Abstract
Background: Duffy-negative individuals were long considered resistant to Plasmodium vivax, yet emerging infections challenge this assumption, underscoring the need to examine Duffy antigen receptor for chemokines (DARC) gene polymorphisms and clarify evolving susceptibility patterns. Objective: This study investigated the association between DARC genetic variants and susceptibility to P. vivax infection to elucidate transmission patterns and explain the rising incidence of P. vivax infection in Sudan. Methods: A total of 405 participants were recruited for the study, including 202 patients with a confirmed diagnosis of P. vivax malaria and 203 blood donors serving as the control group. DNA was extracted from the peripheral blood, and DARC polymorphic variants were analyzed using polymerase chain reaction- sequence specific primer (PCR-SSP). Results: The study showed that the Duffy-negative homozygous genotype FYBES/FYBES was present in both P. vivax-infected patients and the control group; however, it was significantly more frequent in healthy blood donors. The frequencies of the homozygous FYB/FYB genotype and the two heterozygous genotypes FYB/FYA and FYB/FYBES were substantially higher among the patients with P. vivax malaria than in the control group. The homozygous genotype FYA/FYA was more frequent among P. vivax malaria patients, while the heterozygous genotype FYA/FYBES was more common in the control group; however, the differences were not statistically significant. The FYAES allele was not detected in either group. Conclusion: There was a potential association between FYA and FYB alleles and susceptibility to P. vivax infection. The FYBES allele confers partial resistance to P. vivax malaria, as some infected individuals were found to carry the homozygous Duffy-negative genotype (FYBES/ FYBES).
Keywords: Plasmodium vivax, Duffy antigen receptor for chemokines, Malaria
1. BACKGROUND
The Duffy antigens are blood group antigens, mainly present on the surface of red blood cells, but also expressed in endothelial cells and neurons (1). In addition to their role in transfusion reactions and hemolytic disease of newborns, they have garnered significant attention in the field of medicine due to their association with the invasion of the malaria parasite Plasmodium vivax (P. vivax) into red blood cells. Furthermore, they serve as receptors for several chemokines, playing a crucial role in regulating inflammatory processes (2).
The Duffy antigen receptor for chemokine (DARC) gene, also referred to as FY or Duffy, is a single-copy gene located on the long arm of chromosome 1, comprising two exons that span approximately 1,500 bases and encode a protein of 336 amino acids (3). Polymorphisms within this gene are responsible for the Duffy blood group system, presenting as antigenic variant forms, namely Fya and Fyb antigens, which are distinguished by a single amino acid substitution (Gly42Asp) (4). The two main alleles, FYA and FYB, exhibit marked geographical variations, with FYB being highly prevalent in Africa and FYA dominating in Asia (5).
A substitution (T to C) within the promoter region, at nucleotide -33 in the GATA box, disrupts the expression of the Duffy gene and results in the absence of Duffy antigens, particularly in erythroid cells (6). This variant is often associated with an FYB allele, denoted as FYBES (ES: Erythroid Silent). A similar mutation has also been observed with the FYA allele, referred to as T46C, resulting in the FYAES allele (7). Furthermore, a rare FYX allele is found among white people and is defined as a weak Fyb antigen that is not detectable by all anti-Fyb antibodies (8).
The four alleles (FYA, FYB, FYAES, and FYBES) contribute to a total of ten genotypes: FYA/FYA, FYA/FYB, FYA/FYAES, FYA/FYBES, FYB/FYB, FYB/FYAES, FYB/FYBES, FYAES/FYAES, FYAES/FYBES, FYBES/FYBES. The last three give rise to the Fy (a-, b-) phenotype, which was thought to be responsible for resistance to P. vivax malaria (9,10). This phenotype is predominant across sub-Saharan Africa, where the genotype FYBES is the most predominant DARC allele (5).
Demographic factors, such as ancient migration events and fluctuations in population size, have played a pivotal role in shaping the genetic diversity of African populations across their entire genome. Simultaneously, evolutionary forces, including natural selection and mutations, have influenced specific genetic loci within these populations. Malaria, a globally significant infectious disease, has had a profound impact on human evolution; it is widely recognized that malaria has contributed to the increased prevalence of unique hemoglobin variants like hemoglobin S (Hb-S), hemoglobin C (Hb-C), hemoglobin E (Hb-E), as well as variations in the Duffy blood group system (11).
