce ECL Western Blotting Substrate	ThermoFisher	Cat#: 32106
SuperSignal West Femto PLUS Chemiluminescent Substrate	ThermoFisher	Cat#: PI34095
Novex 10% Tris-Glycine Mini Gels	Life Technologies	Cat#: XP00105BOX
Nitrocellulose western blotting membrane, 0.45 mM	GE Healthcare Amersham	Cat#: 10600002
Complete+Ultra Mini EDTA-Free Protease Inhibitor Cocktail Tablets	Roche	Cat#: 05892791001
DMSO	Corning	Cat#: 25-950-CQC
Carbenicillin	Fisher	Cat#: NC0753434
Chloramphenicol	Sigma-Aldrich	Cat#: C0378
Spectinomycin	Sigma-Aldrich	Cat#: S4014
Desthiobiotin polyethyleneoxide iodoacetamide	Santa Cruz Biotechnology	Cat#: sc-300424
Urea	Fisher Scientific	Cat#: M1084871000
Iodoacetamide	Sigma-Aldrich	Cat#: I1149-25G
Dithiothreitol (DTT)	Fisher Bioreagents	Cat#: BP172-25
Tris(benzyltriazolylmethyl)amine (TBTA)	TCI	Cat#: T2993
Copper(II) sulfate, anhydrous	Sigma-Aldrich	Cat#: 451657-10G
Tris(2-carboxyethyl)phosphine HCl (TCEP)	Sigma-Aldrich	Cat#: 75259
Biotin-PEG4-azide	Chempep	Cat#: 271606
Sequencing grade modified trypsin	Promega	Cat#: V5111
Lys-C, Mass Spec Grade	Promega	Cat#: VA1170
Streptavidin agarose resin	Fisher Scientific	Cat#: 20353
Tween 20	Fisher Bioreagents	Cat#: BP337-500
Triton X-100	EMD Millipore	Cat#: TX1568
Nonidet P40 substitute (Igepal CA-630)	USB Corporation	Cat#: 19628
EPPS	Sigma-Aldrich	Cat#: E0276
Calcium carbonate	Fisher	Cat#: C77
SDS	Fisher	Cat#: BP166
K₂CO₃	Fisher	Cat#: P208
Triethylammonium bicarbonate buffer	Sigma-Aldrich	Cat#: T7408-500ML
TMT10plex^™	ThermoFisher	Cat#: 90406
TMTpro^™ 16plex tag	ThermoFisher	Cat#: A44520
Acetonitrile	VWR Intl	Cat#: BJAS017-0100
Hydroxylamine solution	Sigma-Aldrich	Cat#: 467804-10ML
Formic acid, ~98%, for mass spectrometry	Honeywell Fluka	Cat#: 94318-250ML-F
Bovine serum albumin	Sigma-Aldrich	Cat#: A2153
Sep-Pak C18 cartridges	Waters	Cat#: WAT054955
Spin Columns, Desalting, Pierce Peptide	ThermoFisher	Cat#: PI89852
Power Blotter Select Transfer Stacks. Nitrocellulose	Thermo Scientific	Cat#: PB3210
SuperSignal West Pico PLUS Chemiluminescent Substrate T	Thermo Scientific	Cat#: 34580
Extraction disks, C18 sorbent (for Stage-tip)	3M empore	Cat#:143863
Critical commercial assays
Micro BCA Protein Assay Kit	Thermo Scientific	Cat#: 23235
Cell Titer Glo	Promega	Cat#: 134220
Deposited data
Crystallography	This paper	PDB: 9NZI
Proteomics	This paper	PRIDE: PXD064685
RNA-Sequencing	This paper	GEO: GSE299099
Oligonucleotides
Primers used in this study	IDT	Methods below
Software and algorithms
MO.Affinity Analysis Software	Nanotemper	https://shop.nanotempertech.com/software/analysis-software/
MOLREP	Version 11.0/22.07.2010/	https://www.ccp4.ac.uk/html/molrep.html
CCP4 Suite	Version 9	https://www.ccp4.ac.uk/download/#os=macos
COOT	GTK4: 1.1.14	https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
PHENIX	Version 1.21	https://phenix-online.org/
RAW Converter	Version 1.1.0.22; 2004 release	http://fields.scripps.edu/rawconv/
Integrated Proteomics Pipeline (IP2) and ProLuCID	Integrated Proteomics Applications	http://goldfish.scripps.edu/
Prism (v10.4.1)	GraphPad Software	http://www.graphpad.com/scientific-software/prism/
STAR aligner (v2.7.9a)	Cold Spring Harbor Laboratory	https://github.com/alexdobin/STAR
R (v2025.05.0 + 496)	R Core Team	https://www.r-project.org/
Salmon (v1.3.0)	Stony Brook University	https://github.com/COMBINE-lab/salmon
DESeq2 (v1.30.1)	European Molecular Biology Laboratory	https://bioconductor.org/packages/release/bioc/html/DESeq2.html
Other
Quikchange	Agilent	Cat#: 200521
Gateway Vector Conversion System	Invitrogen	Cat#: 11828029
NEBNext Ultra RNA Library Prep	NEB	Cat#: E7770S
RNeasy Plus kit	QIAGEN	Cat#: 74034
QIAshredder columns	QIAGEN	Cat#: 79654
QIAprep Spin Miniprep kit	QIAGEN	Cat#: 27104
PierceTM BCA Protein Assay Kit	ThermoFisher	Cat#: 23225

