Esculin improves wound healing in diabetic rats by modulating extracellular matrix remodeling and molecular pathways

Abstract

Diabetic wounds, marked by poor regeneration, chronic inflammation, and oxidative stress, pose a major challenge in diabetes. Esculin, a natural coumarin with antioxidant and anti-inflammatory effects, shows promise for wound healing. This study investigated the histopathological, biochemical, and molecular effects of topical esculin on full-thickness wounds in streptozotocin-induced diabetic rats. Excisional wounds were created on 60 Sprague-Dawley rats, assigned to four groups: normal control, diabetic control, esculin ointment 5% and 10%. Tissue samples were collected on days 7, 14, and 21 for histopathological, molecular, and biochemical analysis. Esculin treatment significantly accelerated wound closure and improved re-epithelialization and granulation tissue formation. Histological analysis revealed a decrease in lymphocyte infiltration, increased fibroblast proliferation and neovascularization at the earlier stages, and a higher number of fibrocytes and more organized collagen deposition at later stages of wound healing. Biochemically, esculin significantly elevated antioxidant enzyme activities and reduced oxidative stress markers, indicating restoration of redox balance. Moreover, esculin downregulated the pro-inflammatory cytokine IL-1β and upregulated bFGF, VEG), and TGF-β1, thereby supporting fibroblast activity, angiogenesis, and extracellular matrix remodeling. Collectively, these findings highlight the multifaceted role of esculin in promoting wound healing under diabetic conditions, supporting its potential as a promising adjunct therapy for managing chronic wounds.

Introduction

Diabetes mellitus is one of the most significant chronic metabolic disorders, characterized by autoimmune-mediated cell destruction in type 1 diabetes and inadequate compensation for insulin resistance in type 2 diabetes. According to the International Diabetes Federation (IDF), more than 463 million individuals worldwide were affected by diabetes in 2019, with projections indicating an increase to 700 million by 2045¹. Although the pathophysiology of diabetes is multifactorial, chronic hyperglycemia remains its hallmark, initiating a cascade of complications that affect various organ systems, particularly the microvasculature. Diabetic microvascular complications, including nephropathy, retinopathy, neuropathy, and diabetic ulcers, are among the leading causes of morbidity and disability in affected patients^2,3.

Among these complications, diabetic wounds represent a persistent clinical challenge due to the complex interplay between systemic metabolic dysregulation and impaired local tissue responses. Chronic hyperglycemia leads to oxidative stress, endothelial dysfunction, and sustained inflammation, disrupting the tightly coordinated stages of normal wound healing: hemostasis, inflammation, proliferation, and remodeling⁴.

Under physiological conditions, wound healing is initiated by platelet activation upon contact with collagen at the injury site, resulting in the formation of a fibrin clot that serves as a temporary scaffold for cellular infiltration. This matrix supports cell migration and facilitates the release of key signaling molecules, such as cytokines and growth factors. Fibroblasts, as central connective tissue cells, then proliferate and synthesize collagen, playing an essential role in tissue regeneration and structural remodeling during the later stages of repair⁵.

In individuals with diabetes, these tightly regulated processes become significantly impaired. Delayed angiogenesis, fibroblast dysfunction, reduced collagen synthesis, and impaired immune responses contribute to the prolonged presence of wounds and poor tissue regeneration⁶. Moreover, insulin resistance disrupts critical growth factor pathways—particularly involving insulin-like growth factor (IGF), which are essential for cell proliferation and migration⁷. Further complicating this picture, elevated lipid peroxidation and amino acid imbalances contribute to ferroptosis, as well as reduced nitric oxide availability, exacerbating tissue damage and delaying repair. These multifaceted disruptions often result in chronic, non-healing wounds with an elevated risk of infection and lower-limb amputation^8,9.

Despite advances in wound care, pharmacological options for effectively treating chronic wounds, particularly those associated with diabetes, remain limited and often unsatisfactory. This has led to increasing interest in alternative therapeutic approaches that are more accessible, biologically active, and capable of supporting the multifaceted healing process. Herbal medicines, with a long history of use in traditional systems, have gained attention due to their anti-inflammatory, antioxidant, and tissue-regenerative properties, supported by growing experimental evidence¹⁰.

Esculin (6,7-dihydroxycoumarin-6-O-glucoside), a natural coumarin glycoside predominantly found in Aesculus hippocastanum L., commonly known as the horse-chestnut tree, has attracted growing attention due to its broad pharmacological activities that are particularly relevant to tissue repair¹¹. Although no previous research has directly addressed the effect of esculin on wound healing in diabetic conditions, increasing experimental evidence supports its potential relevance to this context.

Notably, esculin exhibits strong antioxidant properties, including scavenging reactive oxygen species (ROS), inhibiting lipid peroxidation, and upregulating antioxidant enzymes such as SOD and GSH in both in vitro and in vivo models^12–14. Since oxidative stress is a major contributor to tissue damage and impaired wound healing, these antioxidant actions are of critical importance. In parallel, esculin exerts significant anti-inflammatory effects by downregulating pro-inflammatory cytokines, such as TNF-α, IL-1β, and IL-6, largely through suppression of NF-κB and Toll-like receptor signaling pathways^15–17. These pathways are known to be persistently activated in chronic diabetic wounds. Furthermore, several studies have reported antidiabetic effects of esculin, including blood glucose reduction, improvement in insulin sensitivity, and mitigation of diabetes-induced organ damage including nephropathy and cardiomyopathy, which are also partly linked to its anti-inflammatory and antioxidant actions¹⁸. More importantly, a recent in vivo study demonstrated that esculin accelerates wound repair in a murine skin injury model by promoting collagen deposition, epithelial proliferation, and angiogenesis via activation of the Wnt/β-catenin pathway¹⁹. In addition, independent studies have demonstrated that coumarin itself significantly accelerates wound healing in tat models by attenuating inflammation, enhancing fibroblast proliferation, stimulating collagen synthesis, and promoting epithelialization²⁰. These findings further support the rationale that coumarin derivatives such as esculin may exert similar or even stronger effects in wound repair.

