Skip to main content
Springer logoLink to Springer
. 2026 Feb 4;49(1):83. doi: 10.1007/s10753-025-02439-6

Impaired BCAA Catabolism Contributes To Acute Lung Injury By Triggering Oxidative Stress and Inflammatory Response Via the MAPK Pathway

Da-Yan Xiong 1,2,#, Chen-Yu Zhang 3,4,#, Jin-Tong Yang 5, Wei Liu 2, Si-Yuan Tang 1,2, Liang Dong 3, Xiao-Ting Huang 1,2,
PMCID: PMC12920403  PMID: 41636928

Abstract

Acute lung injury (ALI) is a severe respiratory failure characterized by rapid alveolar injury, severe hypoxemia, and an uncontrolled inflammatory response. Branched-chain amino acids (BCAAs) are a group of essential amino acids, including valine, leucine, and isoleucine. Accumulating evidence shows that BCAA metabolism has long been implicated in the etiology of type 2 diabetes, myocardial ischemia/reperfusion, heart failure, cancer, and other conditions. However, the contribution of BCAA metabolism regulation in ALI remains largely elusive. Here, we found that branched-chain α-keto acids (BCKAs), intermediate metabolites of BCAAs, were increased in the lungs of ALI mice induced by lipopolysaccharide (LPS) and positively correlated with ALI. Accordingly, promoting BCKA degradation by BT2 alleviates the LPS-induced ALI by suppressing inflammation and oxidative stress in mice with ALI. In addition, we found that BCKA supplements exacerbated the LPS-induced inflammation, oxidative stress, and ALI in mice. Mechanistic studies revealed that BCKAs exacerbate the LPS-induced ALI by activating the mitogen-activated protein kinase (MAPK) pathway in macrophages. Collectively, we demonstrate the causal role of defective BCAA catabolism in the development of ALI. Targeting BCAA catabolism might be a promising therapeutic strategy for ALI.

Supplementary Information

The online version contains supplementary material available at 10.1007/s10753-025-02439-6.

Keywords: Branched-chain amino acids, Acute lung injury, Inflammation, Oxidative stress, MAPK

Introduction

Acute lung injury (ALI) is a severe respiratory disease characterized by rapid alveolar injury, severe hypoxemia, and an uncontrolled inflammatory response [1]. This condition frequently progresses to the more critical acute respiratory distress syndrome (ARDS), which carries a mortality rate of 35%–45% and offers limited therapeutic options [2]. ALI is caused by various pathogenic factors, such as bacterial infections, particularly Gram-negative bacterial endotoxins [3]. Currently, conventional anti-inflammatory drug therapy and mechanical ventilation have provided some relief from the stress of lung injury [4]. However, the mortality rate of patients with ARDS remains high. There are no proven pharmacological therapies for ALI [5]. The development of new and effective treatments for ALI is required to improve the status of treatment for this condition.

Accumulating evidence shows that amino acids and their anabolism and catabolism are implicated in the etiology of various conditions, including type 2 diabetes, myocardial ischemia/reperfusion, heart failure, and cancer [68]. Alterations in amino acid levels, such as glutamine and N-acetylcysteine, have been reported during ALI [9, 10]. However, the potential role of essential amino acids in ALI remains unclear [11, 12].

Branched-chain amino acids (BCAAs), a group of essential amino acids, consist of valine, leucine, and isoleucine. The metabolic homeostasis of BCAAs is regulated by BCAA catabolic enzymes [13]. Branched-chain aminotransferases (BCATs) convert BCAAs to branched-chain α-keto acids (BCKAs) [6]. Subsequently, BCKAs undergo irreversible decarboxylation and dehydrogenation by the branched-chain α-keto-acid dehydrogenase (BCKDH) complex, the rate-limiting enzyme in BCAA catabolism. BCKDH activity is regulated through phosphorylation (inhibition) of its E1 subunit by branched-chain α-keto acid dehydrogenase kinase (BCKDK) and dephosphorylation (activation) by the mitochondrial matrix-targeted protein phosphatase 2 C family member (PPM1K or PP2Cm) [14]. Inhibition of BCKDK with BT2 (3,6-dichlorobenzo[b]thiophene-2-carboxylic acid) has been shown to reduce BCAA/BCKA levels [15, 16]. Studies have shown that excessive branched-chain amino acids can disrupt the metabolic balance of intestinal epithelial cells, inducing intestinal inflammation [17]. Elevated levels of BCAAs can promote kidney inflammation and fibrosis, and restoring BCAA homeostasis through pharmacological inhibitors can alleviate the disease process [18]. However, the role of BCAA metabolism in ALI is not well understood.

Macrophages, the principal immune cells in the lungs, produce inflammatory molecules and trigger inflammatory reactions [19, 20]. Macrophages secrete interleukin (IL)−6 and IL-1β, thereby inducing the production of oxidants, which are associated with the activation of nuclear factor κ‑light‑chain‑enhancer of activated B cells (NF‑κB) [21, 22]. It is well-accepted that inhibiting excessive generation of inflammatory cytokines and reactive oxygen species (ROS) significantly improves pulmonary function and survival status in ALI mice [23, 24]. Mitogen-activated protein kinase (MAPK) pathways induce the expression of inflammatory genes and oxidative stress, thus promoting inflammation and pulmonary permeability, which play an essential role in ALI [25, 26]. Moreover, blocking MAPK prevented lipopolysaccharide (LPS)-induced inflammation, oxidative damage, and pulmonary dysfunction in mice [24, 27, 28]. Importantly, studies have shown that BCAAs can activate the MAPK pathway [29, 30]. These findings suggest that BCAAs may induce macrophage inflammatory responses by activating the MAPK pathway.

In this study, we investigated whether BCAA catabolism dysfunction contributes to the development of ALI and explored the role and molecular mechanism of BCAA catabolism during LPS-induced ALI.

Materials and Methods

Animals

Eight-week-old male C57BL/6J mice were used for this study. All experiments were conducted using non-littermate male mice. The mice were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Hunan, China). All animal experiments were approved by the Ethics Committee of Central South University (XMSB-2024-0011, Changsha, China) and conformed to the guidelines of the National Institutes of Health. Mice were anesthetized, and all necessary measures were taken to minimize suffering before performing procedures.

Animal Treatment Protocols

To clarify the role of BCAAs accumulation in ALI, we employed the BCKDK inhibitor BT2 to promote the degradation of BCAAs. BT2 (20 mg/kg body weight) or saline was administered intraperitoneally once daily either 3 d before or on the day of intratracheal injection of LPS (E. coli O111:B4; 5 mg/kg; 50 µL; Sigma-Aldrich, St. Louis, MO, USA). To study the effect of BCKA on ALI development, BCKA (40 mg/kg weight) or saline was intraperitoneally injected daily for 3 d before LPS administration. Mice were sacrificed 12 h after LPS administration. For survival studies, mice received a lethal dose of LPS (25 mg/kg, intratracheal injection), and survival rates were monitored every 6 h.

BCKA Concentration Measurement

Lung sample and cell supernatant were collected and stored immediately at − 80 °C. BCKA concentrations were determined using a commercially available BCKA detection kit (K564-100, Biovision, USA), following the manufacturer’s protocol. Measurements were performed at 450 nm using a microplate reader.

