Skip to main content
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Feb 19;63(4):e70441. doi: 10.1111/ejn.70441

Anatomical and Neuronal Distribution of the G‐Coupled Protein Receptor 75 mRNA in the Mouse Central Nervous System

Melanie K Becher 1,2, Tessa Knox 1, Kaela Wilson 1, Lawrence F Kromer 1,2, Italo Mocchetti 1,2,
PMCID: PMC12920073  PMID: 41714167

ABSTRACT

G‐protein coupled receptor (GPCR) 75 (GPR75) is a 540 amino acid member of the Gαq class of GPCRs, with no homology with other classic GPCRs. The current focus on GPR75 has centred on its potential role in metabolic disorders and cancer. GPR75 expression is abundant in the central nervous system (CNS) more so than in the peripheral tissues; however, much remains unknown about the distribution and role of this receptor throughout the CNS. In this study, we quantified GPR75 mRNA expression in the mouse CNS using RNAscope fluorescent in situ hybridization (FISH) technology, combined with immunohistochemistry (IHC) to detect GPR75 transcripts in specific neuronal cell types. GPR75 knockout (KO) mice were used as controls and specificity of hybridization. Our results show that GPR75 mRNA expression occurs in several neuronal populations including GABAergic and glutamatergic neurons. In select areas, such as the substantia nigra/ventral tegmental area, locus coeruleus and raphe nucleus, GPR75 mRNA is also highly expressed in monoaminergic neurons. Moreover, we found high expression of GPR75 mRNA in the cerebellum, in both GABAergic and glutamatergic neurons, suggesting a potential role for this receptor in motor/equilibrium activity. Indeed, GPR75 KO mice perform significantly better than wild‐type littermates on the rotarod test. Our data suggest that this receptor may play an important role in brain physiology and function.

Keywords: cerebellum, GABA, glutamate, GPR75, monoamines, rotarod


GPR75, a Gαq‐coupled receptor highly expressed in the CNS, shows distinct mRNA localization across multiple neuronal sub populations, including GABAergic, glutamatergic and monoaminergic neurons. Using RNAscope FISH combined with IHC, we mapped GPR75 expression throughout the mouse brain, revealing particularly high levels in the locus coeruleus and within Parvalbumin expressing neurons. Functionally, GPR75 knockout mice exhibited improved motor performance, suggesting a key role for this receptor in regulating brain physiology and motor control (created in BioRender. Lab, M. (2025) https://BioRender.com/lldqecp).

graphic file with name EJN-63-0-g001.jpg


Abbreviations

20‐HETE

eicosanoid 20‐hydroxyeicosatetraenoic acid

amyloid beta

AQ

cerebral aqueduct

CALB

calbindin

CNS

central nervous system

DA

dopamine

DRN

dorsal raphe nucleus

FISH

fluorescent in situ hybridization

GAD1

glutamic acid decarboxylase 1

GAPDH

glyceraldehyde‐3‐phosphate dehydrogenase

GPR75

G‐protein coupled receptor 75

IHC

immunohistochemistry

IP3

inositol triphosphate

KO

knockout

LC

locus coeruleus

NE

noradrenergic

P13K

phosphatidylinositol 3‐kinase

PCR

polymerase chain reaction

PFA

paraformaldehyde

PKB

phosphate kinase B

PV

parvalbumin

ROI

region of interest

SN

substantia nigra

TAE

tris‐acetate ethylenediaminetetraacetic acid

TH

tyrosine hydroxylase

TPH2

tryptophan hydroxylase 2

vGLUT1

vesicular glutamate transporter

VTA

ventral tegmental area

WT

C57BL/6N wild‐type

1. Introduction

G protein‐coupled receptors (GPCRs) are integral membrane proteins that recognize a wide variety of ligand signals including lipids, peptides, neurotransmitters and hormones. GPCRs are the most common cell surface receptors and are a vital component of multiple physiological processes including neurotransmission, cell growth, metabolism, hormonal control, immune system regulation (Calebiro et al. 2021), neurogenesis (Doze and Perez 2012) and synaptic plasticity (Gonzalez‐Hernandez et al. 2024). Both the molecular structure and physiological significance make these receptors attractive targets for therapeutic development, including drug therapies for neurodegenerative diseases and central nervous system (CNS) disorders. However, there are a number of GPCRs considered ‘orphan’ receptors because they lack a clearly defined function and the ligand(s) that they interact with remain unknown (Civelli et al. 2013).

One GPCR that is considered an orphan receptor is GPCR 75 (GPR75), a 540 amino acid member of the Gαq class of GPCRs, originally characterized for its expression in the human retina (Tarttelin et al. 1999; Sauer et al. 2001). There are two proposed ligands that are shown to activate GPR75, eicosanoid 20‐Hydroxyeicosatetraenoic acid (20‐HETE) (Garcia et al. 2017) and the chemokine CCL5/RANTES (Ignatov et al. 2006; Dedoni et al. 2018). GPR75 contains the characteristic seven transmembrane spanning domains, N‐glycosylation sites in the N‐terminus and several serine and threonine phosphorylation sites in the C‐terminus (Tarttelin et al. 1999). The activation of GPR75 initiates the well‐known signalling cascade of Gαq GPCRs, notably, increased levels of intracellular calcium, stimulation of inositol triphosphate (IP3), phosphatidylinositol 3–kinase (PI3K) and the downstream effector protein kinase B (PKB) (Ignatov et al. 2006; Dedoni et al. 2018).

Much of the current focus on GPR75 has centred on its potential role in metabolic disorders (Froogh et al. 2022; Dashti et al. 2023; Liu et al. 2013), including obesity (Akbari et al. 2021; Hossain et al. 2023; Leeson‐Payne et al. 2024; Powell et al. 2022) and cancer (Cardenas et al. 2023; Cardenas et al. 2020). However, GPR75 can also play a role in the central nervous system. In fact, we and others have reported GPR75 expression in the hippocampus in both mice (Speidell et al. 2023) and rats (Gonzalez‐Fernandez et al. 2020). Moreover, the removal of GPR75 alleles in mice induces an impairment in hippocampal‐dependent contextual memory tasks (Speidell et al. 2023). Others have shown that there is a specific polymorphism in the human GPR75 gene that has been shown to result in retinal degeneration (Sauer et al. 2001). This was replicated in mice where removal of GPR75 has a similar effect in retinal degeneration (Vasudevan et al. 2023), demonstrating an important role for this receptor in maintaining the health of cone photoreceptor cells. Lastly, GPR75 might have neuroprotective properties against the amyloid‐ß peptide (Aβ) (Ignatov et al. 2006), a hallmark of Alzheimer's disease (Stokin and Goldstein 2006). Thus, this receptor may play a role in various CNS functions.

In an effort to better understand the function of this receptor in the CNS, we mapped the expression of GPR75 mRNA throughout various regions of the mouse brain. Importantly, we analysed quantities of GPR75 mRNA expression using fluorescent in situ hybridization (FISH) combined with immunohistochemistry (IHC) to detect GPR75 transcripts colocalized with specific neuronal subtypes. We report that GPR75 mRNA expression in the CNS occurs in several neuronal populations.