Taken together, these findings suggest that esculin targets several pathological mechanisms underlying impaired diabetic wound healing—oxidative imbalance, persistent inflammation, defective collagen remodeling, and impaired angiogenesis—and therefore represents a rational candidate for investigation in streptozotocin-induced diabetic wounds.

Accordingly, the present study was designed to evaluate the therapeutic potential of esculin in enhancing wound healing in a streptozotocin-induced diabetic rat model, with a particular emphasis on its histopathological, biochemical, and molecular effects.

Materials and methods

Animals

In this study, sixty male Sprague–Dawley rats (180–200 g) were obtained from the Animal Breeding Center of Kermanshah University of Medical Sciences (Kermanshah, Iran). The animals were housed in polypropylene cages (five per cage; dimensions: 70 × 40 × 25 cm) under controlled temperature (22–24 °C) and humidity (40–50%) with a 12 h light/dark cycle. They had unrestricted access to tap water and a standard laboratory chow containing 70% carbohydrates, 25% proteins, and 5% lipids. Before starting the experimental procedures, animals were acclimatized for 7 days to the housing conditions.

All experimental procedures involving animals were reviewed and approved by the Ethics Committee of Razi University, Kermanshah, Iran (Approval ID: IR.RAZI.AEC.1403.63). All animal experiments were conducted in accordance with the relevant institutional, national, and international guidelines and regulations, including the recommendations of the European Council Directive 86/609/EEC for the protection of animals used for experimental purposes. The study is fully compliant with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments; https://arriveguidelines.org). Efforts were made to minimize the number of animals used and their suffering throughout the study.

This article does not involve any studies with human participants performed by any of the authors.

Preparation of Esculin formulations

Esculin hydrate (purity ≥ 98%, HPLC grade; Merck, Germany; Cat. No. 02350 − 106, CAS No. 531-75-9) was stored under the manufacturer’s recommended conditions until use. For topical application, two concentrations of ointment were prepared by dispersing either 5–10 g of powdered esculin into 95 g–90 g, respectively, of Eucerin base cream. The base cream was gently warmed to 70 °C in a thermostatic water bath to facilitate uniform mixing. The selected concentrations were based on previous topical studies reporting safety and biological activity²¹. The ointment base consisted of pharmaceutical-grade excipients including water, petrolatum, mineral oil, ceresin, lanolin alcohol, panthenol, and glycerin.

Induction of diabetes by streptozotocin in rat

Type 1 diabetes was induced in all animals except for the normal control group by a single intraperitoneal injection of streptozotocin (STZ; Sigma-Aldrich, USA) at a dose of 50 mg/kg dissolved in freshly prepared citrate buffer (pH 4.5). Rats were fasted for 12 h before and after injection. Control animals received an equivalent volume of sterile normal saline. Blood glucose was measured from tail vein samples 72 h post-injection using a glucometer, and rats with levels above 250 mg/dL, accompanied by polyuria and polydipsia, were considered diabetic.

Wound creation

Following confirmation of diabetes, rats were anesthetized by intramuscular injection of xylazine HCl (10 mg/kg; Alfasan, Netherlands) and ketamine HCl (60 mg/kg; TRITTAU, Germany). After shaving the hair over the dorsal cervical area and disinfecting the skin, full-thickness excisional wounds were created under sterile conditions. To ensure uniform wound size, a sterile circular template was used to outline the wound margins, and a circular wound with a diameter of 2 cm was then surgically excised using scissors and forceps, extending through the epidermis and dermis (Fig. 1A). No topical or systemic antimicrobial agents were applied. The wound creation protocol was adapted from Oryan et al. (2015), with modifications in wound shape, size, and follow-up period.

Fig. 1.

Experimental design and representative macroscopic images of wounds. (A) Representative macroscopic images of full-thickness excisional wounds immediately after wound creation (day 0) in the normal control (NC), diabetic control (DC), and diabetic rats treated with 5% (Es 5) or 10% (Es 10) esculin ointment. All wounds were circular with a diameter of approximately 2 cm and were created under standardized conditions. (B) Schematic illustration of the experimental design and treatment protocol. The schematic elements of this figure were created by the authors using Adobe Photoshop CS5 (Adobe Systems Inc., USA).

Study design

The rats were randomly allocated into four main treatment groups (n = 15): normal control, diabetic control, 5%esculin ointment, and 10% esculin ointment. No material was used in the wound area of rats in the normal and diabetic control groups. In the esculin 5% and 10% groups, the injured area was covered with 1 ml esculin 5 and 10% daily, until the end of the experiment. Within each main group, animals were further divided into three subgroups (n = 5) corresponding to sampling on days 7, 14, and 21 post-injury (Fig. 1B). On each sampling day, animals were humanely euthanized via intravenous injection of pentobarbital sodium (50 mg/kg). Humane endpoints included > 20% weight loss, inability to access food or water, or severe wound infection. Death was confirmed by cessation of heartbeat and respiration, and loss of corneal reflex.

The sample size was estimated a priori based on the primary outcome of wound closure percentage. Assuming a large effect size (Cohen’s d ≥ 1.0), a significance level of 0.05, and a statistical power of 80%, the minimum required sample size was estimated to be 10–12 animals per group. To enable analyses at multiple post-injury time points (days 7, 14, and 21) and to account for potential attrition, 15 animals were included in each group, with five animals allocated per time point.

Wound area measurement

Digital wound photographs were captured on days 7, 14, and 21 post-injury using a high-resolution camera mounted on a fixed stand at a constant distance under standardized conditions. A physical ruler was included in images obtained on day 0 to calibrate the measurement scale in ImageJ software (NIH, USA), and the same calibrated scale was subsequently applied to all time points for wound area measurement (mm²), from which the percentage of wound closure was calculated as previously described²²:

n= numbers of days (7th, 14th and 21th).