Open in a new tab

[R1] 1.Licatalosi DD, and Darnell RB (2010). RNA processing and its regulation: global insights into biological networks. Nat. Rev. Genet 11, 75–87. 10.1038/nrg2673. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R2] 2.Hentze MW, Castello A, Schwarzl T, and Preiss T (2018). A brave new world of RNA-binding proteins. Nat. Rev. Mol. Cell Biol 19, 327–341. 10.1038/nrm.2017.130. [DOI] [PubMed] [Google Scholar]

[R3] 3.Gebauer F, Preiss T, and Hentze MW (2012). From cis-regulatory elements to complex RNPs and back. Cold Spring Harb. Perspect. Biol 4, a012245. 10.1101/cshperspect.a012245. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R4] 4.Kressler D, Hurt E, and Bassler J (2010). Driving ribosome assembly. Biochim. Biophys. Acta 1803, 673–683. 10.1016/j.bbamcr.2009.10.009. [DOI] [PubMed] [Google Scholar]

[R5] 5.Matera AG, Terns RM, and Terns MP (2007). Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nat. Rev. Mol. Cell Biol 8, 209–220. 10.1038/nrm2124. [DOI] [PubMed] [Google Scholar]

[R6] 6.Cooper TA, Wan L, and Dreyfuss G (2009). RNA and disease. Cell 136, 777–793. 10.1016/j.cell.2009.02.011. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R7] 7.Gebauer F, Schwarzl T, Valcárcel J, and Hentze MW (2021). RNA-binding proteins in human genetic disease. Nat. Rev. Genet 22, 185–198. 10.1038/s41576-020-00302-y. [DOI] [PubMed] [Google Scholar]

[R8] 8.Ratni H, Ebeling M, Baird J, Bendels S, Bylund J, Chen KS, Denk N, Feng Z, Green L, Guerard M, et al. (2018). Discovery of Risdiplam, a Selective Survival of Motor Neuron-2 (SMN2) Gene Splicing Modifier for the Treatment of Spinal Muscular Atrophy (SMA). J. Med. Chem 61, 6501–6517. 10.1021/acs.jmedchem.8b00741. [DOI] [PubMed] [Google Scholar]

[R9] 9.Xiang JS, Schafer DM, Rothamel KL, and Yeo GW (2024). Decoding protein-RNA interactions using CLIP-based methodologies. Nat. Rev. Genet 25, 879–895. 10.1038/s41576-024-00749-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R10] 10.Heindel AJ, Brulet JW, Wang X, Founds MW, Libby AH, Bai DL, Lemke MC, Leace DM, Harris TE, Hafner M, and Hsu KL (2023). Chemoproteomic capture of RNA binding activity in living cells. Nat. Commun 14, 6282. 10.1038/s41467-023-41844-z. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R11] 11.Mir C, Garcia-Mayea Y, and LLeonart ME (2022). Targeting the “undruggable”: RNA-binding proteins in the spotlight in cancer therapy. Semin. Cancer Biol 86, 69–83. 10.1016/j.semcancer.2022.06.008. [DOI] [Google Scholar]