Plasmodium vivax is the most geographically distributed Plasmodium species; it is mainly endemic in Southeast Asia and Latin America, but its presence is also reported in the Horn of Africa (12). In Sudan, in recent years, P. vivax infection has begun to rise and emerge in new, previously unaffected areas (13). A survey conducted in Khartoum, the capital of Sudan, in the year 2000 reported relatively high percentages of P. vivax (6.9%); another study in 2019 revealed a higher prevalence of P. vivax (8.2%). The rising prevalence has been attributed to the presence of refugees and proximity to endemic neighboring countries (14,15). Furthermore, the African continent possesses both the ideal temperature and highly competent vectors for P. vivax transmission (16).
Although experimental and epidemiological studies have established that Duffy blood group-negative individuals, primarily of African descent, are resistant to P. vivax infection, several reports have provided evidence for the incidence of P. vivax malaria among Duffy-negative subjects. This suggests the existence of P. vivax strains with acquired Duffy-independent mechanisms for erythrocyte invasion (17).
2. OBJECTIVE
This study investigated the association between the genetic variants of the DARC and Plasmodium vivax infection among the Sudanese population to elucidate the transmission pattern and explain the rising incidence of Plasmodium vivax malaria in Sudan.
3. PATIENTS AND METHODS
Participants
This is a case-control study in which a total of 405 Sudanese subjects were enrolled: 202 patients with clinical features of malaria and positive results of blood films and molecular diagnosis for P. vivax infection, and 203 healthy blood donors with negative blood films and molecular diagnosis for P. vivax malaria, serving as the control group.
Molecular analysis
Genomic DNA was extracted from the peripheral blood, and DARC polymorphic variants were identified among the two study groups using the Polymerase Chain Reaction-Sequence-Specific Primer (PCR-SSP) technique, as described by Nathalang et al. (18), with four sets of primers.
PCR products were separated on a 1.5% ethidium bromide-stained agarose gel and visualized using a gel documentation system (SYNGENE, JAPAN). A 100 bp DNA ladder was run with each batch of samples.
Statistical analysis
The data were analyzed using the Statistical Package for Social Sciences (SPSS), version 21. The distribution of the genotypic variants and frequencies of DARC alleles were compared in P. vivax-infected patients and healthy blood donors using Chi-square and Fisher's exact tests.
Ethical considerations
This study was approved by Al Neelain University Ethical Review Board (ERB). All methods were performed in accordance with the national guidelines for the ethical conduct of research involving human subjects (2008). Informed consent was obtained from each participant before sample collection.
4. RESULTS
Distribution of DRAC genotypic variants
The results showed that FYB/FYBES was the most frequent genotype among P. vivax-infected patients, followed by FYBES/FYBES, FYA/FYB, FYA/FYBES, FYB/FYB, and FYA/FYA genotypes consequently. Among the control group, the genotype FYBES/FYBES was the most frequent, followed by FYB/FYBES, FYA/FYBES, FYB/FYB, FYA/FYA, and FYA/FYB genotypes, in that order. The negative Duffy genotype (FYBES/FYBES) was identified in both study groups. However, it was more frequent among blood donors than P. vivax-infected patients, and the difference was statistically significant.
The frequencies of the two genotypes FYB/FYA and FYB/FYBES were significantly higher among the control group. Although the two genotypes FYA/FYA and FYB/FYB were more predominant among the P. vivax-infected individuals, and the genotype FYA/FYBES was more frequent among the control group, the difference was not statistically significant for the genotypes FYA/FYA and FYA/FYBES. The FYAES allele was not detected in the two study groups, resulting in the absence of the Duffy-negative FYAES/ FYAES and related genotypes (FYAES/FYB, FYA/ FYAES, and FYAES/ FYBES) in both P. vivax-infected and healthy controls (Table 1).