BCKDH Activity Assay

Tissue samples were ground into powder and homogenized in 250 µL of Buffer I (30 mM KPi, pH 7.5, 5 mM DTT, 1 mM α-ketoisovalerate, 3 mM EDTA, 3% FBS, 5% Triton X-100, 1 µM Leupeptin) using a QIAGEN TissueLyser II. The homogenate was centrifuged at 10,000 ×g for 10 min, and 50 µL of the supernatant was added to polystyrene tubes containing an elevated 1 M NaOH CO2 trap. Then, 300 µL of Buffer II (50 mM HEPES pH 7.5, 30 mM KPi pH 7.5, 3 mM NAD+, 0.4 mM coenzyme A, 2 mM thiamine pyrophosphate, 2 mM MgCl2, 5% FBS, 7.8 µM α-keto[1–14 C]isovalerate) was added. The tubes were capped and incubated at 37 °C in a shaking water bath for 30 min. The reaction mixture was acidified with 70% perchloric acid and shaken for 1 h. The amount of 14CO2 trapped was measured using a Beckman Coulter LS6500 liquid scintillation counter.

Histological Analysis

Lung tissues were excised and fixed immediately in 4% fixative for 48 h. The tissue sections were then subjected to hematoxylin–eosin staining. Inflammation severity was scored on a scale between 0 and 4 as follows: 1: <25% lung involvement; 2: 25%–49% lung involvement; 3: 50%–75% lung involvement; and 4: >75% lung involvement. The inflammation score was independently assessed by three pathologists who were blinded to the experimental groups [31].

Wet-To-Dry Ratio of Lung Tissue

The entire lung tissue is completely removed, and its surface is gently blotted to remove excess fluid. The wet weight of the lung tissue is then immediately measured. Subsequently, the lung tissue is placed in a drying oven at 65 °C for 48 to 72 h. Drying is considered complete when the weight stabilizes between two consecutive 24 h measurements, at which point the final dry weight is recorded. The ratio is calculated as W/D.

Lung Function Measurements

Lung function measurements were obtained using the BUXCO system (Scireq, Canada). A snapshot perturbation maneuver was imposed to measure lung compliance, which is obtained by fitting the maneuver signals to a single-compartment model of the lung using operating software. Respiratory input impedance was fit to the constant phase model of the lung by the operating software, and lung tissue resistance was obtained.

Bronchoalveolar Lavage Fluid (BALF) Collection and Analysis

For BALF collection, the trachea was lavaged three times with 1 mL of ice-cold sterile saline. Samples were centrifuged at 1,500 rpm for 5 min. The cell-free supernatant was collected and analyzed for total cell and differential leukocyte counts using a fully automatic blood analyzer (XT-2000i, Sysmex). Supernatant was stored at − 80 ℃ for further analysis.

Lactate Dehydrogenase (LDH) Activity Assay

LDH activity in BALF was determined using an LDH activity kit (Sigma-Aldrich) following the respective manufacturer’s instructions.

Myeloperoxidase (MPO) Activity and Nuclear Factor kappa-B (NF-κB) Transcription Activity Analysis

Lung homogenates and primary peritoneal macrophages were dissolved in an extraction buffer to analyze MPO activity and NF-κB transcription activity. These analyses were performed using commercially available assay kits (Jiancheng Bioengineering Institute, Nanjing, China).

Evaluation of Oxidative Stress

To assess oxidative stress and antioxidant status, we analyzed malondialdehyde (MDA) content, 4-hydroxynonenal (4-HNE) levels, total antioxidant capacity (TAOC), and superoxide dismutase (SOD) activity in lysates of lung homogenate and primary peritoneal macrophages. These analyses were performed according to the manufacturers’ instructions for the respective commercial kits (Nanjing Jiancheng Bioengineering Institute, China).

IL-1β and IL-6 Measurements

The concentrations of cytokines IL-1β and IL-6 in lung homogenates and/or cell culture supernatants were quantified using commercial enzyme-linked immunosorbent assay (ELISA) kits from R&D Systems (Minneapolis, MN, USA), according to the manufacturers’ protocols.

Dichlorofluorescein Diacetate (DCFH-DA) Measurement

DCFH-DA is one of the most widely utilized probes for detecting intracellular ROS, providing a reliable measure of the overall oxidative stress status in tissues and cells. Freshly prepared lung homogenates and cell lysates were incubated with freshly prepared 2’,7’-dichlorofluorescin diacetate (DCFHDA, 50 µM) in the dark for 30 min at room temperature. DCF intensity was measured at an excitation wavelength of 502 nm and an emission wavelength of 530 nm.

Isolation of Primary Peritoneal Macrophages and Treatments

Three days after intraperitoneal injection of 3 mL 3% thioglycolate (Sigma-Aldrich) broth to elicit peritoneal macrophages, peritoneal macrophages were harvested via peritoneal lavage with cooled Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco, Grand Island, NY, USA). Cells were collected by centrifugation at 1500 ×g for 10 min at 4 °C and resuspended in culture medium. Primary macrophages were plated in 12-well plates at a density of 1 × 106 cells/well. Two hours later, the culture medium was discarded and washed with PBS. Macrophages were cultured in a humidified CO2 incubator at 37 °C [23]. To investigate the effects of BCKA on the inflammatory response of macrophages, primary macrophages were treated with LPS (100 ng/mL) with or without BCKA (500 µM) for 6 h. Similarly, to investigate the effects of BT2 on the inflammatory response of macrophages, primary macrophages were treated with LPS (100 ng/mL) with or without BT2 (50 µM) for 6 h. To explore the mechanism by which BCAA metabolic dysregulation triggers inflammatory responses, we used MAPK inhibitors (U0126: ERK inhibitor, SP600125: JNK inhibitor, SB203580: p38 inhibitor; MedChemExpress) to intervene with macrophages. Primary macrophages were pretreated with U0126, SP600125, or SB203580 (20 µM) for 30 min, respectively. Subsequently, the cells were treated with BCKA (500 µM) followed by LPS (100 ng/mL) for an additional 6 h. To achieve the overexpression of PP2Cm, we used an overexpression lentivirus vector. For lentivirus transfection, peritoneal macrophages (1 × 106 cells/well) were infected with the lentivirus (MOI = 50) according to the protocol in the Lentivirus Operation Manual for 16 h. After 3 days of renewed culture in regular RPMI-1640, the cells were subjected to further treatment.

Isolation of Alveolar Macrophages (AMs) and Treatments

AMs were collected by bronchoalveolar lavage. After anesthesia, the trachea of the mice was exposed, and the lungs were flushed three times with 1 mL of chilled PBS supplemented with EDTA (5 mM). The lavage was repeated twice, and AMs from several mice were pooled. The lavage fluid was centrifuged at 1500 ×g for 10 min at 4 °C and resuspended in RPMI-1640 medium containing 10% fetal calf serum, penicillin (100 U/mL), and streptomycin (100 mg/mL). After incubation for 2 h at 37 °C in an atmosphere of 5% CO2, non-adherent cells were removed.

RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was extracted using the RNeasy Mini Kit (Cat#: 74104, Qiagen). Complementary DNA (cDNA) was synthesized using a PrimeScript™RT Reagent Kit with a gDNA Eraser (Takara, Japan). Quantitative real-time PCR was performed using SYBR GreenER™ qPCR SuperMix Universal (Cat#: 1176202 K, Invitrogen). The fold increase or decrease of the experimental sample relative to the control was calculated using the formula 2−△△CT. The primers used in this study were as follows: Il-1β (gggcctcaaaggaaagaatc, taccagttggggaactctgc), Il-6 (ctggggatgtctgtagctca, ctgtgaagtctcctctccgg), Pp2cm (ggtgggtttgtagcttggaa, ggagtgcctcttctgccagt), Bcat1 (tagaatgtgccgatctgctg, ctttggaaggcttcttgacg), Bcat2 (ggacccatgaagacggagta, cccgcttcaattccttcata), and β-actin (ttccagccttccttcttg, ggagccagagcagtaatc).