2. Materials and Methods

2.1. Mice

All studies were carried out following the Guide for the Care and Use of Laboratory Animals as adopted by the US National Institutes of Health and approved by Georgetown University Institute for Animal Care and Use Committee under Protocol 2016‐1188. C57/BL6N mice were originally obtained from Charles River Laboratories (Frederick, MD, Strain #027). GPR75 knockout mice were generated by targeting the murine GPR75 locus using the CRISPR/Cas9 DNA editing technology as previously described (Speidell et al. 2023). Genotype was verified by DNA sequencing.

Mice were maintained at the Research Resource Facility at Georgetown University Medical Center in the Division of Comparative Medicine. Mice used for this study were housed with their littermates, with approximately two to five mice per cage and were kept on a 12‐h light–dark cycle (06:00–18:00). Purina rodent chow #5001 (Purina Animal Nutrition LLC., Summit, MO) and Hydropac purified water (Lab Products Inc., Rockville, MD) were available ad libitum throughout the entire study. Both adult male and female mice ranging from 3 to 5 months of age were used throughout the study. No animals were excluded for health reasons during this study. Experimental mice were euthanized in the intraperitoneal injection of 300/30 mg/kg ketamine (Cat. No. 5700864, Henry Schein Inc., Melville, NY) and xylazine (Cat. No. 59399‐110‐20, Akorn Pharmaceuticals, Lake Forest, IL) mixture followed by intracardial perfusion of ice‐cold phosphate buffered saline (PBS).

2.2. Polymerase Chain Reaction (PCR)

Tissue samples for PCR were immediately frozen following dissection and stored at −80°C until homogenization and downstream analysis. mRNA from tissue was isolated and purified using NucleoSpin RNA (Machery‐Nagel, Cat. No. 740955.50) RNA purification kit. Between 0.01 and 2 μg of RNA was used for the reverse transcription reaction using SuperScript VILO Master Mix with ezDNase Enzyme Kit (Thermo Fisher Scientific, Waltham, MA, Cat. No. 11766050). Primers for GPR75 mRNA were 5′‐atcgtgttgtcagtcctggtg‐3′ (forward) and 5′‐ggctttctctgctgcaaacag‐3′ (reverse) and the housekeeping gene glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), 5′‐accacagtccatgccatcactgccac‐3′ (forward) and 5′‐aggtccaccaccctgttgctgtagcc‐3′ (reverse) (Integrated DNA Technologies, Coralville, IA). Reverse transcriptase reaction for cDNA was performed with SuperScript VILO cDNA Synthesis Kit (Cat. No. 11754050). Using a Taq polymerase (2X concentrate mastermix, New England Biolabs, Ipswich, MA, Cat. No. M02070S), 1000 ng of cDNA was amplified. Unless otherwise stated, the PCR cycle consisted of 30 cycles for amplification: 95°C for 30 s, 62°C for 30 s and 68°C for 1 min, followed by 68°C for 5 min. The PCR products were run on a 1% Ultrapure agarose gel (Invitrogen, Carlsbad, CA, cat. No. 16500‐500) in 1× Tris‐acetate‐ethylenediaminetetraacetic acid (TAE) buffer and analysed using SYBR Safe DNA Gel Stain (Invitrogen, Cat. No. S33102) for visualization with UV light. Quantification of transcript per brain area and organ type was carried out using densitometry analysis in ImageJ2 (Version 2.14.0/1.54f) as a ratio of band density compared to the GAPDH housekeeping gene.

2.3. RNAscope Fluorescent In Situ Hybridization (FISH) and Immunohistochemistry (IHC)

RNAscope was performed with Fluorescent Detection Kit v2 (Advanced Cell Diagnostics Inc., Newark, CA, Cat. No. 323110), according to the manufacturer's pretreatment and assay protocol for formalin‐fixed paraffin‐embedded tissue, as previously described (Speidell et al. 2023). In brief, CNS tissue was preserved in 4% paraformaldehyde (PFA) containing 4% sucrose at 4°C for 24 h immediately following dissection. Subsequently, tissue was transferred to a 10% sucrose solution at 4°C for 24 h, followed by increasing gradients of 20% and 30% sucrose at 4°C for 24 h each, and then, samples were frozen for cryostat sectioning. Fixed‐frozen brain tissue was sectioned at 18 μm and stored at −80°C prior to further analysis. Anatomical structures were analysed in coronal sections and mapped according to the Allen Mouse Brain Atlas from the Allen Institute for Brain Science (available from mouse.brain‐map.org). For the present studies, the colocalization of GPR75 FISH staining within specific neuronal subtypes by IHC was performed on frozen cryostat sectioned tissue.

The probes for mouse GPR75 and glutamic acid decarboxylase 1 (GAD1) mRNA were purchased from Advanced Cell Diagnostics Inc. (Cat. Nos. 318281 and 400951, respectively). The amplification steps were performed according to the manufacturer's directions. Opal Dye 570 (Akoya Biosciences, Marlborough, MA, Cat. No. FP1488001KT) and Opal Dye 520 (Akoya Biosciences, Marlborough, MA, Cat. No. FP1487001KT) were used for visualization as previously described (Speidell et al. 2023).

After FISH, IHC was performed on the same sections to achieve a dual FISH‐IHC stain. Antibodies include, Tyrosine Hydroxylase, 1:500 (Novus Biologicals, Centennial, CO, Cat. No. NB300‐110); Parvalbumin, 1:50 (Invitrogen, Cat. No. PA5‐96209); Calbindin, 1:200 (ThermoFisher Scientific, Cat. No. PA5‐85669); Tryptophan Hydroxylase 2, 1:250 (ThermoFisher Scientific, Cat. No. PA1‐778); vesicular Glutamate Transporter 1; and 1:100 (ThermoFisher Scientific, Cat. No. 48‐2400). Secondary antibodies include Alexa‐Fluor 594, 1:500 (Invitrogen, Cat. No. A11012) or Alexa‐Fluor 647, 1:1000 (Invitrogen, Cat. No. A1108).

2.4. Image Acquisition

Imaging for quantification of GPR75 mRNA puncta was conducted in the Microscopy and Image Shared Resource facility at Georgetown University using the Leica SP8 AOBS confocal microscope (Leica Microsystems, Deerfield, IL). Images were collected using three channels (DAPI, Cy3 and AF594/AF647) at 40× (oil immersion) magnification and at 1024 × 1024 pixels (290.62 × 290.62 μm). A z stack of five pictures, 0.5 μm each, for a total depth of 2.5 μm, was taken from the specific regions of interest (ROIs). Within each ROI, three to five separate z‐stack images were obtained. Images were exported and compressed as TIFF files.