Table 1. Primer sequences for genotyping of the DARC gene.
| Allele | Primer | Primer sequences | Product size (bp) |
|---|---|---|---|
| FYAES | GATA-AB-F | CTCATTAGTCCTTGGCTCTTAC | 711 |
| FY-A-R | AGCTGCTTCCAGGTTGGCAC | ||
| FYBES | GATA-AB-F | CTCATTAGTCCTTGGCTCTTAC | 711 |
| FY-B-R | AGCTGCTTCCAGGTTGGCAT | ||
| FYA | FY-AB-F | CTCATTAGTCCTTGGCTCTTAT | 711 |
| FY-A-R | AGCTGCTTCCAGGTTGGCAC | ||
| FYB | FY-AB-F | CTCATTAGTCCTTGGCTCTTAT | 711 |
| FY-B-R | AGCTGCTTCCAGGTTGGCAT |
Figure 1. Frequency of FYA, FYB, and FYBES alleles.
Allelic frequencies
The frequencies of the FYA and FYB alleles were significantly higher among the P. vivax-infected patients than in the control group, whereas the frequency of the Duffy-negative allele FYBES was significantly higher among the control group (Table 2)
Table 2. Distribution of DARC genotypes among the study population.
| Genotype | Patients N (%) |
Control N (%) |
P.value |
|---|---|---|---|
| FYB / FYB | 24 (11.9%) | 7 (03.4%) | 0.005 |
| FYA / FYA | 10 (05.0%) | 5 (02.5%) | >0.25 |
| FYBES/ FYBES | 43 (21.3%) | 100 (49.2%) | <0.001* |
| FYB / FYA | 32(15.8%) | 3 (01.5%) | <0.001* |
| FYB / FYBES | 65 (32.0%) | 59 (29.1%) | <0.05* |
| FYA /FYBES | 28 (13.9%) | 29 (14.3%) | >0.5 |
5. DISCUSSION
The absence of Duffy blood group antigens on the red blood cell surface was previously believed to confer resistance to P. vivax malaria in Africans, but infections have been reported in Duffy-negative individuals in several Central and East African countries (19).
This study investigated the association between DARC polymorphisms and susceptibility to P. vivax infection among the Sudanese population to elucidate the transmission pattern and explain the rising incidence of P. vivax malaria in recent years.
The results revealed a significantly higher frequency of the Duffy-negative genotype (FYBES/FYBES) among healthy blood donors compared to P. vivax-infected subjects (49.2% vs. 21.3%). This finding suggests a potential association between the FYBES/FYBES genotype and resistance or reduced susceptibility to P. vivax malaria among the Sudanese. This observation is consistent with a previous study conducted in Brazil, which also demonstrated a higher frequency of the FYBES allele among blood donors compared to malaria patients, indicating a lower infection rate among carriers of the FYBES allele (20).
Furthermore, field observations in Papua New Guinea and Ethiopia have established a strong association between the absence or low endemicity of P. vivax malaria and the high prevalence of the Duffy negative allele (21, 22). These findings support the fact that Duffy negativity, at least in part, serves as a barrier to the parasite (23). On the other hand, our finding that the Duffy-negative genotype FYBES/FYBES is detected in a proportion of P. vivax-infected individuals indicates that infection can occur in Duffy-negative individuals in Sudan. Similar findings have been reported in various African countries and the Amazon region of Brazil (20, 22-29). In contrast to our findings, a study in different ethnic groups of Choco, Colombia, reported an absence of P. vivax infection in Duffy-negative individuals (30). Discrepancies in results may be due to the extensive genetic diversity of P. vivax in Sudan and the presence of genetic variants of the parasite in some regions of the world that have evolved alternative invasion mechanisms capable of overcoming Duffy's negativity (19, 31).
In the current study, we found significantly higher frequencies of FYB/FYB, FYA/FYB, and FYB/FYBES genotypes in P. vivax-infected patients compared to the control group. The FYA/FYBES genotype was more common in the control group; however, the difference was not statistically significant. In addition, our findings revealed significantly high frequencies for both FYA and FYB alleles in P. vivax-infected patients, while the frequency of the FYBES allele was significantly higher in the control group. These findings suggest that the FYA and FYB alleles are associated with susceptibility to P. vivax infection, but susceptibility may be reduced when the Duffy-negative allele FYBES is present along with the FYA allele.