Western Blot

Total proteins were extracted from lung tissue or cells for protein detection by Western blot. Protein concentrations were determined using the BCA assay (Thermo, USA). Western blotting was performed as previously described [32]. The following antibodies were used: PP2Cm, 1:1000 (Abcam); p-ERK, 1:2000 (CST); ERK, 1:1000 (CST); p-JNK, 1:2000 (CST); JNK, 1:1000 (CST); p-p38, 1:1000 (Abcam); p38, 1:1000 (Abcam); and β-actin, 1:7500 (Sigma-Aldrich). Blots were visualized with a chemiluminescence kit (Millipore, USA), and band densities of bands were quantified using the Quantity One analysis software (Bio-Rad, USA).

Statistical Analysis

All experiments in this study were independently repeated at least three times. Data are expressed as the mean ± SEM. Statistical analysis was performed with SPSS 19.0. Unpaired Students’ t-test (two groups) and ANOVA (multiple groups) were used. Overall survival was analyzed using the Kaplan-Meier method, with statistical significance assessed via the log-rank test. Pearson correlations were calculated to evaluate linear relationships between protein expression levels. Differences were considered significant when the P-value < 0.05.

Results

Loss of BCAA Catabolism in the Lungs of ALI Mice Positively Correlates With LPS-Induced ALI

For the first time, we investigated the changes in pulmonary BCAA metabolism during LPS-induced ALI in mice. The result showed that the level of BCKA, metabolic intermediates of BCAA, was upregulated in the lung tissues of ALI mice induced by LPS (Fig. 1A). The mRNA expression of Bcat1 and Bcat2, which catalyze the conversion of BCAAs to BCKAs, is decreased (Fig. 1B-C), along with reduced expression of PP2Cm (the BCKD dephosphorylase) and significantly reduced BCDKH activity (Fig. 1D-G). Further studies revealed that the pulmonary BCKA levels in ALI mice positively correlated with the activity of LDH in BALF (Fig. 1H). In addition, mRNA expression of Bcta1 and Bcta2 was decreased, while PP2Cm expression was significantly reduced in macrophages derived from ALI mice (Fig. 1I-M). In summary, these findings suggest that defective BCAA catabolism in the lungs of mice may promote the progression of ALI.

Fig. 1.

Fig. 1

Loss of BCAA catabolism in the lungs of ALI mice positively correlates with LPS-induced ALI. (A) BCKA concentration in tissues from ALI mice lungs (n = 6). (B-C) The mRNA expression of Bcat1 and Bcat2 in the lungs of ALI mice was quantified by real-time PCR (n = 6). (E-F) Real-time PCR and Western blot results of PP2Cm mRNA and protein in the lungs of ALI mice (n = 6). (G) Detection of BCKDH complex enzyme activity in lung tissue of ALI mice (n = 6). (H) BCKA level in the lungs positively correlated with LDH activity in BALF of ALI mice (n = 10). (I-J) The mRNA expression of Bcat1 and Bcat2 in primary macrophages treated with LPS was quantified by real-time PCR (n = 6). (K-M) Real-time PCR and Western blot results of PP2Cm mRNA and protein in primary macrophages treated with LPS (n = 6). * P < 0.05, ** P < 0.01, and *** P < 0.001

Promoting BCAA/BCKA Degradation Alleviates LPS-Induced ALI in Mice

Given the significant role of impaired BCAA catabolism in ALI, we investigated the impact of enhancing BCAA catabolic activity with BT2 on LPS-induced ALI in mice. Mice were prophylactically treated with BT2 for three consecutive days before LPS administration. We found that BT2 effectively reduced the content of BCKA in the lungs of ALI mice (Fig. 2A). Correspondingly, BT2 noticeably attenuated LPS-induced inflammatory histological changes, including pulmonary congestion, alveolar wall thickening, and areas of inflammatory infiltration (Fig. 2B–C). The LDH activity, an indicator of lung injury, also demonstrated a moderate decrease in LPS-induced ALI mice treated with BT2 (Fig. 2D). BT2 reduced pulmonary edema and injury, as evidenced by decreases in the lung wet-to-dry ratio and total protein content in BALF (Fig. 2E–F). As shown by BUXCO results, elevated airway resistance and reduced lung compliance in ALI mice were significantly improved after BT2 treatment (Figs. 2G–H). More importantly, BT2 significantly improved the survival rate of mice challenged with LPS (Fig. 2I). Next, to better simulate clinical treatment scenarios, BT2 was administered concurrently with LPS. The results showed that BT2 also attenuated LPS-induced histopathological changes in lung tissue and reduced LDH activity (Figure S1A-C). Taken together, these data indicate that enhancing BCKA degradation by targeting inhibition of BCKDK can effectively alleviate LPS-induced ALI in mice.

Fig. 2.

Fig. 2

Promoting BCAA/BCKA degradation alleviates LPS-induced ALI in mice. Mice were pretreated with BT2 (20 mg/kg) via intraperitoneal injection once daily for three days, followed by intratracheal administration of LPS. (A) BCKA concentration in the lung tissue from ALI mice treated with or without BT2 (n = 6). (B) Lung sections of mice were stained using the H&E staining. Representative images of the staining are shown (Bar = 100 μm). (C) Inflammation score (based on H&E staining) expressed on a numerical scale (n = 6). (D) BALF was collected and assayed for LDH activity (n = 6). (E) Lung wet-to-dry ratio (n = 6). (F) Total proteins in BALF. (G-H) Pulmonary function as assessed by airway resistance and lung compliance (n = 6). (I) Survival rate in control mice and ALI mice treated with or without BT2 (n = 25). * P < 0.05, ** P < 0.01, and *** P < 0.001

Promoting BCKA Degradation Reduces LPS-Induced Inflammation and Oxidative Stress in ALI Mice

Inflammation and oxidative stress are critical in the progression of ALI. In this study, we found that BT2 effectively reduced the elevated levels of IL-1β and IL-6 in BALF induced by LPS (Fig. 3A–B). It also significantly suppressed the accumulation of total cells, macrophages, and neutrophils in BALF induced by LPS (Fig. 3C–E). The LPS-induced elevation of MPO activity, an index of neutrophil accumulation in the lungs, was markedly decreased in ALI mice treated with BT2 (Fig. 3F). In addition, BT2 significantly inhibited NF-κB transcription activity in LPS-injured lungs, a pivotal transcription factor in triggering the expression of various inflammatory cytokines (Fig. 3G). ROS generation was also reduced by BT2 (Fig. 3H). BT2 suppressed the LPS-induced increase in MDA formation and 4-HNE levels, both of which are biomarkers of oxidative/nitrosative stress (Fig. 3I–J). TAOC and SOD, critical antioxidants for mitigating oxidative stress, were depleted in LPS-induced ALI but were restored with BT2 treatment (Fig. 3K–L). Collectively, these findings indicate that promoting BCKA degradation reduces LPS-induced pulmonary inflammation and oxidative stress.

Fig. 3.