2.5. GPR75 mRNA Puncta Quantification

In order to conduct quantitative analysis of GPR75 mRNA, raw TIFF images were processed with FIJI/ImageJ (Version 2.14.0/1.54f) software (Schneider et al. 2012). Two separate analyses were conducted with the acquired FISH/IHC images. First, quantification of the total puncta within the ROI was automated using a macrocode, Puncta Count: All z‐stack images were uploaded, stacked into a single image using Max Intensity and channels split into individual images. The channel that includes DAPI, identifying nuclei, was blurred using ‘Gaussian Blur’ at a sigma of 2. An appropriate threshold was set and recorded using Otsu thresholding to include all areas of true positivity. A threshold was also set for the FISH puncta channel. Once the threshold was set for each channel, the Analyze Particles function was used to quantify both puncta within the whole image and DAPI area.

To account for differences in cell density across brain regions, puncta counts were normalized to the total DAPI‐positive area within each field of view (puncta per DAPI area). Next, to assess receptor mRNA density within specific neuronal populations, quantification of puncta within IHC positive (GPR75 mRNA colocalization) areas was conducted with a similar macro code and was adjusted to include immuno‐positive regions (IHC staining) instead of DAPI. GPR75 mRNA quantification was restricted to FISH puncta only within IHC positive regions, whereas puncta outside of the IHC‐labelled region were excluded. Puncta counts were then normalized to the total IHC positive area to account for differences in neuronal marker expression throughout different brain areas.

2.6. Animal Behaviour

Mice in the study were either C57BL/6N wild‐type mice or GPR75 knockout mice. Mice were aged at least 14 weeks prior to any behavioural testing. Mice were acclimated to handling daily for 1 week prior to the start of testing. Mice were transferred from their home room to the testing room and habituated for 30 min prior to testing. All mice were tested between 12:00 and 17:00, aligning with their light–dark cycle. These measures were carried out within a 6‐week timespan in the following order.

  1. Open field test: Mice were aged 14–20 weeks throughout the duration of the experiment. The open field test (Cat. No. ENV‐258 T, Med Associates Inc.) consisted of a square chamber with a white surface and moderate light, ensuring that shadows were not present, and a camera above the testing chamber to track the movement of rodents through Anymaze (Stoelting Co., Wood Dale. IL). Mice were put inside the testing chamber and allowed to roam freely for 10 min. In the apparatus, two measures were assessed: total distance travelled and average speed travelled.

  2. Rotarod: Mice were aged 14–20 weeks throughout duration of experiment. The rotarod (Ugo Basile, Cat. No. 47650) consisted of a rotating rod, a power source and small chambers beneath the rod that the mice could fall into. All animals were pretrained on the rod for 1 min at a constant 10 rpm and given a 2‐min rest break in their home cage before testing began. Mice were then tested with three separate trials, each trial lasting 6 min, in which the rod would ramp up from 5 to 80 rpm over the 6‐min time course. Each trial concluded when the rodent either fell off the rod or was stopped if the rodent clung onto the rod for one full revolution, and latency to fall was recorded in seconds. In between each trial, rodents were given a 10‐min break in their home cage.

  3. Running wheel: The mice were aged between 25 and 30 weeks throughout the duration of this experiment. All mice were single housed with ad libitum access to the running wheel. The running wheel (Cat. No. ENV‐047, Med Associates Inc.) consisted of a small wheel with a Bluetooth piece embedded in the wheel, which allows for tracking. Wheels were wirelessly connected to a computer that tracked the wheel movement through the Wheel Analysis software (Cat. No. SOF‐861, Med Associates Inc.). The Wheel Analysis tracked whenever the mouse used the wheel and calculated the equivalent distance that the mice have travelled on the wheel. Mice were given access to the wheel for 8 days.

2.7. Statistical Analysis

All statistical analyses were performed using GraphPad Prism v10.3.1 (GraphPad Software; San Diego, CA) and/or Microsoft Excel (Microsoft Office; Redmond, WA).

3. Results

3.1. GPR75 mRNA Is Predominantly Expressed in the CNS

We have previously established that GPR75 mRNA is abundant in neurons of the mouse hippocampus (Speidell et al. 2023). However, a specific and comprehensive CNS analysis of GPR75 mRNA expression is lacking. Thus, we first sought to confirm the presence and relative levels of GPR75 mRNA by comparing different areas of the CNS and peripheral tissues by PCR analysis. We observed the expected 234‐bp size of the GPR75 amplicon in WT tissue samples, and no band was detected in the GPR75 KO sample (Figure 1A). All analysed CNS areas express GPR75 mRNA; however, there are clear fluctuations in the amount of expression, especially when comparing between brain areas and spinal cord (Figure 1B). Further, GPR75 mRNA expression is significantly higher in the CNS when compared to peripheral tissues, such as spleen, kidney and heart (Figure 1C), and follows a pattern similar to that previously described in the Human Protein Atlas.

FIGURE 1.

FIGURE 1

GPR75 mRNA is predominantly expressed in the CNS compared to peripheral tissues. (A) A representative PCR gel product showing the expected size (234 bp) of the GPR75 amplicon in WT mice. Tissue samples from GPR75 KO mice and samples with no reverse transcriptase (RT) were used as negative controls. GAPDH was used as a housekeeping gene to provide the baseline for semiquantitative analysis. CB, cerebellum; Hyp, hypothalamus; Thal, thalamus. (B) Semiquantitative analysis of GPR75 mRNA levels expressed as arbitrary units, calculated by the densitometric scanning of the GPR75 mRNA band divided by that of GAPDH mRNA. Each data point represents one animal, N = 3. (C) GPR75 mRNA levels are significantly higher in the central nervous system when compared to peripheral areas. Each dot represents the average from seven different brain areas. ****p < 0.001, two‐tailed unpaired t test.

3.2. Semiquantitation of GPR75 mRNA by In Situ Hybridization

PCR does not allow for an in‐depth analysis of GPR75 mRNA expression at cellular levels. Thus, we analysed several areas of the brain by fluorescent RNAscope in situ hybridization (FISH), where mRNA is visualized as fluorescent puncta over DAPI positive nuclei (Figure 2A). Brain sections from GPR75 KO mice were used as control for potential experimental artefacts (Figure 2A). FISH analysis of GPR75 mRNA puncta counts normalized to DAPI positive area revealed GPR75 mRNA expression in all brain regions examined. Analysis of puncta revealed that the pons contained the highest levels of GPR75 mRNA compared to the other brain areas (Figure 2B). Furthermore, as previously demonstrated, most puncta were confined to NeuN positive cells (data not shown), confirming that GPR75 is mostly expressed by neurons (Speidell et al. 2023).

FIGURE 2.

FIGURE 2

GPR75 mRNA expression varies by region in the mouse brain. (A) Example of sections through the hypothalamus (Hyp) from the WT and GPR75 KO mice in which GPR75 puncta (green) are visualized by FISH. Images were thresholded and binarized to enhance puncta detection and illustrate their spatial distribution relative to DAPI‐stained nuclei (blue). Scale bar = 75 μm. (B) Semiquantitative analysis of GPR75 mRNA across different brain areas. Relative quantity was determined by normalizing puncta to DAPI area to account for differences in cell density across brain regions. Each dot within the bars denotes the normalized number of puncta per section (three to five DAPI areas per section, from three brain sections each animal). N = 3 mice each genotype for this analysis.