These findings are consistent with a study in Brazil that showed a reduction in the risk of clinical P. vivax malaria of 19% for subjects with the heterozygous FYA/FYBES genotype while the FYB/FYBES individuals showed a greater risk (26%) of clinical malaria compared with those with the reference genotype FYA/FYB; the reduced susceptibility associated with the FYA/FYBES heterozygous genotype has been attributed to the fact that FYA/FYBES cells express approximately half the levels of Duffy antigen compared with FYA/FYA cells; furthermore, FYA/FYBES individuals have been reported to have greater chance of acquiring high levels of antibodies against the 19-kDa C-terminal region of the P. vivax merozoite surface protein-1 (9, 32).
In Papua New Guinea, the individuals heterozygous for the FYAES allele showed a significant reduction in P. vivax infections (21). In this study, the FYAES allele was not detected in any of the participants, indicating that the FYAES allele does not contribute to resistance to P. vivax infection among the Sudanese population.
6. conclusion
The study provides a comprehensive overview of the distribution of DRAC alleles in relation to P. vivax infection in the Sudanese population. The findings indicate a potential association between FYA and FYB alleles and susceptibility to P. vivax infection. The FYBES allele confers partial resistance to P. vivax malaria, as a proportion of infected individuals were found to carry the homozygous Duffy-negative genotype (FYBES/FYBES). Further studies are necessary to identify the mechanism that enables Duffy-independent P. vivax invasion of human erythrocytes among the Sudanese.
Patient Consent Form:
All participants were informed about the purpose of the study.
Author's Contribution:
S.A.O. collected patients' data and samples, performed the laboratory analysis, and wrote the primary draft. E.W.A. contributed to the study design, data analysis, and the critical review of the draft. E.A.E. contributed to the study design, supervised the laboratory work, and analyzed and interpreted the laboratory results. O.M. supervised all the research steps and approved the final version.
Conflicts of interest:
There are no conflicts of interest.
Financial support and sponsorship:
None.
REFERENCES
- 1.Peiper SC, Wang ZX, Neote K, Martin AW, Showell HJ, Conklyn MJ, et al. The Duffy antigen/receptor for chemokines (DARC) is expressed in endothelial cells of Duffy negative individuals who lack the erythrocyte receptor. J Exp Med. 1995;181(4):1311–1317. doi: 10.1084/jem.181.4.1311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Smolarek D, Hattab C, Hassanzadeh-Ghassabeh G, Cochet S, Gutiérrez C, de Brevern AG, et al. A recombinant dromedary antibody fragment (VHH or nanobody) directed against human Duffy antigen receptor for chemokines. Cell Mol Life Sci. 2010;67(19):3371–3387. doi: 10.1007/s00018-010-0387-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rot A, Horuk R. Chapter 9 The Duffy antigen receptor for chemokines. Methods Enzymol. 2009;461:191–206. doi: 10.1016/S0076-6879(09)05409-3. [DOI] [PubMed] [Google Scholar]
- 4.Langhi DM Jr, Bordin JO. Duffy blood group and malaria. Hematology. 2006;11(5):389–398. doi: 10.1080/10245330500469841. [DOI] [PubMed] [Google Scholar]
- 5.Howes RE, Patil AP, Piel FB, Nyangiri OA, Kabaria CW, Gething PW, et al. The global distribution of the Duffy blood group. Nat Commun. 2011;2:266. doi: 10.1038/ncomms1265. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Iwamoto S, Li J, Sugimoto N, Okuda H, Kajii E. Characterization of the Duffy gene promoter: evidence for tissue-specific abolishment of expression in Fy(a-b-) of black individuals. Biochem Biophys Res Commun. 1996;222(3):852–859. doi: 10.1006/bbrc.1996.0833. [DOI] [PubMed] [Google Scholar]