Fig. 3

Promoting BCKA degradation reduces LPS-induced inflammation and oxidative stress in ALI mice. (A-B) BALF was collected for the analysis of IL-1β and IL-6 (n = 5). (C-E) The numbers of total cells, macrophages, and neutrophils were determined in BALF (n = 5). (F) MPO activity in the lungs (n = 5). (G) NF-κB activity in the lungs (n = 5). (H) Relative ROS level in the lungs as assessed by DCF intensity (n = 5). (I-J) Quantification of MDA and 4-HNE in the lungs (n = 5). (K-L) Quantification of TAOC and total SOD activity in the lungs (n = 5). * P < 0.05, ** P < 0.01, and *** P < 0.001

BCKA Exacerbates LPS-Induced ALI in Mice

To further investigate whether manipulating BCKA levels influences ALI progression in vivo, we treated LPS-challenged mice with BCKA (40 mg/kg, i.p.). BCKAs significantly exacerbated lung injury and pulmonary edema in mice treated with LPS, as evidenced by increased inflammatory scores, elevated LDH activity, higher lung wet-to-dry weight ratio, and increased total protein levels in BALF (Fig. 4A–E). BCKA treatment further intensified the elevation of airway resistance and the suppression of lung compliance induced by LPS (Fig. 4F–G). Moreover, BCKA exacerbated the mortality rate of ALI mice (Fig. 4H). Taken together, our data indicate that BCKA exacerbates LPS-induced ALI in mice.

Fig. 4.

Fig. 4

BCKA exacerbates LPS-induced ALI in mice. (A) Lung sections of mice were stained using the H&E staining. Representative images of the staining are shown (Bar = 100 μm). (B) Inflammation score (based on H&E staining) expressed on a numerical scale (n = 5). (C) BALF was collected and assayed for LDH activity (n = 5). (D) Lung wet-to-dry ratio (n = 5). (E) Total proteins in BALF (n = 5). (F-G) Pulmonary function as assessed by airway resistance and lung compliance (n = 5). (H) Survival rate in Control mice and ALI mice treated with or without BCKA (n = 25). * P < 0.05, ** P < 0.01, and *** P < 0.001

BCKA Facilitates Inflammation and Oxidative Stress in Mice with ALI

Next, we investigated the effects of increased BCKA content on LPS-induced inflammation and oxidative stress in mice. Compared to mice exposed to LPS alone, BCKA treatment led to further increases in IL-1β and IL-6 levels in the bronchoalveolar lavage fluid (BALF) of LPS-exposed mice (Fig. 5A–B). BCKA significantly facilitated the accumulation of total cells, macrophages, and neutrophils in the BALF of ALI mice induced by LPS (Fig. 5C–E). And LPS-induced elevation of MPO activity, an index of neutrophil accumulation in lungs, was further increased in mice treated with BCKA (Fig. 5F). The NF-κB transcription activity in lung tissue was further elevated in BCKA-treated ALI mice (Fig. 5G). Furthermore, BCKA amplified LPS-induced oxidative stress in the lungs, as demonstrated by increased levels of DCF intensity, MDA, and 4-HNE (Fig. 5H–J). Simultaneously, TAOC and SOD activity in the lungs of ALI mice were further inhibited by BCKA (Fig. 5K–L). Collectively, these results reveal that BCKA facilitates LPS-induced pulmonary inflammation and oxidative stress in mice.

Fig. 5.

Fig. 5

BCKA facilitates inflammation and oxidative stress in mice with ALI. (A-B) BALF was collected for the analysis of IL-1β and IL-6 (n = 5). (C-E) The numbers of total cells, macrophages, and neutrophils were determined in BALF (n = 5). (F) MPO activity in the lungs (n = 5). (G) NF-κB activity in the lungs (n = 5). (H) Relative ROS level in the lungs as assessed by DCF intensity (n = 5). (I-J) Quantification of MDA and 4-HNE in the lungs (n = 5). (K-L) Quantification of TAOC and total SOD activity in the lungs (n = 5). * P < 0.05, ** P < 0.01, and *** P < 0.001

BCAA Metabolic Disorders Promote LPS-Induced Macrophage Inflammatory Response

The LPS-induced increases in IL-1β and IL-6 levels were significantly reduced in primary peritoneal macrophages treated with BT2 (Fig. 6A–B). BT2 administration also significantly decreased MDA content and DCF intensity (Fig. 6C–D). In addition, BT2 treatment markedly inhibited the LPS-induced decrease in SOD activity in primary peritoneal macrophages (Fig. 6E). Overexpression of PP2Cm (OE-PP2Cm) in macrophages (Figure S2), aimed at enhancing BCAA catabolism, effectively attenuated the LPS-induced elevations in IL-1β and IL-6 (Fig. 6F-G) and mitigated the decrease in SOD activity (Fig. 6H). By contrast, BCKA treatment aggravated the elevation of IL-1β and IL-6 levels, MDA content, and DCF intensity induced by LPS in primary peritoneal macrophages (Fig. 6F–I). BCKA also exacerbated the LPS-induced downregulation of SOD activity in primary peritoneal macrophages (Fig. 6J). In addition, we found that BT2 dramatically attenuated the increase in IL-1β, IL-6 levels, DCF intensity, and MDA content induced by treatment with LPS in primary AMs (Fig. 7A-D). The decrease in SOD activity in AMs induced by LPS was reduced after treatment with BT2 (Fig. 7E). BCKA treatment also aggravated the elevation of IL-1β and IL-6 levels, and DCF intensity induced by LPS in primary AMs (Fig. 7F–H). These findings suggest that enhancing BCAA catabolism attenuates LPS-induced inflammation and oxidative stress in primary macrophages.

Fig. 6.

Fig. 6

BCAA metabolic disorders promote LPS-induced macrophage inflammatory response. (A-B) Supernatants from primary peritoneal macrophages treated with LPS in the presence or absence of BT2 were collected for IL-1β and IL-6 analysis (n = 5). (C) Quantification of MDA in primary peritoneal macrophages (n = 5). (D) Relative ROS level in primary peritoneal macrophages as assessed by DCF intensity (n = 5). (E) Quantification of total SOD activity in primary peritoneal macrophages (n = 5). (F-G) Supernatants from macrophages treated with LPS combined with OE-PP2Cm were collected for IL-1β and IL-6 analysis (n = 3–4). (H) Quantification of total SOD activity in macrophages (n = 3). (I-J) Supernatants from primary peritoneal macrophages treated with LPS in the presence or absence of exogenous BCKA were collected for IL-1β and IL-6 analysis (n = 5). (K) Relative ROS level in primary peritoneal macrophages as assessed by DCF intensity (n = 5). (L) Quantification of MDA in primary peritoneal macrophages (n = 5). (M) Quantification of total SOD activity in primary peritoneal macrophages (n = 5). * P < 0.05, ** P < 0.01, and *** P < 0.001

Fig. 7.

Fig. 7

The role of BCAA catabolism in LPS-induced inflammatory responses in primary AMs. (A-B) Supernatants from primary peritoneal macrophages treated with LPS in the presence or absence of BT2 were collected for IL-1β and IL-6 analysis (n = 4). (C) Quantification of MDA in primary AMs (n = 4). (D) Relative ROS level in AMs as assessed by DCF intensity (n = 4). (E) Quantification of total SOD activity in AMs (n = 4). (F-G) Supernatants from primary peritoneal macrophages treated with LPS in the presence or absence of exogenous BCKA were collected for IL-1β and IL-6 analysis (n = 4). (H) Relative ROS level in AMs as assessed by DCF intensity (n = 4). * P < 0.05, ** P < 0.01, and *** P < 0.001

BCKA Exacerbates LPS-Induced Macrophage Inflammatory Response By Activating the MAPK Pathway

The MAPK family (including JNK, ERK1/2, and P38 MAPK) plays a key role in macrophage activation in ALI [24, 33]. Therefore, we explored whether MAPK is involved in BCKA-induced macrophage activation. Western blot analysis demonstrated that phosphorylation of both ERK and JNK significantly increased after BCKA treatment, whereas phosphorylation of p38 did not differ significantly between treatments with or without BCKA (Fig. 8A–B). To determine whether inhibiting ERK and JNK activity could restore susceptibility to injury induced by BCKA, we treated macrophages with ERK inhibitor (U0126) and JNK inhibitor (SP600125). We found that the ERK inhibitor and the JNK inhibitor recovered the alterations of IL-1β and IL-6 levels induced by BCKA in macrophages (Fig. 8C–D). Consistent with these data, the increased levels of MDA and DCF intensity, along with the decrease in SOD activity induced by BCKA, were significantly suppressed by U0126 and SP600125 in macrophages (Fig. 8E–G). Collectively, these results demonstrate that BCKA exacerbates LPS-induced ALI by activating the MAPK pathway in macrophages.