3.2.1. GPR75 mRNA Is Expressed in GABAergic and Glutamatergic Neuron Subpopulations

To gain further insight into the potential functional roles of GPR75 in the brain, we examined colocalization of GPR75 mRNA with specific neuronal subpopulations. For this, we performed dual FISH‐IHC, using a published protocol (Speidell et al. 2023). Analysis of the coronal sections through the telencephalon (Figure 3A) revealed that several sections of the cerebral cortex, especially motor and somatosensory cortices, contained GPR75 mRNA in cells expressing glutamate decarboxylase 1 (GAD1), the gene that encodes for glutamic acid decarboxylase 67, the enzyme that produces GABA (Figure 3D) and parvalbumin (PV), which is a common marker for a major subtype of GABAergic interneurons of the cortex (Figure 3B). GPR75 mRNA puncta were also identified in PV+ cells within the striatum (Figure 3C), suggesting expression of this receptor in striatal GABAergic spiny neurons. No hybridization was observed in cortical sections from GPR75 KO mice (Figure 3E).

FIGURE 3.

FIGURE 3

GPR75 mRNA in the telencephalon. (A) Drawing of the anatomical areas from a mouse brain atlas analysed for GPR75 mRNA puncta. (B, D) Representative coronal sections (from three animals) of the primary motor cortex (MO) and primary somatosensory area (SSA), respectively, showing colocalization of GPR75 mRNA (green puncta) within parvalbumin (PV) positive neurons and glutamate decarboxylase 1 (GAD1) mRNA, respectively (red). (C) Representative coronal section from the striatum (STR) showing GPR75 mRNA (green puncta) colocalized with PV positive cells (red). (E) Representative section of the MO from GPR75 KO mice. DAPI (blue) was used to identify cell nuclei. The scale bar is equal to 75 μm unless otherwise noted.

We next analysed diencephalic areas, such as the hippocampus (Figure 4A), hypothalamus and thalamus (Figure 5A). In the hippocampus, GPR75 mRNA was also observed in GAD1 positive neurons throughout this brain area (Figure 4B). Sections from GPR75 KO mice did not exhibit GPR75 puncta (Figure 4D). In addition, GPR75 puncta were localized in PV (data not shown) and calbindin (CALB) positive cells in the CA1 region (Figure 4C), suggesting that this subpopulation of hippocampal inhibitory interneurons and glutamatergic neurons also express GPR75 mRNA (Yang et al. 2018). In both the hypothalamus and thalamus (Figure 5A), GPR75 mRNA was detected in GAD1 positive neurons (Figure 5B,C), throughout these areas, and, in particular, in the lateral hypothalamus and reticular nucleus of thalamus, supporting the notion that this receptor is expressed by GABAergic neurons in various brain areas. No puncta were observed in sections from GPR75 KO mice (Figure 5D).

FIGURE 4.

FIGURE 4

GPR75 mRNA is densely expressed throughout the hippocampus. (A) Drawing of the coronal sections utilized for FISH‐IHC analysis. (B) Representative coronal section (from three animals) of the CA1 region of the hippocampus showing colocalization of GPR75 mRNA (green puncta) within GAD1 mRNA positive cells (red). (C) CA1 region showing GPR75 mRNA (green puncta) colocalizing with CALB immunoreactive cells (red). (D) Representative section of the hippocampus from GPR75 KO mice showing no GPR75 puncta. DAPI (blue) was used to detect nuclei. The scale bar is equal to 75 μm unless otherwise noted.

FIGURE 5.

FIGURE 5

GPR75 mRNA in the hypothalamus and thalamus. (A) Drawing of the coronal sections utilized for FISH‐IHC analysis. (B, C) Representative coronal section (from three animals) of the lateral hypothalamus (LH) and the reticular nucleus (RT) of the thalamus, respectively, showing colocalization of GPR75 mRNA (green puncta) within GAD1 positive cells (red). (D) Representative section of the thalamus from GPR75 KO mice showing no GAD1 puncta but no GPR75 mRNA. DAPI (blue) was used to detect nuclei. The scale bar is equal to 75 μm unless otherwise noted.

In the cerebellum (Figure 6A), GPR75 mRNA was detected in PV positive Purkinje neurons (Figure 6B), which represent the major GABAergic inhibitory neurons of the cerebellum. Moreover, we detected GPR75 mRNA also in the granule cell layer, associated with glutamatergic neurons as identified with an antibody against the vesicular glutamate transporter, VGLUT1 (Figure 6C). Overall, these data provide evidence that GPR75 mRNA is expressed by both inhibitory and excitatory neurons.

FIGURE 6.

FIGURE 6

GPR75 mRNA is expressed in both Purkinje and granule cell layers of the cerebellum. (A) Drawing of the region of the cerebellum (CB) utilized to prepare coronal sections. (B, C) Examples of coronal sections (from three animals) analysed with FISH‐IHC to detect GPR75 mRNA transcripts (green puncta), in PV positive cells in the Purkinje layer (B, red) and VGLUT1 positive cells (C, red) in the granule cell layer. Cell nuclei were stained with DAPI (blue). The scale bar is equal to 75 μm unless otherwise noted.

3.2.2. GPR75 mRNA Is Expressed in Monoamine Neurons

FISH‐IHC analysis of additional brain areas revealed abundant GPR75 mRNA expression in monoamine neurons as well. For instance, we found GPR75 mRNA expression within tyrosine hydroxylase (TH) positive cells, in both the substantia nigra (SN) /ventral tegmental area (VTA) (Figures 7A,B) and Locus Coeruleus (LC) (Figure 8A,B), indicating that GPR75 mRNA is expressed in dopaminergic (DA) and noradrenergic (NE) neurons, respectively. No GPR75 puncta were detected in GPR75 KO mice (Figure 8C). Moreover, we found CALB positive cells within the VTA also express GPR75 mRNA (Figure 7C). These neurons are known to corelease dopamine and glutamate into the nucleus accumbens. These data suggest that GPR75 might play a role in DA and NE transmission.

FIGURE 7.

FIGURE 7

GPR75 transcripts are localized in both dopaminergic and nondopaminergic neurons in the SN‐VTA region. (A) An overview of a coronal section (4X) of the midbrain stained for TH immunoreactivity (red). (B) Coronal section through the SN analysed for GPR75 mRNA (green) and TH immunoreactivity (red) by FISH‐IHC. (C) Coronal section throughout the VTA showing GPR75 mRNA puncta (green) in CALB positive cells (red). DAPI (blue) was used to identify nuclei. GPR75 KO sections of the SN‐VTA confirmed the absence of GPR75 mRNA (not shown). The scale bar is equal to 75 μm unless otherwise noted. N = 3.

FIGURE 8.