[R12] 12.Julio AR, and Backus KM (2021). New approaches to target RNA binding proteins. Curr. Opin. Chem. Biol 62, 13–23. 10.1016/j.cbpa.2020.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R13] 13.Kathman SG, Koo SJ, Lindsey GL, Her HL, Blue SM, Li H, Jaensch S, Remsberg JR, Ahn K, Yeo GW, et al. (2023). Remodeling oncogenic transcriptomes by small molecules targeting NONO. Nat. Chem. Biol 19, 825–836. 10.1038/s41589-023-01270-0. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R14] 14.Takeiwa T, Ikeda K, Horie K, and Inoue S (2024). Role of RNA binding proteins of the Drosophila behavior and human splicing (DBHS) family in health and cancer. RNA Biol 21, 1–17. 10.1080/15476286.2024.2332855. [DOI] [Google Scholar]

[R15] 15.Knott GJ, Bond CS, and Fox AH (2016). The DBHS proteins SFPQ, NONO and PSPC1: a multipurpose molecular scaffold. Nucleic Acids Res 44, 3989–4004. 10.1093/nar/gkw271. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R16] 16.Passon DM, Lee M, Rackham O, Stanley WA, Sadowska A, Filipovska A, Fox AH, and Bond CS (2012). Structure of the heterodimer of human NONO and paraspeckle protein component 1 and analysis of its role in subnuclear body formation. Proc. Natl. Acad. Sci. USA 109, 4846–4850. 10.1073/pnas.1120792109. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R17] 17.Schell B, Legrand P, and Fribourg S (2022). Crystal structure of SFPQ-NONO heterodimer. Biochimie 198, 1–7. 10.1016/j.biochi.2022.02.011. [DOI] [PubMed] [Google Scholar]

[R18] 18.Knott GJ, Chong YS, Passon DM, Liang XH, Deplazes E, Conte MR, Marshall AC, Lee M, Fox AH, and Bond CS (2022). Structural basis of dimerization and nucleic acid binding of human DBHS proteins NONO and PSPC1. Nucleic Acids Res 50, 522–535. 10.1093/nar/gkab1216. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R19] 19.Clery A, Blatter M, and Allain FH (2008). RNA recognition motifs: boring? Not quite. Curr. Opin. Struct. Biol 18, 290–298. 10.1016/j.sbi.2008.04.002. [DOI] [PubMed] [Google Scholar]

[R20] 20.Wang J, Sachpatzidis A, Christian TD, Lomakin IB, Garen A, and Konigsberg WH (2022). Insight into the Tumor Suppression Mechanism from the Structure of Human Polypyrimidine Splicing Factor (PSF/SFPQ) Complexed with a 30mer RNA from Murine Virus-like 30S Transcript-1. Biochemistry 61, 1723–1734. 10.1021/acs.biochem.2c00192. [DOI] [PubMed] [Google Scholar]

[R21] 21.Knott GJ, Panjikar S, Thorn A, Fox AH, Conte MR, Lee M, and Bond CS (2016). A crystallographic study of human NONO (p54(nrb)): overcoming pathological problems with purification, data collection and noncrystallographic symmetry. Acta Crystallogr. D Struct. Biol 72, 761–769. 10.1107/S2059798316005830. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R22] 22.Lee PW, Marshall AC, Knott GJ, Kobelke S, Martelotto L, Cho E, McMillan PJ, Lee M, Bond CS, and Fox AH (2022). Paraspeckle subnuclear bodies depend on dynamic heterodimerisation of DBHS RNA-binding proteins via their structured domains. J. Biol. Chem 298, 102563. 10.1016/j.jbc.2022.102563. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R23] 23.Lee M, Sadowska A, Bekere I, Ho D, Gully BS, Lu Y, Iyer KS, Trewhella J, Fox AH, and Bond CS (2015). The structure of human SFPQ reveals a coiled-coil mediated polymer essential for functional aggregation in gene regulation. Nucleic Acids Res 43, 3826–3840. 10.1093/nar/gkv156. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R24] 24.Van Nostrand EL, Pratt GA, Shishkin AA, Gelboin-Burkhart C, Fang MY, Sundararaman B, Blue SM, Nguyen TB, Surka C, Elkins K, et al. (2016). Robust transcriptome-wide discovery of RNA-binding protein binding sites with enhanced CLIP (eCLIP). Nat. Methods 13, 508–514. 10.1038/nmeth.3810. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R25] 25.Fox AH, Bond CS, and Lamond AI (2005). P54nrb forms a heterodimer with PSP1 that localizes to paraspeckles in an RNA-dependent manner. Mol. Biol. Cell 16, 5304–5315. 10.1091/mbc.e05-06-0587. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R26] 26.Shindo N, Fuchida H, Sato M, Watari K, Shibata T, Kuwata K, Miura C, Okamoto K, Hatsuyama Y, Tokunaga K, et al. (2019). Selective and reversible modification of kinase cysteines with chlorofluoroacetamides. Nat. Chem. Biol 15, 250–258. 10.1038/s41589-018-0204-3. [DOI] [PubMed] [Google Scholar]