Fig. 8.

Fig. 8

BCKA exacerbates LPS-induced macrophage inflammatory response by activating the MAPK pathway. (A-B) The protein level of p-ERK, ERK, p-JNK, JNK, p-p38, and p38 in primary peritoneal macrophages was detected using Western blot (n = 5). (C-D) The supernatant of primary peritoneal macrophages was collected for the analysis of IL-1β and IL-6 (n = 5). (E) Quantification of MDA in primary peritoneal macrophages (n = 5). (F) Relative ROS level in lungs as assessed by DCF intensity (n = 5). (G) Quantification of total SOD activity in primary peritoneal macrophages (n = 5). * P < 0.05, ** P < 0.01, and *** P < 0.001. U0126: ERK inhibitor, SP600125: JNK inhibitor, SB203580: p38 inhibitor

The MAPK Pathway Is Activated By BCKA To Induce ALI

In line with the in vitro findings, treatment with U0126 and SP600125 significantly inhibited the increase in inflammation score, LDH activity, lung wet-to-dry ratio, and total protein levels in BALF in ALI mice (Fig. 9A–E). Moreover, U0126 and SP600125 restored the BCKA-aggravated decrease in lung compliance (Fig. 9F). U0126 and SP600125 also recovered the alterations of IL-1β and IL-6 levels induced by BCKA (Fig. 9G–H). The accumulation of total cells, macrophages, and neutrophils in BALF observed in BCKA-treated ALI mice was reversed by U0126 and SP600125 (Fig. 9I–K). Furthermore, we found that U0126 and SP600125 inhibited the increase of MPO induced by BCKA in mice with ALI (Fig. 9L). Taken together, these findings demonstrate that defective BCAA catabolism sensitizes the lung to acute injury through activation of the MAPK pathway.

Fig. 9.

Fig. 9

The MAPK pathway is activated by BCKA to induce ALI. (A) Lung sections of mice were stained using H&E staining. Representative images of the staining are shown (Bar = 100 μm). (B) Inflammation score (based on H&E staining) expressed on a numerical scale (n = 5). (C) BALF was collected and assayed for LDH activity (n = 5). (D) Lung wet-to-dry ratio (n = 5). (E) Total proteins in BALF (n = 5). (F) Pulmonary function as assessed by lung compliance (n = 5). (G-H) The mRNA expression of Il-1β and Il-6 in the lung tissue was determined by real-time PCR (n = 5). (I-K) The numbers of total cells, macrophages, and neutrophils were determined in BALF (n = 5). (L) MPO activity in the lungs (n = 5). * P<0.05, ** P<0.01, and *** P<0.001.

Discussion

The pathogenesis of ALI remains incompletely understood. This study highlights the essential role of defective BCAA catabolism in the pathogenesis of ALI. First, we observed that BCKAs were elevated in ALI mice and positively correlated with LPS-induced ALI. Inhibition of BCKDK by BT2 ameliorates LPS-induced ALI by reducing inflammation and oxidative stress in mice. By contrast, BCKA supplementation enhanced susceptibility to inflammation, oxidative stress, and ALI in response to LPS in vivo. In addition, our in vitro data show that inhibiting BCKDK could alleviate inflammation and oxidative stress in LPS-induced primary macrophages, while supplementation with BCKA has the opposite effect. We further revealed that defective BCAA catabolism exacerbated LPS-induced ALI by activating the MAPK pathway. These results suggest that targeting BCAA catabolism could be a valuable therapeutic approach for treating ALI (Fig. 10).

Fig. 10.

Fig. 10

Impaired BCAA catabolism contributes to ALI by triggering oxidative stress and inflammatory response via the MAPK pathway

Disturbances in BCAA metabolism are associated with various diseases, including diabetes, cancer, heart failure, and mechanical pain [3436]. Under physiological conditions, the intake and excretion of BCAAs are maintained at relatively constant levels [37]. Several studies have shown elevated plasma BCAA/BCKA levels in patients with heart failure and sepsis. Similarly, our findings demonstrate altered circulating BCKA levels in animal models of ALI, with a positive correlation between plasma BCKA levels and ALI severity, implicating defective BCAA metabolism in ALI progression.

Recent studies have shown that enhancing BCAA metabolism by using BT2 preserves cardiac function under pathological stress and alleviates myocardial ischemia-reperfusion injury [15, 16]. The results obtained from experiments using BT2 demonstrated the regulatory role of defective BCAA catabolism on ALI. In the present study, we found that BT2 decreased pulmonary edema and injury, restored lung function, and improved the survival rate of LPS-challenged ALI mice. Furthermore, BT2 administration alleviated LPS-induced injury, suggesting that enhanced BCAA catabolism protects against ALI progression.

Excessive generation of inflammatory mediators and free radicals is implicated in the pathogenesis of ALI [38, 39]. During ALI, Toll-like receptor activation triggers the phosphorylation and nuclear translocation of NF-κB, leading to the transcription of various inflammatory cytokines [4042]. Targeting inflammation promotes lung tissue repair in ALI [43, 44]. In line with previous findings, we observed increased inflammatory responses in LPS-injured lungs, which were significantly prevented by enhanced BCAA metabolism. This was accompanied by reduced oxidative stress. Interestingly, while BCAA supplementation has been shown to promote pro-inflammatory mediator synthesis and inflammation in neurons [45], we found that BCKA supplementation significantly promoted the activation of macrophages, exacerbating pulmonary inflammation and oxidative stress in ALI mice. These findings suggest that regulating BCAA metabolism could protect against LPS-induced inflammation and oxidative stress in ALI.

The MAPK family, including JNK, ERK1/2, and P38 MAPK, plays a pivotal role in ALI development [24, 33]. MAPK is a threonine/serine kinase that regulates NF-κB-dependent transcription of inflammatory cytokines [46, 47]. Previous studies have demonstrated that inhibiting MAPK phosphorylation exerts anti-inflammatory effects on macrophages. Similarly, MAPK/ERK pathways have been shown to be significantly activated in renal epithelial cells treated with BCAAs [48]. In our study, BCKA treatment significantly increased the phosphorylation of JNK and ERK in primary macrophages. To further investigate the relationship between the MAPK pathway and BCKA-enhanced lung injury, we pretreated cells with U0126 or SP600125, inhibitors of ERK and JNK. Both inhibitors effectively suppressed BCKA-induced inflammation and oxidative stress in primary macrophages in vitro and in lung tissues in vivo.

Although our study effectively reveals the key role of BCAA metabolism defects in acute lung injury, it still has several limitations. Firstly, the research primarily relies on an LPS-induced mouse ALI model. While this model is classic, it cannot fully replicate the complex etiology and heterogeneity of human ALI/ARDS. For instance, lung injury induced by SARS-CoV-2, bacteria, or trauma may involve different mechanisms, so the generalizability of the findings needs further validation across different pathological models. Secondly, although the exploration of molecular mechanisms focuses on the MAPK pathway, the specific upstream events by which defective BCAA metabolism influences this pathway, as well as its crosstalk with other key pathways such as NF-κB, have not been fully elucidated. Our future work will involve a more in-depth investigation.