Histopathological analysis

Full-thickness skin specimens from the wound site (including epidermis, dermis, and subcutaneous tissue) were bisected longitudinally. One half was fixed in 10% neutral-buffered formalin, processed, and embedded in paraffin. Sections of 5 μm thickness were stained with hematoxylin–eosin (H&E) and Masson’s trichrome for light microscopy. Histological examinations were done by using a procedure reported by Oryan et al²³. Histological parameters evaluated included fibrin deposition, hemorrhage, epithelial cornification, inflammatory cell infiltration (mononuclear and polymorphonuclear), re-epithelialization, angiogenesis, fibroblast and macrophage content, necrosis, fibrocyte presence, and collagen organization. Images were captured using a DinoCapture digital microscope camera and analyzed with Adobe Photoshop CS4. Five random microscopic fields per sample were examined for cell counts and vessel density.

Histopathological evaluation was performed by an experienced pathologist using hematoxylin and eosin–stained sections. Total cellularity was assessed at ×200 magnification, while fibroblasts, fibrocytes, macrophages, lymphocytes, neutrophils, and blood vessels were identified based on established morphological criteria and counted at ×800 magnification within the wound area. Cell counts were performed in multiple randomly selected high-power fields, and the mean values and standard deviations were calculated for each parameter. These assessments were considered semi-quantitative and observational in nature.

Tissue biochemistry

The remaining half of each wound specimen was rinsed in cold phosphate-buffered saline, snap-frozen in liquid nitrogen, and stored at − 80 °C for biochemical assays.

Dry matter content was determined by calculating the ratio of dry to wet tissue weight²⁴. Hydroxyproline levels were measured after acid hydrolysis and colorimetric detection using paradimethyl-amino-benzaldehyde (PDAB) reagent, with absorbance at 557 nm and results expressed as µg/mg protein [22]. Glycosaminoglycans (GAGs) were quantified using the dimethylmethylene blue (DMMB) assay with absorbance at 595 nm²⁵.

Oxidative stress and antioxidant enzyme assays

To assess oxidative stress markers and antioxidant defense systems in wound tissue, a panel of biochemical parameters was quantified using commercial kits (Navand Salamat Co., Iran) according to the supplier’s instructions.

Superoxide dismutase (SOD) activity was determined based on inhibition of pyrogallol autoxidation, with absorbance read at 405 nm. Results were normalized to total protein content. For total antioxidant capacity (TAC), a ferric reducing antioxidant power (FRAP)-based method was used, in which antioxidants reduce Fe³⁺ to Fe²⁺; the reaction product was detected at 593 nm, and TAC was calculated against a standard curve. Glutathione peroxidase (GPx) activity was assessed through a coupled reaction where GPx reduces cumene hydroperoxide in the presence of GSH. The oxidized GSH was subsequently recycled by glutathione reductase with NADPH, and the decline in NADPH absorbance at 340 nm served as the activity index. Myeloperoxidase (MPO) activity, a marker of neutrophil infiltration, was evaluated by monitoring the H₂O₂-dependent oxidation of tetramethylbenzidine (TMB) and measuring absorbance at 650 nm. Malondialdehyde (MDA) levels, an indicator of lipid peroxidation, were estimated via the thiobarbituric acid (TBA) reaction, producing a colored complex measurable at 532 nm. Concentrations were determined using a calibration curve and expressed as µmol/mg protein.

Gene expression analysis by quantitative Real-Time PCR

Total RNA was extracted from frozen wound tissue using RNX Plus solution (Sinaclon, Iran). After DNase I treatment, RNA purity and concentration were determined spectrophotometrically. Complementary DNA (cDNA) synthesis was performed using Pars Toos (Iran) reverse transcription kits. qRT-PCR reactions were set up with SYBR Green Master Mix (Yekta Tajhiz Azma, Iran) on a Rotor-Gene Q system (Qiagen, Germany). Primers targeted IL-1β, TGF-β1, bFGF, VEGF, and the β-actin housekeeping gene (Table 1)²⁶. Cycling conditions included initial denaturation at 95 °C for 20 s, followed by 40 cycles of denaturation (95 °C, 20 s), annealing (55 °C, 20 s), and extension (72 °C, 30 s). Relative expression levels were calculated using the 2^–ΔΔCt method.

Table 1.

Sequences of the primer pairs utilized for RT-PCR.

Gen symbols	Primer sequences
IL-1ß	F: TCTGAAGCAGCTATGGCAAC
	R: TCAGCCTCAAAGAACAGGTCA
TGF-ß1	F: ACTACGCCAAAGAAGTCACC
	R: CACTGCTTCCCGAATGTCT
bFGF	F: ATTTCCAAAACCTGACCCGAT
	R: TGCCTTTTAACACAACGACCAG
VEGF	F: ATGCCAAGTGGTCCCAG
	R: CAATAGCTGCGCTGGTAG
GAPDH	F: AGTTCAACGGCACAGTCAAG
	R: TACTCAGCACCAGCATCACC

Statistical analysis

Descriptive statistics were expressed as mean ± standard Deviation of the mean (SD). The normality of data distribution was assessed using the Shapiro–Wilk test. For normally distributed data, comparisons among experimental groups were performed using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Statistical analyses were performed using SPSS software version 22.0 (SPSS Inc., Chicago, IL, USA). Graphs were generated using GraphPad Prism version 9.5 (GraphPad Software, San Diego, CA, USA). A P value of less than 0.05 was considered statistically significant.

Results

Wound closure rate

By day 7 post-injury (PI), the normal control group showed the most rapid wound contraction, while the diabetic control group exhibited the slowest healing, with the difference being highly significant (P < 0.0001). Both esculin-treated groups demonstrated improved closure compared with the diabetic control, although statistical significance was achieved only in the esculin 10% group (P < 0.0001). Moreover, wound reduction in the esculin 10% group was significantly greater than in the esculin 5% group (P < 0.001) (Fig. 2A–D).

Fig. 2.

Macroscopic wound images of the normal control (A, E, I), diabetic control (B, F, J), esculin 5% (C, G, K) and esculin 10% (D, H, L) groups on days 7, 14 and 21 PI. Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001).