- 7.Zimmerman PA, Woolley I, Masinde GL, Miller SM, McNamara DT, Hazlett F, et al. Emergence of FY*A(null) in a Plasmodium vivax-endemic region of Papua New Guinea. Proc Natl Acad Sci USA. 2012;96(24):13973–13977. doi: 10.1073/pnas.96.24.13973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Gassner C, Kraus RL, Dovc T, Kilga-Nogler S, Utz I, Mueller TH, et al. Fyx is associated with two missense point mutations in its gene and can be detected by PCR-SSP. Immunohematology. 2000;16(2):61–67. doi: 10.21307/immunohematology-2019-579. [DOI] [PubMed] [Google Scholar]
- 9.Kano FS, de Souza AM, de Menezes Torres L, Costa MA, Souza-Silva FA, Sanchez BAM, et al. Susceptibility to Plasmodium vivax malaria associated with DARC (Duffy antigen) polymorphisms is influenced by the time of exposure to malaria. Sci Rep. 2018;8(1):13851. doi: 10.1038/s41598-018-32254-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Abou-Ali RK, Dhyani A, Terço AL, Toro DM, Gomes KS, Tezza LC, et al. Impact of Duffy polymorphisms on parasite density in Brazilian Amazonian patients infected by Plasmodium vivax. Malar J. 2019;18(1):289. doi: 10.1186/s12936-019-2918-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Campbell MC, Tishkoff SA. African genetic diversity: implications for human demographic history, modern human origins, and complex disease mapping. Annu Rev Genomics Hum Genet. 2008;9:403–433. doi: 10.1146/annurev.genom.9.081307.164258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Kojom Foko LP, Narang G, Jakhan J, Tamang S, Moun A, Singh V, et al. Nationwide spatiotemporal drug resistance genetic profiling from over three decades in Indian Plasmodium falciparum and Plasmodium vivax isolates. Malar J. 2023;22(1):236. doi: 10.1186/s12936-023-04651-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Abdelraheem MH, Albsheer MMA, Mohamed HS, Amin M, Abdel Hamid MM. Transmission of Plasmodium vivax in Duffy-negative individuals in central Sudan. Trans R Soc Trop Med Hyg. 2016;110(4):258–260. doi: 10.1093/trstmh/trw014. [DOI] [PubMed] [Google Scholar]
- 14.Elgoraish AG, Elzaki SEG, Ahmed RT, Ahmed AI, Fadlalmula HA, Abdalgader Mohamed S, et al. Epidemiology and distribution of Plasmodium vivax malaria in Sudan. Trans R Soc Trop Med Hyg. 2019:trz044. doi: 10.1093/trstmh/trz044. [DOI] [PubMed] [Google Scholar]
- 15.El Sayed BB, Arnot DE, Mukhtar MM, Baraka OZ, Dafalla AA, Elnaiem DE, et al. study of the urban malaria transmission problem in Khartoum. Acta Trop. 2000;75(2):163–171. doi: 10.1016/s0001-706x(99)00098-4. [DOI] [PubMed] [Google Scholar]
- 16.Guerra CA, Howes RE, Patil AP, Gething PW, Van Boeckel TP, Temperley WH, et al. The international limits and population at risk of Plasmodium vivax transmission in 2009. PLoS Negl Trop Dis. 2010;4(8):e774. doi: 10.1371/journal.pntd.0000774. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Popovici J, Roesch C, Rougeron V. The enigmatic mechanisms by which Plasmodium vivax infects Duffy-negative individuals. PLoS Pathog. 2020;16(2):e1008258. doi: 10.1371/journal.ppat.1008258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nathalang O, Intharanut K, Siriphanthong K, Nathalang S, Kupatawintu P. Duffy blood group genotyping in Thai blood donors. Ann Lab Med. 2015;35(6):618–623. doi: 10.3343/alm.2015.35.6.618. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Albsheer MMA, Pestana K, Ahmed S, Elfaki M, Gamil E, Ahmed SM, et al. Distribution of Duffy Phenotypes among Plasmodium vivax Infections in Sudan. Genes (Basel) 2019;10(6):437. doi: 10.3390/genes10060437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Cavasini CE, de Mattos LC, Couto AA, Couto VS, Gollino Y, Moretti LJ, et al. Duffy blood group gene polymorphisms among malaria vivax patients in four areas of the Brazilian Amazon region. Malar J. 2007;6:167. doi: 10.1186/1475-2875-6-167. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kasehagen LJ, Mueller I, Kiniboro B, Bockarie MJ, Reeder JC, Kazura JW, et al. Reduced Plasmodium vivax erythrocyte infection in PNG Duffy-negative heterozygotes. PLoS One. 2007;2(3):e336. doi: 10.1371/journal.pone.0000336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lo E, Yewhalaw D, Zhong D, Zemene E, Degefa T, Tushune K, et al. Molecular epidemiology of Plasmodium vivax and Plasmodium falciparum malaria among Duffy-positive and Duffy-negative populations in Ethiopia. Malar J. 2015;14:84. doi: 10.1186/s12936-015-0596-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Wurtz N, Mint Lekweiry K, Bogreau H, Pradines B, Rogier C, Ould Mohamed Salem Boukhary A, et al. Vivax malaria in Mauritania includes infection of a Duffy-negative individual. Malar J. 2011;10:336. doi: 10.1186/1475-2875-10-336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Ryan JR, Stoute JA, Amon J, Dunton RF, Mtalib R, Koros J, et al. Evidence for transmission of Plasmodium vivax among a Duffy antigen-negative population in Western Kenya. Am J Trop Med Hyg. 2006;75(4):575–581. [PubMed] [Google Scholar]
- 25.Culleton R, Ndounga M, Zeyrek FY, Coban C, Casimiro PN, Takeo S, et al. Evidence for the transmission of Plasmodium vivax in the Republic of the Congo, West Central Africa. J Infect Dis. 2009;200(9):1465–1469. doi: 10.1086/644510. [DOI] [PubMed] [Google Scholar]
- 26.Ménard D, Barnadas C, Bouchier C, Henry-Halldin C, Gray LR, Ratsimbasoa A, et al. Plasmodium vivax clinical malaria is commonly observed in Duffy-negative Malagasy people. Proc Natl Acad Sci USA. 2010;107(13):5967–5971. doi: 10.1073/pnas.0912496107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Dhorda M, Nyehangane D, Rénia L, Piola P, Guerin PJ, Snounou G. Transmission of Plasmodium vivax in south-western Uganda: report of three cases in pregnant women. PLoS One. 2011;6(5):e19801. doi: 10.1371/journal.pone.0019801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Mendes C, Dias F, Figueiredo J, Mora VG, Cano J, de Sousa B, et al. Duffy negative antigen is no longer a barrier to Plasmodium vivax--molecular evidence from the African West Coast (Angola and Equatorial Guinea) PLoS Negl Trop Dis. 2011;5(6):e1192. doi: 10.1371/journal.pntd.0001192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Ngassa Mbenda HG, Das A. Molecular evidence of Plasmodium vivax mono and mixed malaria parasite infections in Duffy-negative native Cameroonians. PLoS One. 2014;9(8):e103262. doi: 10.1371/journal.pone.0103262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Gonzalez L, Vega J, Ramirez JL, Bedoya G, Carmona-Fonseca J, Maestre A. Relationship between genotypes of the Duffy blood groups and malarial infection in different ethnic groups of Choco, Colombia. Colombia Médica (Cali, Colombia) 2012;43(3):189–195. [PMC free article] [PubMed] [Google Scholar]
- 31.Ford A, Kepple D, Abagero BR, Connors J, Pearson R, Auburn S, et al. Whole genome sequencing of Plasmodium vivax isolates reveals frequent sequence and structural polymorphisms in erythrocyte binding genes. PLoS Negl Trop Dis. 2020;14(10):e0008234. doi: 10.1371/journal.pntd.0008234. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.King CL, Adams JH, Xianli J, Grimberg BT, McHenry AM, Greenberg LJ, et al. Fy(a)/Fy(b) antigen polymorphism in human erythrocyte Duffy antigen affects susceptibility to Plasmodium vivax malaria. Proc Natl Acad Sci USA. 2011;108(50):20113–20118. doi: 10.1073/pnas.1109621. [DOI] [PMC free article] [PubMed] [Google Scholar]