Furthermore, our findings also yield intriguing implications regarding macrophage metabolic reprogramming under stress. Impaired BCAA catabolism may reduce the metabolic flux of BCKAs into the mitochondrial tricarboxylic acid (TCA) cycle, thereby limiting the availability of acetyl-CoA and succinyl-CoA. Given that impaired oxidative phosphorylation is recognized as a key driver of pro-inflammatory polarization in macrophages [49], it becomes fascinating to investigate the relationship between BCAA metabolism and energy metabolism pathways such as oxidative phosphorylation in macrophages. Studies have shown that enhancing BCAA metabolism promotes anti-inflammatory polarization of macrophages both in vitro and in vivo, while also increasing oxidative phosphorylation in M2 macrophages [50, 51]. This perspective supports our conclusion that BCAA metabolic defects can drive macrophages toward a pro-inflammatory phenotype. Future studies employing stable isotope tracing are warranted to directly quantify the contribution of BCAA oxidation to the overall bioenergetics of macrophages. Understanding whether and how macrophages prioritize BCAA catabolism during metabolic stress may reveal novel targets for restoring immunometabolic homeostasis in ALI.

In summary, our study demonstrates the causal role of BCAA catabolic deficiency in ALI development. Enhancing BCAA catabolism may prevent LPS-induced inflammation, oxidative stress, and ALI in a MAPK-dependent manner. These findings position BCAA catabolic deficiency as both a predictive biomarker and a promising therapeutic target for LPS-induced ALI.

Supplementary Information

Below is the link to the electronic supplementary material.

ESM 1 (123.5KB, pdf)

(PDF 123 KB)

ESM 2 (1.2MB, docx)

(DOCX 1.15 MB)

Author Contributions

XTH and LD designed and performed most of the experiments, analyzed and interpreted the data, and wrote the manuscript. DYX and CYZ performed most of the experiments, analyzed them, and interpreted the data. WL and JTY assisted during the acquisition, analysis, and interpretation of data and revised the manuscript. SYT assisted with data acquisition and revision of the manuscript. XTH and LD are responsible for the integrity of the work as a whole. All authors reviewed and approved the final version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (82100084, 82170853), Guangxi Natural Science Foundation (2024GXNSFAA999056), Key Project of Ningxia Natural Science Foundation (2024AAC02044), and Hunan Provincial Natural Science Foundation of China (2025JJ50523).

Data Availability

Data will be made available on request.

Declarations

Ethics Approval

This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Central South University (XMSB-2024-0011).

Competing interests

The authors declare no competing interests.

Footnotes

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Da-Yan Xiong and Chen-Yu Zhang contributed equally to this work.