At day 14 PI, wound closure was again greatest in the normal control animals, followed in order by the esculin 10%, esculin 5%, and diabetic control groups. Statistical comparisons indicated significant differences between the diabetic control and both esculin-treated groups when compared to the normal control (P < 0.0001). In addition, the esculin 10% group differed significantly from the diabetic control (P < 0.0001) and the esculin 5% group (P < 0.05) (Fig. 2E–H).

By day 21 PI, normal controls maintained the highest percentage of wound closure, which remained significantly greater than that observed in the other groups (P < 0.05). Esculin-treated animals continued to display enhanced wound closure compared with diabetic controls, with differences being highly significant (P < 0.0001) (Fig. 2I–L).

General observation

By day 7 PI, all groups displayed wounds covered with abundant granulation tissue, although the extent of scar formation was less pronounced in the normal control group compared with the diabetic control and esculin-treated groups. None of the groups showed evidence of epithelial regeneration at this point. Inflammatory infiltration, including lymphocytes, plasma cells, and macrophages, was detected within the dermis—most prominently in the deeper regions of the lesions—with the diabetic control group exhibiting the greatest intensity of inflammation. Numerous fibroblasts and a smaller proportion of fibrocytes were present in the dermis of all groups. The normal control animals, however, displayed fewer inflammatory cells, reduced perivascular edema, and less fibrin accumulation than the other three groups (Fig. 3A–D). Across all groups, collagen deposition was evident but poorly organized, with fibers arranged in a random manner, as reflected by broad, low peaks in the orientation distribution histograms. Quantitative analysis of collagen density using ImageJ indicated that the control group had the greatest deposition, followed by esculin 10%, esculin 5%, and diabetic controls, with the difference between the esculin 10% and normal control groups reaching significance (P < 0.05) (Fig. 4A–D).

Fig. 3.

Representative longitudinal sections of skin tissue from the normal control (A, E, I), diabetic control (B, F, J), esculin 5% (C, G, K) and esculin 10% (D, H, L) groups at 7, 14, and 21 days post-injury, respectively, stained with Hematoxylin and Eosin (H&E). On day 7, no signs of new epithelial formation were observed in any of the groups. The esculin-treated groups exhibited reduced inflammatory cell infiltration compared to the diabetic control. Newly formed collagen fibers at the lesions site were disorganized, with a random distribution pattern in all groups. By day 14, the normal control group showed a more regular epidermis compared to the other groups. In the esculin-treated groups, there was a reduction in cellularity, greater organization of collagen fibers, and improved tissue alignment compared to the diabetic control group. On day 21, the normal control group demonstrated nearly complete wound closure, reduced inflammation, and enhanced tissue maturation with an increased number of large blood vessels. The esculin-treated groups showed improved epithelial formation and collagen organization relative to the diabetic control group. Black arrowheads indicate neutrophils; red arrowheads indicate macrophages; black arrows indicate fibroblasts; and red arrows indicate fibrocytes.

Fig. 4.

Collagen fiber organization in longitudinal skin sections stained with Masson’s Trichrome in the normal control (a, e, i), diabetic control (b, f, j), esculin 5% (c, g, k), and esculin 10% (d, h, l) groups at 7, 14, and 21 days post-injury. On day 7, collagen fibers in the untreated wounds were sparse and disorganized, while the esculin-treated groups, particularly 10%, showed improved density and orientation. By day 14, collagen fiber alignment and dermal remodeling were improved in the esculin groups compared to the diabetic control group. At day 21, normal control group demonstrated the most organized and dense collagen deposition, followed by the Esculin 10% and 5% groups, respectively. Quantitative analysis of blue staining revealed statistically significant differences among the groups Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001).

By day 14 PI, the epidermis appeared thickened and irregular in all groups relative to adjacent intact skin, but the control animals retained a more uniform epithelial structure compared with the others. In the wounds treated with esculin, there was a reduction in cellularity and a decrease in the number of blood vessels, and also their diameters were more prominent compared to the untreated wounds. However, these parameters remained lower than those observed in the normal control group (Fig. 3E–H). Collagen fibers in esculin-treated groups displayed greater organization and alignment than those in diabetic controls, with orientation histograms showing higher, narrower peaks. This pattern was most evident in the normal control group, followed by the 10% and 5% esculin-treated groups. Quantitative assessment of blue intensity confirmed a highly significant improvement in collagen density in the esculin 10% group compared with diabetic controls (P < 0.0001) (Fig. 4E–H).

By day 21 PI, wounds in the normal control animals were nearly closed, with relatively small residual scar tissue. In these rats, lymphocyte and macrophage infiltration had markedly declined, while tissue maturation and the presence of large- sized blood vessels were more prominent compared with the other groups. In esculin-treated groups, the epidermis was better developed than in diabetic controls, with areas of keratinization also observed (Fig. 3I–L). Collagen fiber organization in these treated wounds showed substantial improvement relative to diabetic controls, as indicated by sharp, distinct peaks in orientation histograms and supported by quantitative analysis, which revealed a significant rise in the proportion of organized fibers (P < 0.0001). Despite this progress, the normal control group still exhibited the highest degree of collagen maturation and structural organization (Fig. 4I-L).

Histopathological and histomorphometric analysis

The data obtained from the histopathological and histomorphometric analyses on days 7, 14, and 21 PI are presented in Fig. 5. Across all time points, the lowest number of total cells was observed in the normal control group, followed by the esculin 10%, esculin 5%, and diabetic control groups. The esculin-treated groups exhibited a statistically significant reduction in total cell number compared to the diabetic control group on all days (P < 0.001).

Fig. 5.

Histopathologic and histomorphometric analysis. Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001).

On day 7 PI, the highest number of fibroblasts was observed in the normal control group, which was significantly greater than in the other groups (P < 0.0001). After the normal control group, the fibroblast count was highest in the esculin 10% group, which was significantly greater than that of the diabetic control group (P < 0.0001). On day 14 PI, the number of fibroblasts in both treatment groups decreased compared to the diabetic control group; however, this reduction was statistically significant only for the esculin 10% group (P < 0.01). On day 21 PI, the lowest number of fibroblasts was observed in the normal control and esculin 5% groups, respectively. The difference between the normal control and diabetic control groups was statistically significant (P < 0.001).