FIGURE 8

The noradrenergic neurons in the LC express GPR75 mRNA. (A) Drawing of the anatomical region through the pons utilized to prepare coronal sections for FISH‐IHC analysis. (B) Example of a section from the LC in the pons (from three animals) stained with a TH antibody (red) showing colocalization of GPR75 puncta (green + red = yellow) in the LC. Cell nuclei were stained with DAPI (blue). (C) Representative section of the pons from GPR75 KO mice. The scale bar is equal to 75 μm unless otherwise noted.

To examine whether serotonergic neurons also express GPR75 mRNA, we analysed colocalization of GPR75 mRNA in tryptophan hydroxylase 2 (TPH2) positive cells in the dorsal raphe nucleus (DRN) ventral to the cerebral aqueduct, within the brainstem (Figure 9A). TPH2 is the rate‐limiting enzyme for the synthesis of serotonin (Zhang et al. 2005). We detected GPR75 mRNA in the DRN area (Figure 9B) in TPH‐2 expressing cells (Figure 9C), suggesting expression of the transcript in serotonergic neurons as well.

FIGURE 9.

FIGURE 9

GPR75 mRNA is expressed by serotonergic neurons. (A) Drawing of the brain area utilized to prepare coronal sections. (B) Example of a section (five sections from three animals) from the Dorsal Raphe Nucleus (DRN), showing presence of GPR75 mRNA puncta (green) within this area. AQ, cerebral aqueduct. (C) Example of a section stained with a TPH2 antibody (red) and analysed by FISH‐IHC to detect GPR75 puncta within TPH2 neurons (merge, yellow puncta). Cell nuclei were stained with DAPI (blue). The scale bar is equal to 75 μm unless otherwise noted. Sections through the DRN from GPR75 KO mice confirm the absence of GPR75 mRNA (not shown).

We then compared the number of puncta across different neuronal populations. Analyses of puncta in all subpopulations of neurons examined revealed that PV positive neurons express more GPR75 mRNA than other neuronal populations (Figure 10).

FIGURE 10.

FIGURE 10

GPR75 mRNA expression varies among different neuronal populations. Semiquantitative analysis of GPR75 mRNA puncta across several different neuronal populations reveals a fluctuation in amount of GPR75 mRNA depending on the neuron subtype. Results reveal that PV positive neurons contain higher levels of GPR75 mRNA compared to Calbindin, TH and TPH2 neurons. Relative quantity of puncta colocalization is expressed in arbitrary units (AU) obtained by normalizing puncta to immunoreactive area. Each dot within the bars denotes the normalized quantity of puncta per brain section (three to five areas per section, three brain sections per animal). N = 3 mice for this analysis. *p < 0.01, **p < 0.001, two‐tailed unpaired t test.

3.3. GPR75KO Mice Display Increased Performance on Motor Activities Modulated by the Cerebellum

Due to high expression of GPR75 mRNA in brain areas controlling movement, we hypothesized that lack of GPR75 would impact basal ganglia or cerebellar‐modulated behaviours. We first examined motor behaviour with the open field test between our two different genotypes. We compared the total distance travelled and the average speed across the C57BL/6N (WT) and the GPR75KO mice. Within the 10‐min testing window, when comparing total distance travelled, no significant difference was observed (two‐tailed Welch's t test, p = 0.1025) between the two genotypes of mice (Figure 11A). We also examined average speed between WT and KO mice and observed no difference (Figure 11B) (two‐tailed Welch's t test, p = 0.7807).

FIGURE 11.

FIGURE 11

Motor activity in WT and GPR75 KO. Open field was used to determine average speed (A) and total distance (B) in WT and GPR75 (KO) mice (n = 7 each) for 10‐min sessions. (C) In the rotarod test, data are the average of three trials. Please note that GPR75 KO mice exhibited the longest duration in maintaining balance on the rotarod compared to WT littermates (n = 10, each). Both males and females were used. *p < 0.01, two‐tailed unpaired t test.

To further examine motor activity, we subjected mice (aged 14–20 weeks) to the rotarod test, which examines motor coordination and equilibrium. Results were averaged across three trials, and the motor activity of mice was assessed by the amount of time the mice remained on the rotating rod. Across the three trials, GPR75KO mice exhibited a significant increase in the time on the rod (two‐tailed Welch's t test, p = 0.0252) as compared to WT mice (Figure 11C). To rule out the contribution of basal ganglia dysfunction, the same cohort of mice that were used for the rotarod test (aged 25–30 weeks) was subjected to the running wheel (Figure S1). Mice were housed individually and allowed ad libitum access to the running wheel for 8 days. Across the 8 days, there was no significant difference in total distance travelled between GPR75KO and our WT mice (two‐tailed Welch's t test, p = 0.3476). Although a contribution of the basal ganglia to the observed motor activity differences cannot be excluded, our results indicate that removal of GPR75 is associated with significant enhancement of cerebellum‐dependent function and equilibrium.

4. Discussion

Despite the high expression of GPR75 in the brain, little is known about its function or regulation. Our previous work demonstrated that GPR75 is expressed mainly in neurons throughout the hippocampus, including areas CA1 through CA4 (Speidell et al. 2023). Furthermore, behavioural analyses of GPR75 KO mice have revealed that GPR75 may play a role in contextual memory and anxiety‐like behaviours (Speidell et al. 2023), which are typically associated with hippocampal function. In an effort to expand our knowledge on the potential functions of GPR75 outside the hippocampus, we have used FISH targeting GPR75 mRNA, followed by IHC to localize several different neuronal subtypes that express this receptor throughout the CNS. We report that GPR75 mRNA is differentially expressed in several CNS areas, with PV positive neurons having the highest levels of GPR75 mRNA. Moreover, in comparison to peripheral tissues, the brain contains significantly more GPR75 mRNA. Thus, in addition to general metabolism, as suggested by other researchers in the field (Akbari et al. 2021; Hossain et al. 2023), this receptor could have a role in neuronal function.

Our data show that GPR75 mRNA is expressed by GABAergic interneurons in multiple areas throughout the brain. GPR75 mRNA was detected in the cerebellum, localized to the Purkinje cell layer. Purkinje cells are GABAergic neurons that provide an inhibitory tone to the deep cerebellar nuclei that play a role in motor movement regulation, balance control and learned skill movements (Kim et al. 2024; Lalonde and Strazielle 2019; Lalonde and Strazielle 2003). Thus, GPR75 could have a role in gait coordination and motor learning. Moreover, we report that GPR75 mRNA is also expressed by non‐GABAergic neurons. For instance, in the cerebellum, GPR75 mRNA was also localized in the granule cell layer in glutamatergic neurons identified by a VGLUT1 antibody. Thus, consistent with this distribution, GPR75 could play a possible role in cerebellar function by modulating GABA/glutamate homeostasis.