References

  • 1.Liu, H., J. Dong, C. Xu, Y. Ni, Z. Ye, Z. Sun, H. Fan, and Y. Chen. 2025. Acute lung injury: Pathogenesis and treatment. Journal of Translational Medicine 23 (1): 926. 10.1186/s12967-025-06994-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Li, S., W. Zhuang, Y. Wang, H. Qin, X. Qin, X. Yan, X. Hu, X. Liu, and C. Chen. 2025. CXCR1 depletion in Ly6C(+) cDC2 alleviates acute lung injury via modulation of Th17/Treg balance. Advanced Science: e06287. 10.1002/advs.202506287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zhong, W. J., J. Zhang, J. X. Duan, C. Y. Zhang, S. C. Ma, Y. S. Li, N. S. Yang, H. H. Yang, J. B. Xiong, C. X. Guan, Z. X. Jiang, Z. J. You, and Y. Zhou. 2023. TREM-1 triggers necroptosis of macrophages through mTOR-dependent mitochondrial fission during acute lung injury. J Transl Med 21(1):179. 10.1186/s12967-023-04027-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Zhang, J., Y. Guo, M. Mak, and Z. Tao. 2024. Translational medicine for acute lung injury. Journal of Translational Medicine 22 (1): 25. 10.1186/s12967-023-04828-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sha, H. X., Y. B. Liu, Y. L. Qiu, W. J. Zhong, N. S. Yang, C. Y. Zhang, J. X. Duan, J. B. Xiong, C. X. Guan, and Y. Zhou. 2024. Neutrophil extracellular traps trigger alveolar epithelial cell necroptosis through the cGAS-STING pathway during acute lung injury in mice. International Journal of Biological Sciences 20(12):4713–4730. 10.7150/ijbs.99456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Blair, M.C., M.D. Neinast, C. Jang, Q. Chu, J.W. Jung, J. Axsom, M.R. Bornstein, C. Thorsheim, K. Li, A. Hoshino, S. Yang, R.J. Roth Flach, B.B. Zhang, J.D. Rabinowitz, and Z. Arany. 2023. Branched-chain amino acid catabolism in muscle affects systemic BCAA levels but not insulin resistance. Nature Metabolism 5 (4): 589–606. 10.1038/s42255-023-00794-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.McGarrah, R. W., and P. J. White. 2023. Branched-chain amino acids in cardiovascular disease. Nature Reviews. Cardiology 20(2):77–89. 10.1038/s41569-022-00760-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Yao, C. C., R. M. Sun, Y. Yang, H. Y. Zhou, Z. W. Meng, R. Chi, L. L. Xia, P. Ji, Y. Y. Chen, G. Q. Zhang, H. P. Sun, S. Lu, C. Yang, and Y. Wang. 2023. Accumulation of branched-chain amino acids reprograms glucose metabolism in CD8(+) T cells with enhanced effector function and anti-tumor response. Cell Rep 42(3):112186. 10.1016/j.celrep.2023.112186 [DOI] [PubMed] [Google Scholar]
  • 9.Lai, C. C., W. L. Liu, and C. M. Chen. 2014. Glutamine attenuates acute lung injury caused by acid aspiration. Nutrients 6(8):3101–3116. 10.3390/nu6083101 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mokra, D., I. Porvaznik, and J. Mokry. 2025. N-Acetylcysteine in the treatment of acute lung injury: Perspectives and limitations. International Journal of Molecular Sciences. 10.3390/ijms26062657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Garcia, B., E.N. Makiyama, G.R. Sampaio, R.A.M. Soares-Freitas, A. Bonvini, A.G. Amaral, S. Bordin, R.A. Fock, and M.M. Rogero. 2024. Effects of branched-chain amino acids on the inflammatory response induced by LPS in Caco-2 cells. Metabolites. 10.3390/metabo14010076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Liu, Y., X. Wang, J. Wei, K. Fu, Y. Chen, L. Li, Z. Wang, and L. Yang. 2024. Comprehensive profiling of amino acids and derivatives in biological samples: A robust UHPLC-MS/MS method for investigating acute lung injury. Journal of Chromatography A 1721:464816. 10.1016/j.chroma.2024.464816 [DOI] [PubMed] [Google Scholar]
  • 13.Dimou, A., V. Tsimihodimos, and E. Bairaktari. 2022. The critical role of the branched chain amino acids (BCAAs) catabolism-regulating enzymes, branched-chain aminotransferase (BCAT) and branched-chain α-keto acid dehydrogenase (BCKD), in human pathophysiology. International Journal of Molecular Sciences. 10.3390/ijms23074022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Xie, H., J. Li, N. Lian, M. Xie, M. Wu, K. Tang, Y. Kang, P. Lu, and T. Li. 2023. Defective branched-chain amino acid catabolism in dorsal root ganglia contributes to mechanical pain. Embo Reports 24(11):e56958. 10.15252/embr.202356958 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Lian, K., X. Guo, Q. Wang, Y. Liu, R. T. Wang, C. Gao, C. Y. Li, C. X. Li, and L. Tao. 2020. PP2Cm overexpression alleviates MI/R injury mediated by a BCAA catabolism defect and oxidative stress in diabetic mice. European Journal of Pharmacology 866:172796. 10.1016/j.ejphar.2019.172796 [DOI] [PubMed] [Google Scholar]
  • 16.Ericksen, R. E., S. L. Lim, E. McDonnell, W. H. Shuen, M. Vadiveloo, P. J. White, Z. Ding, R. Kwok, P. Lee, G. K. Radda, H. C. Toh, M. D. Hirschey, and W. Han. 2019. Loss of BCAA catabolism during carcinogenesis enhances mTORC1 activity and promotes tumor development and progression. Cell Metab 29(5):1151–1165e1156. 10.1016/j.cmet.2018.12.020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chen, Y., S. Jiang, H. Wang, M. Si, H. Wu, X. Liang, S. Yao, Y. Zhang, X. Wen, and J. Yang. 2025. The probiotic Parabacteroides johnsonii ameliorates metabolic disorders through promoting BCAAs to BSCFAs conversion. Advanced Science: e02624. 10.1002/advs.202502624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Deng, X., C. Tang, T. Fang, T. Li, X. Li, Y. Liu, X. Zhang, B. Sun, H. Sun, and L. Chen. 2025. Disruption of branched-chain amino acid homeostasis promotes the progression of DKD via enhancing inflammation and fibrosis-associated epithelial-mesenchymal transition. Metabolism 162:156037. 10.1016/j.metabol.2024.156037 [DOI] [PubMed] [Google Scholar]
  • 19.Lai, K., C. Song, M. Gao, Y. Deng, Z. Lu, N. Li, and Q. Geng. 2023. Uridine alleviates sepsis-induced acute lung injury by inhibiting ferroptosis of macrophage. International Journal of Molecular Sciences. 10.3390/ijms24065093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhong, W. J., T. Liu, H. H. Yang, J. X. Duan, J. T. Yang, X. X. Guan, J. B. Xiong, Y. F. Zhang, C. Y. Zhang, Y. Zhou, and C. X. Guan. 2023. TREM-1 governs NLRP3 inflammasome activation of macrophages by firing up Glycolysis in acute lung injury. International Journal of Biological Sciences 19(1):242–257. 10.7150/ijbs.77304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen, R., C. Cao, H. Liu, W. Jiang, R. Pan, H. He, K. Ding, and Q. Meng. 2022. Macrophage Sprouty4 deficiency diminishes sepsis-induced acute lung injury in mice. Redox Biology 58:102513. 10.1016/j.redox.2022.102513 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.van der Velden, S., T. L. J. van Osch, A. Seghier, A. E. H. Bentlage, J. Y. Mok, D. M. Geerdes, W. J. E. van Esch, R. B. Pouw, M. C. Brouwer, I. Jongerius, M. de Haas, L. Porcelijn, C. E. van der Schoot, G. Vidarsson, and R. Kapur. 2024. Complement activation drives antibody-mediated transfusion-related acute lung injury via macrophage trafficking and formation of NETs. Blood 143(1):79–91. 10.1182/blood.2023020484 [DOI] [PubMed] [Google Scholar]
  • 23.Huang, X. T., W. Liu, Y. Zhou, M. Sun, H. H. Yang, C. Y. Zhang, and S. Y. Tang. 2020. Galectin-1 ameliorates lipopolysaccharide-induced acute lung injury via AMPK-Nrf2 pathway in mice. Free Radical Biology and Medicine 146:222–233. 10.1016/j.freeradbiomed.2019.11.011 [DOI] [PubMed] [Google Scholar]
  • 24.Xu, Y., C. Zhang, D. Cai, R. Zhu, and Y. Cao. 2023. Exosomal miR-155-5p drives widespread macrophage M1 polarization in hypervirulent Klebsiella pneumoniae-induced acute lung injury via the MSK1/p38-MAPK axis. Cellular & Molecular Biology Letters 28 (1): 92. 10.1186/s11658-023-00505-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hong, H., S. Lou, F. Zheng, H. Gao, N. Wang, S. Tian, G. Huang, and H. Zhao. 2022. Hydnocarpin D attenuates lipopolysaccharide-induced acute lung injury via MAPK/NF-κB and Keap1/Nrf2/HO-1 pathway. Phytomedicine 101:154143. 10.1016/j.phymed.2022.154143 [DOI] [PubMed] [Google Scholar]
  • 26.Chen, C., L. Li, X. Liu, D. Zhang, Y. Liu, and Y. Li. 2023. 23-O-acetylshengmanol-3-O-α-L-arabinoside alleviates lipopolysaccharide-induced acute lung injury through inhibiting IκB/NF-κB and MAPK/AP-1 signaling pathways. Journal of Ethnopharmacology 300:115725. 10.1016/j.jep.2022.115725 [DOI] [PubMed] [Google Scholar]