In evaluating the number of fibrocytes on day 7 PI, although the normal control group had a higher fibrocyte count than the other groups, the difference was not statistically significant (P > 0.05). On day 14, the highest number of fibrocytes was observed in the normal control group, which was significantly greater than in the other groups (P < 0.001). Both treatment groups showed higher fibrocyte counts than the diabetic control group; however, this difference was statistically significant only for the 5% esculin group (P < 0.05). On day 21 PI, the normal control group exhibited the highest fibrocyte count, followed by the esculin 10% and esculin 5% groups, and then the diabetic control group, respectively. The differences between the normal control and the other groups, as well as between the esculin-treated groups and the diabetic control group, were statistically significant (P < 0.0001).

On day 7 PI, no significant differences in the fibrocyte-to-fibroblast ratio were observed among the groups. By day 14 PI, the normal control group exhibited the highest fibrocyte-to-fibroblast ratio, although the difference compared to the diabetic control group was not statistically significant (P > 0.05). On day 21 PI, the normal control group showed a significantly higher fibrocyte-to-fibroblast ratio compared to the other groups (P < 0.0001). Furthermore, the esculin-treated groups demonstrated a significantly greater fibrocyte-to-fibroblast ratio than the diabetic control group (P < 0.0001).

On days 7 PI, the normal control group exhibited the highest number of blood vessels, which was significantly greater than all other groups (P < 0.05). A statistically significant difference was also observed between the esculin-treated groups and the diabetic control group (P < 0.01). On days 14 PI, the normal control group showed the highest vessel count, with a statistically significant increase compared to other groups (P < 0.0001). The esculin-treated groups also demonstrated significantly more vessels than the diabetic control group (P < 0.0001). On days 21 PI, vessel numbers in the normal control group decreased relative to other groups, but no significant intergroup differences were detected (P > 0.05).

At day 7 PI, lymphocyte infiltration was greatest in the diabetic control animals, followed in descending order by the esculin 5%, esculin 10%, and normal control groups. Statistical analysis confirmed that all intergroup differences were highly significant (P < 0.0001). By day 14 PI, lymphocyte numbers had declined in every group; the normal control group exhibited the lowest lymphocyte count, which were significantly different from all others (P < 0.0001). Both esculin-treated groups also showed significantly fewer lymphocytes relative to diabetic controls (P < 0.0001). On day 21 PI, the lymphocyte counts in the normal control and esculin-treated groups remained significantly lower than those in the diabetic control group (P < 0.0001).

On day 7 PI, macrophage infiltration peaked in the diabetic control group and was significantly higher than in all other groups (P < 0.0001). Esculin-treated animals also showed more macrophages than the normal control group (P < 0.0001). By day 14 PI, macrophage numbers had declined, with the lowest values recorded in the normal control, esculin 10%, and esculin 5% groups, respectively, each being significantly reduced compared with the diabetic controls (P < 0.0001). At day 21 PI, macrophage counts remained elevated in the diabetic control group compared to all others (P < 0.0001), whereas no significant difference was found between the esculin-treated groups and the normal controls (P > 0.05).

On days 7, 14, and 21 PI, the diabetic control group exhibited the highest number of neutrophils, which was significantly greater than in the other groups (P < 0.0001). Across all three time points, the lowest neutrophil counts were observed in the normal control group, followed by the esculin 10% and 5% groups, respectively.

Histopathological analysis using H&E staining demonstrated the presence of inflammatory cells with morphological features consistent with neutrophils, including multilobed nuclei and dense chromatin. These neutrophil-like inflammatory cells were most abundant during the early stages of wound healing and showed a progressive decline over time. However, a residual presence of such cells was still observed at day 21, especially in diabetic wounds, consistent with delayed resolution of inflammation. Cell counts were performed in a semi-quantitative manner based on morphological criteria.

neutrophil-like inflammatory cells were observed at day 21.

Quantitative analysis of dry Matter, Hydroxyproline, and glycosaminoglycans content during wound healing

Dry matter content

At day 7 PI, the normal control group exhibited the greatest proportion of dry matter, while the diabetic control showed the lowest; the difference between the groups was not statistically significant (P > 0.05). By day 14, dry matter content in the normal control animals was significantly higher than in all other groups (P < 0.05). Although the esculin-treated rats demonstrated increased dry matter relative to diabetic controls, these differences were not statistically significant (P > 0.05). On day 21, the ranking of dry matter content was as follows: normal control > esculin 10% > esculin 5% > diabetic control. Statistically significant differences were detected both between the normal control and other groups, and between esculin-treated groups and diabetic controls (P < 0.05) (Fig. 6).

Fig. 6.

Dry matter, hydroxyproline and GAGs content in experimental groups on days 7, 14 and 21 post-injury. Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001).

Hydroxyproline content

Across all time points (days 7, 14, and 21 PI), the highest levels were observed in the normal control group, which were significantly greater than those in the diabetic control group (P < 0.01). No statistically significant differences were detected between the two esculin-treated groups (P > 0.05). Although both esculin concentrations consistently yielded higher hydroxyproline levels compared with the diabetic control, these increases were not statistically significant (P > 0.05) (Fig. 6).

Glycosaminoglycans level

On day 7 PI, the highest amount of GAGs was observed in the normal control group, which was significantly greater than in the diabetic control (P < 0.0001) and esculin 5% (P < 0.05) groups. Both esculin-treated groups showed higher GAG levels than diabetic controls, with significance observed only in the esculin 10% group (P < 0.05). At day 14, GAGs remained significantly elevated in the normal control group compared with all others (P < 0.05). Esculin-treated animals also displayed increased GAG levels relative to diabetic controls, reaching significance in the esculin 10% group (P < 0.05). By day 21, GAG content was again greatest in the normal control animals (P < 0.0001). Both esculin concentrations yielded significantly greater values than diabetic controls, with P < 0.05 for 5% and P < 0.0001 for 10% concentrations (Fig. 6).