GPR75 mRNA was also detected in DA neurons of the SN and VTA, with similar expression levels in both regions. However, the VTA is more heterogeneous than the SN. The VTA is composed of 60% TH+ neurons, 30%–35% of GABAergic neurons and 5% of glutamatergic neurons (Trutti et al. 2019). Thus, it was not surprising to find GPR75 puncta localized to CALB positive neurons. These neurons in the VTA, in addition to GABA, corelease dopamine and glutamate onto the nucleus accumbens (Barbano et al. 2024; Miranda‐Barrientos et al. 2021). SN and VTA play a critical and complex role in a wide range of behaviours, from motor control (Engelhard et al. 2019; Gaertner et al. 2022) to reward learning (Brown et al. 2012; van Zessen et al. 2012; Yang et al. 2023). Thus, expression within these areas suggests an additional role of GPR75 in these aforementioned behaviours. Additionally, CALB‐expressing neurons are known to be less vulnerable to degeneration in animal models of Parkinson's Disease (Yuan et al. 2013; del Rey et al. 2024). Thus, GPR75 may be neuroprotective as previously suggested (Ignatov et al. 2006; Speidell et al. 2023).

We have also identified dense GPR75 mRNA puncta in the NE cell bodies within the LC, suggesting a potential important role of GPR75 in the central NE system. The NE system has many functions, including long‐term synaptic plasticity (Hansen and Manahan‐Vaughan 2015), control of local blood flow and energy homeostasis (Bekar et al. 2012), the sleep cycle (Kjaerby et al. 2022), attention (Aston‐Jones et al. 2000) and stress responses (Grueschow et al. 2021). Considerable evidence suggests that alterations in NE neurotransmission, which modulate amygdala activity, may contribute to the manifestation of anxiety symptoms (Lustberg et al. 2020; Sullivan et al. 1999; Morris et al. 2020). Stress exposure is also associated with an increased release of norepinephrine in the hippocampus (Zhang et al. 2025). Our previous study has shown that GPR75 KO mice exhibit an anxiety behaviour that is consistent with dysfunctional amygdala/hippocampal function (Speidell et al. 2023). Thus, aberrant expression of GPR75 in the LC may be involved in the development of pathological anxiety.

GPR75 mRNA was also localized to TPH‐2+ cells in the brainstem area containing the DRN. The DRN contains predominantly serotonergic neurons, whose activity modulates a wide variety of behavioural states, including anxiety and depression (Paquelet et al. 2022; Michelsen et al. 2007). Both preclinical and clinical studies have shown that alterations in serotonin in the DRN are associated with several neuropsychiatric disorders, including major depressive disorder and anxiety (Paquelet et al. 2022; Nautiyal et al. 2016; Okaty et al. 2019; Vahid‐Ansari and Albert 2021). Thus, alterations in GPR75 expression or function in serotonergic neurons could also contribute to anxiety disorders. More experiments are needed to prove or disprove this hypothesis.

Previous data have shown that GPR75 has a role in hippocampal function because GPR75 KO mice exhibit an impairment in hippocampal‐dependent tasks, including contextual memory (Speidell et al. 2023). However, the widespread distribution of GPR75 mRNA in the CNS, and in particular the cerebellum, suggests a broader function. The cerebellum is crucial for motor coordination and balance. When GPR75 KO mice were tested for balance by rotarod, their latency to fall was significantly higher than WT, suggesting that GPR75 may play a positive role in motor coordination by modulating the activity of Purkinje GABAergic neurons and glutamatergic granule cells. In addition, the distribution of GPR75 mRNA correlates with the wide expression of CCL5, one of the suggested ligands of GPR75 (Ignatov et al. 2006; Dedoni et al. 2018). CCL5 is constitutively expressed in neurons as well as in nonneuronal cells of the adult rat brain (Lanfranco et al. 2017), where it exerts a neuroprotective activity (Campbell et al. 2015). Thus, in the adult brain, GPR75/CCL5 signalling may play a role in neuronal transmission, prevention of neuroinflammation, memory consolidation and motor activity.

In conclusion, our results demonstrate that GPR75 mRNA is expressed throughout the mouse brain with high expression in specific regions of the brain. Within these areas, we identify notable differences in expression across select neuronal subtypes, suggesting that GPR75 may play important roles in modulating neurotransmitter release and function, as well as neuronal maintenance. The multiple effects of GPR75 on neuronal function highlight the importance of further investigation.

Author Contributions

Melanie K. Becher, Tessa Knox and Kaela Wilson performed the experiments and the analysed data. Melanie K. Becher and Italo Mocchetti designed the experiments and wrote the manuscript. Italo Mocchetti coordinated the research activity. Lawrence F. Kromer assisted with the interpretation of the anatomical data. All authors reviewed the results and approved the final version of the manuscript.

Funding

This work was supported by the President Award for Distinguished Scholar‐Teachers, Georgetown University, and the National Institute of Neurological Disorders and Stroke (NS079172).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Figure S1: WT and GPR75 KO mice do not exhibit differences in running wheel performance. Total distance travelled over 8 consecutive days was compared using two‐tailed Welch's t‐test (p = 0.3476) for 20 mice (KO = 10, WT = 10).

EJN-63-0-s001.docx (3.5MB, docx)

Acknowledgements

This work was supported by the President Award for Distinguished Scholar‐Teachers, Georgetown University, and the National Institute of Health, Grant R01 NS079172.

Becher, M. K. , Knox T., Wilson K., Kromer L. F., and Mocchetti I.. 2026. “Anatomical and Neuronal Distribution of the G‐Coupled Protein Receptor 75 mRNA in the Mouse Central Nervous System.” European Journal of Neuroscience 63, no. 4: e70441. 10.1111/ejn.70441.

Associate Editor: Stephanie Borgland

Data Availability Statement

The data that support the findings of this study are openly available in OSF repository (at https://osf.io/szj6x/files). GPR75 KO mice will be available upon reasonable request.

GPR75 KO mice will be available upon reasonable request.