[R27] 27.Yamane D, Onitsuka S, Re S, Isogai H, Hamada R, Hiramoto T, Kawanishi E, Mizuguchi K, Shindo N, and Ojida A (2022). Selective covalent targeting of SARS-CoV-2 main protease by enantiopure chlorofluoroacetamide. Chem. Sci 13, 3027–3034. 10.1039/d1sc06596c. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R28] 28.Yamane D, Tetsukawa R, Zenmyo N, Tabata K, Yoshida Y, Matsunaga N, Shindo N, and Ojida A (2023). Expanding the Chemistry of Dihaloacetamides as Tunable Electrophiles for Reversible Covalent Targeting of Cysteines. J. Med. Chem 66, 9130–9146. 10.1021/acs.jmedchem.3c00737. [DOI] [PubMed] [Google Scholar]

[R29] 29.Rostovtsev VV, Green LG, Fokin VV, and Sharpless KB (2002). A stepwise Huisgen cycloaddition process: copper(I)-catalyzed regiose lective “ligation” of azides and terminal alkynes. Angew. Chem., Int. Ed. Engl 41, 2596–2599. . [DOI] [PubMed] [Google Scholar]

[R30] 30.Tornoe CW, Christensen C, and Meldal M (2002). Peptidotriazoles on solid phase: [1,2,3]-triazoles by regiospecific copper(i)-catalyzed 1,3-dipolar cycloadditions of terminal alkynes to azides. J. Org. Chem 67, 3057–3064. 10.1021/jo011148j. [DOI] [PubMed] [Google Scholar]

[R31] 31.Speers AE, Adam GC, and Cravatt BF (2003). Activity-Based Protein Profiling in Vivo Using a Copper(I)-Catalyzed Azide-Alkyne [3 + 2] Cycloaddition. J. Am. Chem. Soc 125, 4686–4687. 10.1021/ja034490h. [DOI] [PubMed] [Google Scholar]

[R32] 32.Njomen E, Hayward RE, DeMeester KE, Ogasawara D, Dix MM, Nguyen T, Ashby P, Simon GM, Schreiber SL, Melillo B, and Cravatt BF (2024). Multi-tiered chemical proteomic maps of tryptoline acrylamide-protein interactions in cancer cells. Nat. Chem 16, 1592–1604. 10.1038/s41557-024-01601-1. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R33] 33.Vinogradova EV, Zhang X, Remillard D, Lazar DC, Suciu RM, Wang Y, Bianco G, Yamashita Y, Crowley VM, Schafroth MA, et al. (2020). An Activity-Guided Map of Electrophile-Cysteine Interactions in Primary Human T Cells. Cell 182, 1009–1026.e29. 10.1016/j.cell.2020.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R34] 34.Weerapana E, Wang C, Simon GM, Richter F, Khare S, Dillon MBD, Bachovchin DA, Mowen K, Baker D, and Cravatt BF (2010). Quantitative reactivity profiling predicts functional cysteines in proteomes. Nature 468, 790–795. 10.1038/nature09472. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R35] 35.Backus KM, Correia BE, Lum KM, Forli S, Horning BD, González-Páez GE, Chatterjee S, Lanning BR, Teijaro JR, Olson AJ, et al. (2016). Proteome-wide covalent ligand discovery in native biological systems. Nature 534, 570–574. 10.1038/nature18002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R36] 36.Schwanhausser B, Busse D, Li N, Dittmar G, Schuchhardt J, Wolf J, Chen W, and Selbach M (2011). Global quantification of mammalian gene expression control. Nature 473, 337–342. 10.1038/nature10098. [DOI] [PubMed] [Google Scholar]