  • 27.Li, Z., H. Pan, J. Yang, D. Chen, Y. Wang, H. Zhang, and Y. Cheng. 2023. Xuanfei baidu formula alleviates impaired mitochondrial dynamics and activated NLRP3 inflammasome by repressing NF-κB and MAPK pathways in LPS-induced ALI and inflammation models. Phytomedicine 108: 154545. 10.1016/j.phymed.2022.154545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pei, X., Z. Zhang, N. Wang, G. Huang, X. Min, Y. Yang, and J. Cao. 2023. Onychiol B attenuates lipopolysaccharide-induced inflammation via MAPK/NF-κB pathways and acute lung injury in vivo. Bioorganic Chemistry 132:106351. 10.1016/j.bioorg.2023.106351 [DOI] [PubMed] [Google Scholar]
  • 29.Shi, J. W., Z. Z. Lai, W. J. Zhou, H. L. Yang, T. Zhang, J. S. Sun, J. Y. Zhao, and M. Q. Li. 2024. TNFSF14(+) natural killer cells prevent spontaneous abortion by restricting leucine-mediated decidual stromal cell senescence. Embo Journal 43(21):5018–5036. 10.1038/s44318-024-00220-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Xu, M., D. Hu, X. Liu, Z. Li, and L. Lu. 2025. Branched-chain amino acids and inflammation management in endurance sports: Molecular mechanisms and practical implications. Nutrients. 10.3390/nu17081335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Zhang, C. Y., A. J. Ou, L. Jin, N. S. Yang, P. Deng, C. X. Guan, X. T. Huang, J. X. Duan, and Y. Zhou. 2024. Cadmium exposure triggers alveolar epithelial cell pyroptosis by inducing mitochondrial oxidative stress and activating the cGAS-STING pathway. Cell Commun Signal 22(1):566. 10.1186/s12964-024-01946-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Wang, G. Y., X. Xu, D. Y. Xiong, L. Deng, W. Liu, and X. T. Huang. 2024. CPT1A as a potential therapeutic target for lipopolysaccharide-induced acute lung injury in mice. Scientific Reports 14(1):1600. 10.1038/s41598-024-52042-2 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhou, M., L. Meng, Q. He, C. Ren, and C. Li. 2024. Valsartan attenuates LPS-induced ALI by modulating NF-κB and MAPK pathways. Frontiers in Pharmacology 15:1321095. 10.3389/fphar.2024.1321095 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Zhou, Z. Y., K. Song, Z. Y. Liu, Y. F. Ke, Y. Shi, K. Cai, R. Zhao, X. Sun, H. Tao, and J. Y. Zhao. 2024. Branched-chain amino acids deficiency promotes diabetic cardiomyopathy by activating autophagy of cardiac fibroblasts. Theranostics 14(19):7333–7348. 10.7150/thno.102708 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fine, K. S., J. T. Wilkins, and K. T. Sawicki. 2024. Circulating branched chain amino acids and cardiometabolic disease. J Am Heart Assoc 13(7):e031617. 10.1161/JAHA.123.031617 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ren, Y. M., Z. Y. Zhuang, Y. H. Xie, P. J. Yang, T. X. Xia, Y. L. Xie, Z. H. Liu, Z. R. Kang, X. X. Leng, S. Y. Lu, L. Zhang, J. X. Chen, J. Xu, E. H. Zhao, Z. Wang, M. Wang, Y. Cui, J. Tan, Q. Liu, W. H. Jiang, H. Xiong, J. Hong, Y. X. Chen, H. Y. Chen, and J. Y. Fang. 2024. BCAA-producing clostridium symbiosum promotes colorectal tumorigenesis through the modulation of host cholesterol metabolism. Cell Host & Microbe 32(9):1519–1535e1517. 10.1016/j.chom.2024.07.012 [DOI] [PubMed] [Google Scholar]
  • 37.Mansoori, S., M. Y. Ho, K. K. Ng, and K. K. Cheng. 2025. Branched-chain amino acid metabolism: Pathophysiological mechanism and therapeutic intervention in metabolic diseases. Obesity Reviews 26(2):e13856. 10.1111/obr.13856 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Muhammad, W., J. Zhu, Z. Zhai, J. Xie, J. Zhou, X. Feng, B. Feng, Q. Pan, S. Li, R. Venkatesan, P. Li, H. Cao, and C. Gao. 2022. ROS-responsive polymer nanoparticles with enhanced loading of dexamethasone effectively modulate the lung injury microenvironment. Acta Biomaterialia 148:258–270. 10.1016/j.actbio.2022.06.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Wang, K., M. Wang, X. Liao, S. Gao, J. Hua, X. Wu, Q. Guo, W. Xu, J. Sun, Y. He, Q. Li, and W. Gao. 2022. Locally organised and activated Fth1(hi) neutrophils aggravate inflammation of acute lung injury in an IL-10-dependent manner. Nature Communications 13(1):7703. 10.1038/s41467-022-35492-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Millar, M.W., F. Fazal, and A. Rahman. 2022. Therapeutic targeting of NF-κB in acute lung injury: A double-edged sword. Cells. 10.3390/cells11203317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Qu, L., Y. Li, C. Chen, T. Yin, Q. Fang, Y. Zhao, W. Lv, Z. Liu, Y. Chen, and L. Shen. 2022. Caveolin-1 identified as a key mediator of acute lung injury using bioinformatics and functional research. Cell Death and Disease 13(8):686. 10.1038/s41419-022-05134-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Sun, B., L. Bai, Q. Li, Y. Sun, M. Li, J. Wang, X. Shi, and M. Zhao. 2024. Knockdown of angiopoietin-like 4 suppresses sepsis-induced acute lung injury by blocking the NF-κB pathway activation and hindering macrophage M1 polarization and pyroptosis. Toxicology in Vitro 94:105709. 10.1016/j.tiv.2023.105709 [DOI] [PubMed] [Google Scholar]
  • 43.Li, J., K. Lu, F. Sun, S. Tan, X. Zhang, W. Sheng, W. Hao, M. Liu, W. Lv, and W. Han. 2021. Panaxydol attenuates ferroptosis against LPS-induced acute lung injury in mice by Keap1-Nrf2/HO-1 pathway. Journal of Translational Medicine 19 (1): 96. 10.1186/s12967-021-02745-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Yuan, R., Y. Li, S. Han, X. Chen, J. Chen, J. He, H. Gao, Y. Yang, S. Yang, and Y. Yang. 2022. Fe-curcumin nanozyme-mediated reactive oxygen species scavenging and anti-inflammation for acute lung injury. ACS Central Science 8 (1): 10–21. 10.1021/acscentsci.1c00866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Feijó, G. D. S., J. Jantsch, L. L. Correia, S. Eller, O. V. Furtado-Filho, M. Giovenardi, M. Porawski, E. Braganhol, and R. P. Guedes. 2022. Neuroinflammatory responses following zinc or branched-chain amino acids supplementation in obese rats. Metabolic Brain Disease 37(6):1875–1886. 10.1007/s11011-022-00996-5 [DOI] [PubMed] [Google Scholar]
  • 46.Jiang, F. W., J. Y. Guo, J. Lin, S. Y. Zhu, X. Y. Dai, M. A. U. Saleem, Y. Zhao, and J. L. Li. 2024. MAPK/NF-κB signaling mediates atrazine-induced cardiorenal syndrome and antagonism of lycopene. Science of the Total Environment 922:171015. 10.1016/j.scitotenv.2024.171015 [DOI] [PubMed] [Google Scholar]
  • 47.Chen, Y., W. Lin, L. Zhong, Z. Fang, B. Ye, Z. Wang, N. Chattipakorn, W. Huang, G. Liang, and G. Wu. 2023. Bicyclol attenuates obesity-induced cardiomyopathy via inhibiting NF-κB and MAPK signaling pathways. Cardiovascular Drugs and Therapy 37 (6): 1131–1141. 10.1007/s10557-022-07356-6. [DOI] [PubMed] [Google Scholar]
  • 48.Yamamoto, J., S. Nishio, F. Hattanda, D. Nakazawa, T. Kimura, M. Sata, M. Makita, Y. Ishikawa, and T. Atsumi. 2017. Branched-chain amino acids enhance cyst development in autosomal dominant polycystic kidney disease. Kidney International 92(2):377–387. 10.1016/j.kint.2017.01.021 [DOI] [PubMed] [Google Scholar]
  • 49.Chen, S., X. Liu, W. Zhang, B. Li, F. Liu, Y. Zhang, and Y. Han. 2025. Nanozyme coating-mediated mitochondrial metabolic reprogramming of macrophages for immunomodulatory osseointegration in rheumatoid arthritis case. ACS Nano 19 (28): 26127–26146. 10.1021/acsnano.5c07535. [DOI] [PubMed] [Google Scholar]
  • 50.Lu, M., D. Luo, Z. Zhang, F. Ouyang, Y. Shi, C. Hu, H. Su, Y. Li, J. Zhang, Q. Gui, and T. S. Yang. 2024. Branched-chain amino acid catabolism promotes M2 macrophage polarization. Frontiers in Immunology 15:1469163. 10.3389/fimmu.2024.1469163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zhao, S., L. Zhou, Q. Wang, J. H. Cao, Y. Chen, W. Wang, B. D. Zhu, Z. H. Wei, R. Li, C. Y. Li, G. Y. Zhou, Z. J. Tan, H. P. Zhou, C. X. Li, H. K. Gao, X. J. Qin, and K. Lian. 2023. Elevated branched-chain amino acid promotes atherosclerosis progression by enhancing mitochondrial-to-nuclear H(2)O(2)-disulfide HMGB1 in macrophages. Redox Biology 62:102696. 10.1016/j.redox.2023.102696 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

ESM 1 (123.5KB, pdf)

(PDF 123 KB)

ESM 2 (1.2MB, docx)

(DOCX 1.15 MB)

Data Availability Statement

Data will be made available on request.


Articles from Inflammation are provided here courtesy of Springer

RESOURCES