References

  1. Akbari, P. , Gilani A., Sosina O., et al. 2021. “Sequencing of 640,000 Exomes Identifies GPR75 Variants Associated With Protection from Obesity.” Science 373, no. 6550: 73–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aston‐Jones, G. , Rajkowski J., and Cohen J.. 2000. “Locus Coeruleus and Regulation of Behavioral Flexibility and Attention.” Progress in Brain Research 126: 165–182. [DOI] [PubMed] [Google Scholar]
  3. Barbano, M. F. , Qi J., Chen E., et al. 2024. “VTA Glutamatergic Projections to the Nucleus Accumbens Suppress Psychostimulant‐Seeking Behavior.” Neuropsychopharmacology 49, no. 12: 1905–1915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bekar, L. K. , Wei H. S., and Nedergaard M.. 2012. “The Locus Coeruleus‐Norepinephrine Network Optimizes Coupling of Cerebral Blood Volume With Oxygen Demand.” Journal of Cerebral Blood Flow and Metabolism 32, no. 12: 2135–2145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brown, M. T. , Tan K. R., O'Connor E. C., Nikonenko I., Muller D., and Luscher C.. 2012. “Ventral Tegmental Area GABA Projections Pause Accumbal Cholinergic Interneurons to Enhance Associative Learning.” Nature 492, no. 7429: 452–456. [DOI] [PubMed] [Google Scholar]
  6. Calebiro, D. , Koszegi Z., Lanoiselee Y., Miljus T., and O'Brien S.. 2021. “G Protein‐Coupled Receptor‐G Protein Interactions: A Single‐Molecule Perspective.” Physiological Reviews 101, no. 3: 857–906. [DOI] [PubMed] [Google Scholar]
  7. Campbell, L. A. , Avdoshina V., Day C., Lim S. T., and Mocchetti I.. 2015. “Pharmacological Induction of CCL5 In Vivo Prevents gp120‐Mediated Neuronal Injury.” Neuropharmacology 92: 98–107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cardenas, S. , Colombero C., Cruz M., et al. 2023. “20‐HETE/GPR75 Pairing Modulates the Expression and Transcriptional Activity of the Androgen Receptor in Androgen‐Sensitive Prostate Cancer Cells.” Molecular and Cellular Endocrinology 559: 111784. [DOI] [PubMed] [Google Scholar]
  9. Cardenas, S. , Colombero C., Panelo L., et al. 2020. “GPR75 Receptor Mediates 20‐HETE‐Signaling and Metastatic Features of Androgen‐Insensitive Prostate Cancer Cells.” Biochimica et Biophysica Acta 1865, no. 2: 158573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Civelli, O. , Reinscheid R. K., Zhang Y., Wang Z., Fredriksson R., and Schioth H. B.. 2013. “G Protein‐Coupled Receptor Deorphanizations.” Annual Review of Pharmacology and Toxicology 53: 127–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Dashti, M. R. , Gorbanzadeh F., Jafari‐Gharabaghlou D., Farhoudi Sefidan Jadid M., and Zarghami N.. 2023. “G Protein‐Coupled Receptor 75 (GPR75) as a Novel Molecule for Targeted Therapy of Cancer and Metabolic Syndrome.” Asian Pacific Journal of Cancer Prevention 24, no. 5: 1817–1825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dedoni, S. , Campbell L. A., Harvey B. K., Avdoshina V., and Mocchetti I.. 2018. “The Orphan G Protein‐Coupled Receptor 75 Signaling Is Activated by the Chemokine CCL5.” Journal of Neurochemistry 146: 526–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. del Rey, N. L. , Hernandez‐Pinedo N., Carrillo M., et al. 2024. “Calbindin and Girk2/Aldh1a1 Define Resilient vs Vulnerable Dopaminergic Neurons in a Primate Parkinson's Disease Model.” NPJ Parkinsons Disease 10, no. 1: 165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Doze, V. A. , and Perez D. M.. 2012. “G‐Protein‐Coupled Receptors in Adult Neurogenesis.” Pharmacological Reviews 64, no. 3: 645–675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Engelhard, B. , Finkelstein J., Cox J., et al. 2019. “Specialized Coding of Sensory, Motor and Cognitive Variables in VTA Dopamine Neurons.” Nature 570, no. 7762: 509–513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Froogh, G. , Garcia V., and Laniado Schwartzman M.. 2022. “The CYP/20‐HETE/GPR75 Axis in Hypertension.” Advances in Pharmacology 94: 1–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gaertner, Z. , Azcorra M., Dombeck D. A., and Awatramani R.. 2022. “Molecular Heterogeneity in the Substantia Nigra: A Roadmap for Understanding PD Motor Pathophysiology.” Neurobiology of Disease 175: 105925. [DOI] [PubMed] [Google Scholar]
  18. Garcia, V. , Gilani A., Shkolnik B., et al. 2017. “20‐HETE Signals Through G‐Protein‐Coupled Receptor GPR75 (Gq) to Affect Vascular Function and Trigger Hypertension.” Circulation Research 120, no. 11: 1776–1788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Gonzalez‐Fernandez, E. , Staursky D., Lucas K., et al. 2020. “20‐HETE Enzymes and Receptors in the Neurovascular Unit: Implications in Cerebrovascular Disease.” Frontiers in Neurology 11: 983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gonzalez‐Hernandez, A. J. , Munguba H., and Levitz J.. 2024. “Emerging Modes of Regulation of Neuromodulatory G Protein‐Coupled Receptors.” Trends in Neurosciences 47, no. 8: 635–650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Grueschow, M. , Stenz N., Thorn H., et al. 2021. “Real‐World Stress Resilience Is Associated With the Responsivity of the Locus Coeruleus.” Nature Communications 12, no. 1: 2275. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hansen, N. , and Manahan‐Vaughan D. L.. 2015. “Locus Coeruleus Stimulation Facilitates Long‐Term Depression in the Dentate Gyrus That Requires Activation of Beta‐Adrenergic Receptors.” Cerebral Cortex 25, no. 7: 1889–1896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hossain, S. , Gilani A., Pascale J., et al. 2023. “Gpr75‐Deficient Mice Are Protected From High‐Fat Diet‐Induced Obesity.” Obesity 31, no. 4: 1024–1037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Ignatov, A. , Robert J., Gregory‐Evans C., and Schaller H. C.. 2006. “RANTES Stimulates Ca2+ Mobilization and Inositol Trisphosphate (IP3) Formation in Cells Transfected With G Protein‐Coupled Receptor 75.” British Journal of Pharmacology 149, no. 5: 490–497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kim, L. H. , Heck D. H., and Sillitoe R. V.. 2024. “Cerebellar Functions Beyond Movement and Learning.” Annual Review of Neuroscience 47, no. 1: 145–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Kjaerby, C. , Andersen M., Hauglund N., et al. 2022. “Memory‐Enhancing Properties of Sleep Depend on the Oscillatory Amplitude of Norepinephrine.” Nature Neuroscience 25, no. 8: 1059–1070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lalonde, R. , and Strazielle C.. 2003. “Motor Coordination, Exploration, and Spatial Learning in a Natural Mouse Mutation (Nervous) With Purkinje Cell Degeneration.” Behavior Genetics 33, no. 1: 59–66. [DOI] [PubMed] [Google Scholar]
  28. Lalonde, R. , and Strazielle C.. 2019. “Motor Performances of Spontaneous and Genetically Modified Mutants With Cerebellar Atrophy.” Cerebellum 18, no. 3: 615–634. [DOI] [PubMed] [Google Scholar]