[R37] 37.Morgenstern C, Lastres-Becker I, Demirdöǧen BC, Costa VM, Daiber A, Foresti R, Motterlini R, Kalyoncu S, Arioz BI, Genc S, et al. (2024). Biomarkers of NRF2 signalling: Current status and future challenges. Redox Biol 72, 103134. 10.1016/j.redox.2024.103134. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R38] 38.Brennan MS, Matos MF, Richter KE, Li B, and Scannevin RH (2017). The NRF2 transcriptional target, OSGIN1, contributes to monomethyl fumarate-mediated cytoprotection in human astrocytes. Sci. Rep 7, 42054. 10.1038/srep42054. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R39] 39.Feng L, Zhao K, Sun L, Yin X, Zhang J, Liu C, and Li B (2021). SLC7A11 regulated by NRF2 modulates esophageal squamous cell carcinoma radiosensitivity by inhibiting ferroptosis. J. Transl. Med 19, 367. 10.1186/s12967-021-03042-7. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R40] 40.Li S, Li Z, Shu FJ, Xiong H, Phillips AC, and Dynan WS (2014). Double-strand break repair deficiency in NONO knockout murine embryonic fibroblasts and compensation by spontaneous upregulation of the PSPC1 paralog. Nucleic Acids Res 42, 9771–9780. 10.1093/nar/gku650. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R41] 41.Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM, et al. (2012). Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393–1406. 10.1016/j.cell.2012.04.031. [DOI] [PubMed] [Google Scholar]

[R42] 42.Gerstberger S, Hafner M, and Tuschl T (2014). A census of human RNA-binding proteins. Nat. Rev. Genet 15, 829–845. 10.1038/nrg3813. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R43] 43.Miura C, Shindo N, Okamoto K, Kuwata K, and Ojida A (2020). Fragment-Based Discovery of Irreversible Covalent Inhibitors of Cysteine Proteases Using Chlorofluoroacetamide Library. Chem. Pharm. Bull 68, 1074–1081. 10.1248/cpb.c20-00547. [DOI] [Google Scholar]

[R44] 44.Tripathi A, Chhabra A, Rizvi S, and Tyagi RK (2025). Selective steroid receptor modulators, degraders and PROTACs: Therapeutic strategies in management of endocrine-related cancers. Mol. Cell. Endocrinol 605, 112569. 10.1016/j.mce.2025.112569. [DOI] [PubMed] [Google Scholar]

[R45] 45.Liu L, Shi L, Wang Z, Zeng J, Wang Y, Xiao H, and Zhu Y (2022). Targeting Oncoproteins for Degradation by Small Molecule-Based Proteolysis-Targeting Chimeras (PROTACs) in Sex Hormone-Dependent Cancers. Front. Endocrinol 13, 839857. 10.3389/fendo.2022.839857. [DOI] [Google Scholar]

[R46] 46.Aragao D, Aishima J, Cherukuvada H, Clarken R, Clift M, Cowieson NP, Ericsson DJ, Gee CL, Macedo S, Mudie N, et al. (2018). MX2: a high-flux undulator microfocus beamline serving both the chemical and macromolecular crystallography communities at the Australian Synchrotron. J. Synchrotron Radiat 25, 885–891. 10.1107/S1600577518003120. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R47] 47.Kabsch W (2010). Xds. Acta Crystallogr. D Biol. Crystallogr 66, 125–132. 10.1107/S0907444909047337. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R48] 48.Vagin A, and Teplyakov A (2010). Molecular replacement with MOLREP. Acta Crystallogr. D Biol. Crystallogr 66, 22–25. 10.1107/S0907444909042589. [DOI] [PubMed] [Google Scholar]

[R49] 49.Collaborative Computational Project Number 4 (1994). The CCP4 suite: programs for protein crystallography. Acta Crystallogr. D Biol. Crystallogr 50, 760–763. 10.1107/S0907444994003112. [DOI] [PubMed] [Google Scholar]

[R50] 50.Emsley P, Lohkamp B, Scott WG, and Cowtan K (2010). Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr 66, 486–501. 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R51] 51.Afonine PV, Grosse-Kunstleve RW, Echols N, Headd JJ, Moriarty NW, Mustyakimov M, Terwilliger TC, Urzhumtsev A, Zwart PH, and Adams PD (2012). Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallogr. D Biol. Crystallogr 68, 352–367. 10.1107/S0907444912001308. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R52] 52.Moriarty NW, Grosse-Kunstleve RW, and Adams PD (2009). electronic Ligand Builder and Optimization Workbench (eLBOW): a tool for ligand coordinate and restraint generation. Acta Crystallogr. D Biol. Crystallogr 65, 1074–1080. 10.1107/S0907444909029436. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R53] 53.Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, and Zhang F (2014). Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Science 343, 84–87. 10.1126/science.1247005. [DOI] [PMC free article] [PubMed] [Google Scholar]