Assessment of oxidative stress parameters

The data obtained from the assessment of oxidative stress parameters on days 7, 14, and 21 PI are presented in Fig. 7.

Fig. 7.

Oxidative stress markers and antioxidant enzyme activities among experimental groups on days 7, 14 and 21 post-injury. Levels of glutathione peroxidase (GPx), superoxide dismutase (SOD), total antioxidant capacity (TAC), malondialdehyde (MDA), and myeloperoxidase (MPO) were measured in the normal control, diabetic control, Esculin 5%, and Esculin 10% groups. Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001).

Glutathione peroxidase activity

On days 7, 14, and 21 PI, the highest and lowest GPx activities were observed in the normal control and diabetic control groups, respectively. Statistical analysis revealed a significant difference between the normal control and diabetic control groups only on day 7 (P < 0.001). On days 14 and 21, the normal control group showed significant differences compared to the other groups (P < 0.05). Across all three time points, GPx activity in the esculin-treated groups was higher than in the diabetic control group; however, this difference reached statistical significance only on day 21 between the diabetic control and the esculin 10% group (P < 0.05).

Superoxide dismutase activity

On days 7, 14, and 21 PI, the highest and lowest SOD activities were observed in the normal control and diabetic control groups, respectively. Statistical analysis revealed significant differences on day 7 between the normal control group and both the diabetic control group (P < 0.0001) and the esculin 5% group (P < 0.001). Additionally, a significant difference was found between the diabetic control and esculin 10% groups on day 7 PI (P < 0.05). On days 14 and 21, the normal control group showed significant differences compared to the other groups (P < 0.01). Although SOD activity in the esculin-treated groups was higher than in the diabetic control group on days 14 and 21, this difference was statistically significant only between the diabetic control and esculin 10% groups (P < 0.01 on day 14 and P < 0.0001 on day 21).

Total antioxidant capacity

The TAC was highest in the normal control group across all three experimental days (P < 0.0001). On each day, the TAC levels in the esculin-treated groups were significantly greater than those in the diabetic control group (P < 0.0001 for the 10% esculin group and P < 0.05 for the 5% esculin group on day 7; P < 0.0001 for both groups on days 14 and 21). Although the esculin 10% group consistently exhibited higher TAC levels than the esculin 5% group on all three days, this difference was not statistically significant (P > 0.05).

Malondialdehyde levels

MDA levels were lowest in the normal control group and highest in the diabetic control group on days 7, 14, and 21 PI. On day 7 PI, significant differences were found between the normal control and both the diabetic control (P < 0.0001) and esculin 5% groups (P < 0.001), as well as between the diabetic control and esculin 5% (P < 0.05) and 10% groups (P < 0.0001). On day 14 PI, MDA levels were lower in the esculin-treated groups compared to the diabetic control, with significance only between the esculin 10% and diabetic control groups (P < 0.001). On day 21 PI, the normal control group had the lowest MDA levels, followed by esculin 10%, esculin 5%, and diabetic control groups, with a significant difference only between the normal and diabetic controls (P < 0.05).

Myeloperoxidase concentration

On day 7 PI, the normal control group had the lowest MPO concentration, significantly different from all other groups (P < 0.0001). The diabetic control group showed the highest levels, with a significant difference compared to the esculin 10% group (P < 0.05). On day 14 PI, MPO levels in the esculin-treated groups were lower than in the diabetic control group, reaching statistical significance only for the esculin 10% group (P < 0.001). On day 21 PI, the normal control group again exhibited the lowest MPO concentration, followed by the the esculin 10% and esculin 5% groups, and the diabetic control group. MPO levels in both esculin-treated groups were lower than in the diabetic control group, with a statistically significant difference only between the esculin 10% group and the diabetic control group (P < 0.05).

Gene expression profiles of IL-1β, TGF-β1, bFGF, and VEGF

The mRNA expression levels of IL-1β, TGF-β1, bFGF, and VEGF were evaluated in skin tissues on days 7, 14, and 21 PI using quantitative real-time PCR. Data are expressed as fold changes relative to β-actin and are summarized in Fig. 8.

Fig. 8.

IL-1β, TGF-β1, bFGF, and VEGF genes expression among experimental groups on days 7, 14 and 21 post-injury. Data are presented as mean ± SD (n = 5). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. P < 0.05 is significant. (*, means P < 0.05, **, means P < 0.01, ****, means P < 0.0001). Correlation matrix showing Pearson correlation coefficients between mRNA expression levels of across all samples. Blue colors indicate positive correlations and red colors indicate negative correlations. Significant correlations IL-1ß vs. TGF-ß1 (r = − 0.63, P < 0.0001), IL-1ß vs. bFGF (r = − 0.27, P > 0.05), IL-1ß vs. VEGF (r = − 0.77, P < 0.0001), TGF-ß1 vs. BFGF (r = 0.58, P < 0.001), TGF-ß1 vs. BFGF (r = 0.76, P < 0.0001), BFGF vs. VEGF (r = 0.52, P < 0.01).

IL-1β expression

Quantitative real-time PCR analysis of IL-1β mRNA levels revealed the lowest expression in the normal control group across all three experimental time points and the highest expression in the diabetic control group. Treatment with esculin, at both 5% and 10% concentrations, significantly suppressed IL-1β expression compared to the diabetic control at all-time points (P < 0.0001). No statistically significant differences were detected between the two esculin-treated groups (P > 0.05).