  29. Lanfranco, M. F. , Mocchetti I., Burns M. P., and Villapol S.. 2017. “Glial‐ and Neuronal‐Specific Expression of CCL5 mRNA in the Rat Brain.” Frontiers in Neuroanatomy 11: 137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Leeson‐Payne, A. , Iyinikkel J., Malcolm C., et al. 2024. “Loss of GPR75 Protects Against Non‐Alcoholic Fatty Liver Disease and Body Fat Accumulation.” Cell Metabolism 36, no. 5: 1076–1087.e4. [DOI] [PubMed] [Google Scholar]
  31. Liu, B. , Hassan Z., Amisten S., et al. 2013. “The Novel Chemokine Receptor, G‐Protein‐Coupled Receptor 75, Is Expressed by Islets and Is Coupled to Stimulation of Insulin Secretion and Improved Glucose Homeostasis.” Diabetologia 56, no. 11: 2467–2476. [DOI] [PubMed] [Google Scholar]
  32. Lustberg, D. , Tillage R. P., Bai Y., Pruitt M., Liles L. C., and Weinshenker D.. 2020. “Noradrenergic Circuits in the Forebrain Control Affective Responses to Novelty.” Psychopharmacology 237, no. 11: 3337–3355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Michelsen, K. A. , Schmitz C., and Steinbusch H. W.. 2007. “The Dorsal Raphe Nucleus—From Silver Stainings to a Role in Depression.” Brain Research Reviews 55, no. 2: 329–342. [DOI] [PubMed] [Google Scholar]
  34. Miranda‐Barrientos, J. , Chambers I., Mongia S., et al. 2021. “Ventral Tegmental Area GABA, Glutamate, and Glutamate‐GABA Neurons Are Heterogeneous in Their Electrophysiological and Pharmacological Properties.” European Journal of Neuroscience 54: 4061–4084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Morris, L. S. , McCall J. G., Charney D. S., and Murrough J. W.. 2020. “The Role of the Locus Coeruleus in the Generation of Pathological Anxiety.” Brain and Neuroscience Advances 4: 2398212820930321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Nautiyal, K. M. , Tritschler L., Ahmari S. E., David D. J., Gardier A. M., and Hen R.. 2016. “A Lack of Serotonin 1B Autoreceptors Results in Decreased Anxiety and Depression‐Related Behaviors.” Neuropsychopharmacology 41, no. 12: 2941–2950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Okaty, B. W. , Commons K. G., and Dymecki S. M.. 2019. “Embracing Diversity in the 5‐HT Neuronal System.” Nature Reviews. Neuroscience 20, no. 7: 397–424. [DOI] [PubMed] [Google Scholar]
  38. Paquelet, G. E. , Carrion K., Lacefield C. O., Zhou P., Hen R., and Miller B. R.. 2022. “Single‐Cell Activity and Network Properties of Dorsal Raphe Nucleus Serotonin Neurons During Emotionally Salient Behaviors.” Neuron 110, no. 16: 2664–2679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Powell, D. R. , Doree D. D., DaCosta C. M., et al. 2022. “Mice Lacking Gpr75 Are Hypophagic and Thin.” Diabetes Metabolic Syndrome and Obesity 15: 45–58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Sauer, C. G. , White K., Stohr H., et al. 2001. “Evaluation of the G Protein Coupled Receptor‐75 (GPR75) in Age Related Macular Degeneration.” British Journal of Ophthalmology 85, no. 8: 969–975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Schneider, C. A. , Rasband W. S., and Eliceiri K. W.. 2012. “NIH Image to ImageJ: 25 Years of Image Analysis.” Nature Methods 9, no. 7: 671–675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Speidell, A. , Walton S., Campbell L. A., et al. 2023. “Mice Deficient for G‐Protein‐Coupled Receptor 75 Display Altered Presynaptic Structural Protein Expression and Disrupted Fear Conditioning Recall.” Journal of Neurochemistry 165, no. 6: 827–841. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Stokin, G. B. , and Goldstein L. S.. 2006. “Axonal Transport and Alzheimer's Disease.” Annual Review of Biochemistry 75: 607–627. [DOI] [PubMed] [Google Scholar]
  44. Sullivan, G. M. , Coplan J. D., Kent J. M., and Gorman J. M.. 1999. “The Noradrenergic System in Pathological Anxiety: A Focus on Panic With Relevance to Generalized Anxiety and Phobias.” Biological Psychiatry 46, no. 9: 1205–1218. [DOI] [PubMed] [Google Scholar]
  45. Tarttelin, E. E. , Kirschner L. S., Bellingham J., et al. 1999. “Cloning and Characterization of a Novel Orphan G‐Protein‐Coupled Receptor Localized to Human Chromosome 2p16.” Biochemical and Biophysical Research Communications 260, no. 1: 174–180. [DOI] [PubMed] [Google Scholar]
  46. Trutti, A. C. , Mulder M. J., Hommel B., and Forstmann B. U.. 2019. “Functional Neuroanatomical Review of the Ventral Tegmental Area.” NeuroImage 191: 258–268. [DOI] [PubMed] [Google Scholar]
  47. Vahid‐Ansari, F. , and Albert P. R.. 2021. “Rewiring of the Serotonin System in Major Depression.” Frontiers in Psychiatry 12: 802581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. van Zessen, R. , Phillips J. L., Budygin E. A., and Stuber G. D.. 2012. “Activation of VTA GABA Neurons Disrupts Reward Consumption.” Neuron 73, no. 6: 1184–1194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Vasudevan, S. , Samuels I. S., and Park P. S.. 2023. “Gpr75 Knockout Mice Display Age‐Dependent Cone Photoreceptor Cell Loss.” Journal of Neurochemistry 167, no. 4: 538–555. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yang, J. , Chen J., Liu Y., Chen K. H., Baraban J. M., and Qiu Z.. 2023. “Ventral Tegmental Area Astrocytes Modulate Cocaine Reward by Tonically Releasing GABA.” Neuron 111, no. 7: 1104–1117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Yang, T. , Britt J. K., Cintron‐Perez C. J., et al. 2018. “Ca(2+)‐Binding Protein 1 Regulates Hippocampal‐Dependent Memory and Synaptic Plasticity.” Neuroscience 380: 90–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yuan, H. H. , Chen R. J., Zhu Y. H., Peng C. L., and Zhu X. R.. 2013. “The Neuroprotective Effect of Overexpression of Calbindin‐D(28k) in an Animal Model of Parkinson's Disease.” Molecular Neurobiology 47, no. 1: 117–122. [DOI] [PubMed] [Google Scholar]
  53. Zhang, E. T. , Saglimbeni G. S., Feng J., Li Y., and Bruchas M. R.. 2025. “Dentate Gyrus Norepinephrine Ramping Facilitates Aversive Contextual Processing.” Nature Communications 16, no. 1: 454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zhang, X. , Gainetdinov R. R., Beaulieu J. M., et al. 2005. “Loss‐of‐Function Mutation in Tryptophan Hydroxylase‐2 Identified in Unipolar Major Depression.” Neuron 45, no. 1: 11–16. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1: WT and GPR75 KO mice do not exhibit differences in running wheel performance. Total distance travelled over 8 consecutive days was compared using two‐tailed Welch's t‐test (p = 0.3476) for 20 mice (KO = 10, WT = 10).

EJN-63-0-s001.docx (3.5MB, docx)

Data Availability Statement

The data that support the findings of this study are openly available in OSF repository (at https://osf.io/szj6x/files). GPR75 KO mice will be available upon reasonable request.

GPR75 KO mice will be available upon reasonable request.


Articles from The European Journal of Neuroscience are provided here courtesy of Wiley

RESOURCES