[R54] 54.Ewels PA, Peltzer A, Fillinger S, Patel H, Alneberg J, Wilm A, Garcia MU, Di Tommaso P, and Nahnsen S (2020). The nf-core framework for community-curated bioinformatics pipelines. Nat. Biotechnol 38, 276–278. 10.1038/s41587-020-0439-x. [DOI] [PubMed] [Google Scholar]

[R55] 55.Fulmer GR, Miller AJM, Sherden NH, Gottlieb HE, Nudelman A, Stoltz BM, Bercaw JE, and Goldberg KI (2010). NMR Chemical Shifts of Trace Impurities: Common Laboratory Solvents, Organics, and Gases in Deuterated Solvents Relevant to the Organometallic Chemist. Organometallics 29, 2176–2179. 10.1021/om100106e. [DOI] [Google Scholar]

PERMALINK

Structural and mechanistic analysis of covalent ligands targeting the RNA-binding protein NONO

Garrett L Lindsey

Thomas K Hockley

Alejandro Villa Gomez

Andrew C Marshall

William R Brothers

Colin T Finney

Jacob Gross

Archa H Fox

Gene W Yeo

Bruno Melillo

Charles S Bond

Benjamin F Cravatt

SUMMARY

Graphical abstract

In brief

INTRODUCTION

RESULTS

(R)-SKBG-1-NONO co-crystal structure

Figure 1. Structural characterization of (R)-SKBG-1-bound-NONO homodimer.

Chlorofluoroacetamides engage NONO with improved proteome-wide selectivity

Figure 2. Chlorofluoroacetamide (CFA) ligands stereoselectively and site-specifically engage NONO_C145.

Figure 3. CFA ligands target NONO with improved proteome-wide selectivity.

(R, R)-GL-373 exhibits NONO-restricted transcriptomic and growth effects in cancer cells

Figure 4. CFA ligands produce NONO-restricted transcriptomic and anti-proliferative effects in cancer cells.

DISCUSSION

Limitations of the study

RESOURCE AVAILABILITY

Lead contact

Materials availability

Data and code availability

STAR★METHODS

EXPERIMENTAL MODEL AND STUDY PARTICIPANT DETAILS

Cell lines

METHOD DETAILS

Crystallography

Microscale thermophoresis assay (MST)

Plasmid amplification and purification

Mutagenesis

Plasmids for stable expression

NONO knockout by CRISPR/Cas9

Generation of 22Rv1 NONO C-FLAG WT or C145S cell line

Western blot analysis

Gel-based ABPP

Cysteine-directed ABPP

HPLC fractionation

Protein-directed ABPP

High-pH spin column fractionation

TMT LC-MS analysis

Fusion instruments:

Eclipse Tribrid instrument:

MS data processing

Data analysis – Cysteine-directed ABPP

Data analysis – Protein-directed ABPP

RNA-seq – Sample preparation

RNA-seq – Library preparation with polyA selection and HiSeq sequencing

RNA-seq – Data processing and quantification

RNA-seq – Data analysis

Cell growth inhibition assays

Synthesis and characterization of compounds

General considerations

Synthesis of (-R, R)-GL-373

Lithium (R)-4-(tert-butoxycarbonyl)piperazine-2-carboxylate (S2)

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)piperazine-1-carboxylate (S3)

tert-butyl (R)-3-((4-methoxybenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S4)

(R)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S5)

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-methoxybenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-373)

Synthesis of stereoisomers of (R, R)-GL-373

Synthesis of alkyne-containing analogs of (R, R)-GL-373

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)piperazine-1-carboxylate (S6)

tert-butyl (R)-3-((4-ethynylbenzyl)carbamoyl)-4-((4-methoxyphenyl)sulfonyl)piperazine-1-carboxylate (S7)

(R)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl)piperazine-2-carboxamide (S8)

(R)-4-((R)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((R, R)-GL-586)

(S)-4-((S)-2-chloro-2-fluoroacetyl)-N-(4-ethynylbenzyl)-1-((4-methoxyphenyl)sulfonyl) piperazine-2-carboxamide ((S, S)-GL-586)

QUANTIFICATION AND STATISTICAL ANALYSIS

ADDITIONAL RESOURCES

Supplementary Material

Highlights.

SIGNIFICANCE.