TGF-β1 expression

On day 7 PI, the highest TGF-β1 gene expression was observed in the normal control group, with a statistically significant difference compared to the diabetic control group (P < 0.01). Although TGF-β1 expression in the esculin-treated groups was higher than in the diabetic control group, this difference was not statistically significant (P > 0.05). A similar pattern was observed on day 14 PI, where the normal control group showed significantly higher TGF-β1 expression than the other groups (P < 0.0001). Additionally, TGF-β1 expression in the esculin-treated groups was significantly greater than in the diabetic control group (P < 0.001). On day 21 PI, TGF-β1 expression had decreased in the normal control and both esculin treatment groups compared to day 14 PI; however, the normal control group still exhibited significantly higher expression than the other groups (P < 0.0001). TGF-β1 levels in the esculin-treated groups were lower than in the diabetic control group, although statistical significance was observed only between the diabetic control and esculin 10% groups (P < 0.001).

bFGF expression

Real-time PCR analysis of bFGF mRNA expression in skin tissue samples on days 7 and 14 PI revealed the highest expression in the normal control group, followed by the esculin 10% and esculin 5% groups, respectively. The difference between the normal control group and the other groups was statistically significant (P < 0.01). However, on day 21 PI, an inverse pattern was observed; the lowest bFGF expression was found in the normal control group, while the diabetic control group exhibited the highest expression. The bFGF expression levels in the esculin-treated groups were significantly lower than those in the diabetic control group (P < 0.0001).

VEGF expression

On day 7 PI, the highest VEGF gene expression was observed in the normal control group, which was significantly different from the other groups (P < 0.05). VEGF expression in the esculin-treated groups was higher than in the diabetic control group, although statistical significance was observed only between the diabetic control and esculin 10% groups (P < 0.05). A similar pattern was observed on day 14 PI, with the normal control group showing higher VEGF expression than other groups. Again, VEGF levels in the esculin-treated groups exceeded those in the diabetic control group, with significance only between the diabetic control and esculin 10% groups (P < 0.001). On day 21 PI, VEGF expression in the normal control group decreased compared to day 14. However, it remained higher than in the other groups, with a significant difference between the normal and diabetic control groups (P < 0.05). Although VEGF expression in the esculin-treated groups was higher than in the diabetic control group, these differences were not statistically significant (P > 0.05).

To investigate potential interactions among these genes, a Pearson correlation analysis was conducted using pooled expression data. The results revealed a strong negative correlation between IL-1β and VEGF (r = − 0.77, P < 0.01), and a moderate negative correlation between IL-1β and TGF-β1 (r = − 0.63, P < 0.05). On the other hand, TGF-β1 expression was positively correlated with both VEGF (r = 0.76, P < 0.01) and bFGF (r = 0.58, P < 0.05). These associations suggest an inverse relationship between inflammatory and angiogenic/regenerative signaling pathways during wound healing. The correlation matrix is shown in Fig. 7.

Discussion

Impaired wound healing is a well-recognized complication of diabetes. It remains a persistent, multifactorial clinical challenge, primarily due to the complex interplay between systemic metabolic dysregulation and impaired local tissue responses. Chronic hyperglycemia impairs blood flow, reduces oxygen delivery, suppresses collagen and fibronectin synthesis, and diminishes immune cell function, collectively leading to delayed wound healing, prolonged inflammation, and increased risk of chronic infection^27,28. Given the global rise in diabetes prevalence and the associated healthcare burden of non-healing wounds, there is an urgent need for effective therapeutic strategies that not only promote tissue repair but also target the fundamental inflammatory and oxidative pathways involved in impaired healing. In this context, traditional medicinal plants and their bioactive compounds have shown considerable potential in modulating key pathways involved in wound healing, making them valuable candidates for further investigation as adjuncts or alternatives to conventional wound care therapies¹⁰.

Based on its documented hypoglycaemic, anti-inflammatory, and antioxidant properties¹¹, we hypothesized that esculin could be used as a compound to accelerate the wound healing process in diabetic conditions.

Consistent with established models, diabetic control animals in this study exhibited delayed wound closure, increased inflammatory cell infiltration, impaired collagen deposition, and diminished antioxidant defense. Moreover, the observed reductions in hydroxyproline and glycosaminoglycan content in diabetic wounds provide further evidence of impaired extracellular matrix (ECM) formation, a key feature of diabetic wound pathology. In contrast, topical application of esculin markedly improved wound contraction, re-epithelialization, scar formation, angiogenesis, and collagen fiber maturation in diabetic rats. Furthermore, esculin treatment significantly enhanced GAGs and hydroxyproline levels across various phases of healing. Evaluation of oxidative stress parameters revealed improved antioxidant status in esculin-treated groups, as evidenced by increased activities of GPx and SOD, along with decreased MDA concentrations. Additionally, esculin modulated the expression patterns of key wound healing-related genes, including IL-1β, TGF-β1, bFGF, and VEGF, which may contribute to accelerated healing and reduced inflammation.

The inflammatory phase is the initial and essential stage of the wound healing process, characterized by the infiltration of immune cells, primarily neutrophils, macrophages, as well as lymphocytes, and the release of pro-inflammatory cytokines, chemokines, and growth factors. This orchestrated immune response facilitates the clearance of necrotic tissue and microbial agents while preparing the wound bed for the proliferative phase. In normal conditions, this phase is self-limiting and transitions smoothly to the next stage. However, in diabetic wounds, chronic hyperglycemia leads to dysregulation and prolongation of inflammation, resulting in excessive cytokine production, persistent immune cell activation, delayed granulation tissue formation, and impaired wound closure^29,30.

Quantitative histological analysis demonstrated that inflammatory cell infiltration, including lymphocytes, macrophages, and neutrophils, was markedly elevated in the diabetic control group during the early post-injury phase, which was further corroborated by increased IL-1β expression, heightened MPO activity, and elevated MDA levels, collectively indicating persistent inflammation and oxidative stress known to impair wound healing in diabetic conditions²⁷. Esculin-treated groups exhibited a more transient and regulated inflammatory response, as evidenced by the significant downregulation of IL-1β across all time points, modulation of macrophage dynamics, and reduced MPO activity, suggesting enhanced resolution of inflammation.

Esculin has demonstrated significant anti-inflammatory properties across various in vivo and in vitro models, primarily through the suppression of pro-inflammatory cytokines and key signaling pathways. It was shown to markedly reduce the expression of IL-1β, TNF-α, and inducible nitric oxide synthase (iNOS) in colitis and LPS-induced inflammation models by inhibiting the nuclear factor-kappa B (NF-κB) signaling pathway, a central regulator of inflammation^16,31. In murine models of arthritis and acute lung injury, esculin not only attenuated inflammatory cell infiltration and cytokine production but also impaired neutrophil migration via the inhibition of the protein-activated kinase 1/LIM domain kinase 1/cofilin signaling axis^15,17. Additionally, in LPS-induced acute kidney injury, esculin downregulated inflammatory mediators, including IL-6, monocyte chemoattractant protein-1 (MCP-1), and intercellular cell adhesion molecule-1 (ICAM-1), partly through inhibition of the Toll-like receptor 4 (TLR4)/myeloid differentiation primary response 88 (MyD88)/the high mobility group box 1 (HMGB1) axis¹³. Collectively, these findings suggest that esculin’s anti-inflammatory efficacy is primarily mediated by targeting upstream pattern recognition receptor pathways and downstream transcriptional responses, particularly via NF-κB suppression.

In the inflammatory phase of wound healing, macrophages play a pivotal role by coordinating the early immune response through the secretion of pro-inflammatory cytokines such as IL-1β and IL-6, and growth factors including TGF-β, bFGF, EGF, and PDGF, which collectively initiate fibroplasia, promote angiogenesis, and prime the wound bed for subsequent tissue regeneration³². Under physiological conditions, this phase is tightly regulated to allow timely resolution; however, in diabetic wounds, macrophages often exhibit a dysregulated and pro-inflammatory phenotype, characterized by prolonged infiltration and sustained expression of cytokines, particularly IL-1β, which contributes to chronic inflammation and impaired wound closure^33,34. In the present study, one notable findings was the modulation of macrophage accumulation in the esculin-treated groups, suggesting that esculin mitigates excessive inflammation in diabetic wounds. Furthermore, esculin treatment significantly downregulated IL-1β expression, indicating its potential to modulate macrophage-driven inflammatory responses, likely through inhibition of critical signaling pathways such as NF-κB.

Oxidative stress has been extensively implicated in the pathophysiology of diabetic wounds, primarily through the overproduction of ROS, which disrupts redox homeostasis and impairs tissue repair mechanisms, thereby delaying wound healing. Persistently high blood glucose levels in diabetic conditions contribute to excessive ROS production and a concurrent depletion of antioxidant defenses, such as SOD and GSH, weakening the skin’s capacity to counteract oxidative damage^35,36. This redox imbalance promotes lipid peroxidation, evidenced by elevated MDA levels, which compromise membrane integrity and disrupt cellular function. Numerous studies have demonstrated that enhancing antioxidant capacity can mitigate ROS burden and significantly improve wound healing outcomes^37,38.

In the present study, diabetic wounds exhibited marked oxidative stress, as reflected by increased MDA and MPO levels and diminished antioxidant defenses, including reduced activities of SOD, GPx, and lower TAC. Treatment with esculin effectively restored redox balance by enhancing antioxidant enzyme activity and suppressing MDA and MPO concentrations, indicating its ability to counteract lipid peroxidation and neutrophil-derived oxidative damage. These findings suggest that esculin exerts protective effects through its antioxidant properties, likely contributing to improved wound healing under diabetic conditions.

This observation is consistent with previous experimental studies demonstrating the antioxidant potential of esculin in various pathological models, providing mechanistic support for the findings of the present study. esculin has been shown to neutralize reactive oxygen and nitrogen species, such as superoxide anions, hydroxyl radicals, and nitric oxide, which are key contributors to oxidative cellular damage in chronic diseases³⁹. In gastric injury models, esculin significantly reduced nitric oxide production by inhibiting iNOS activity⁴⁰, while in colitis models, it lowered MPO activity, thereby mitigating ROS-induced inflammation⁴¹. In neuronal cell lines, esculin attenuated oxidative stress by decreasing ROS levels and enhancing the activities of key antioxidant enzymes, including SOD and GSH [12]. Additional studies in models of lung injury, diabetic nephropathy, and chemical toxicity further support its efficacy in restoring redox balance through both direct radical scavenging and upregulation of endogenous antioxidant systems¹¹.

The proliferative phase represents a critical stage in the wound healing cascade, involving keratinocyte migration, fibroblast proliferation, ECM deposition, and neovascularization. These processes are orchestrated by a variety of growth factors and cytokines, including basic fibroblast growth factor (bFGF), transforming growth factor-β1 (TGF-β1), and vascular endothelial growth factor (VEGF), which collectively promote granulation tissue formation, angiogenesis, and re-epithelialization^29,30. In diabetic wounds, hyperglycemia-induced oxidative stress and chronic inflammation impair the expression and activity of these mediators, resulting in reduced fibroblast function, inadequate ECM synthesis, and insufficient vascularization⁴².

Fibroblasts are fundamental components of granulation tissue, playing a central role in the production of collagen and other ECM elements essential for tissue repair. Alongside fibroblastic activity, angiogenesis is another vital process during the proliferative phase, as it ensures the adequate delivery of oxygen and nutrient to regenerating tissues⁴³. This neovascularization, driven by the development of new capillaries from pre-existing vessels, is often compromised in diabetic conditions due to hyperglycemia-induced endothelial dysfunction⁴⁴, contributing to delayed wound healing. Consequently, enhancing angiogenesis while addressing hyperglycemia is considered a key therapeutic strategy for managing chronic diabetic ulcers⁴⁵. Moreover, elevated blood glucose levels significantly reduce the levels of critical growth factors. Among these, bFGF and VEGF are particularly important: bFGF stimulates fibroblast proliferation, epithelialization, and collagen synthesis, while VEGF promotes endothelial cell migration and vascular permeability, thereby facilitating angiogenesis and wound perfusion²⁹. Collectively, these growth factors not only drive cellular proliferation but also arrange the structural and vascular components of tissue regeneration. Their enhanced expression at the wound site has been strongly correlated with accelerated healing outcomes. it forms the molecular basis for many plant-based therapeutic interventions aimed at restoring impaired healing in diabetic wounds³⁸.

In the present study, esculin treatment resulted in a marked upregulation of bFGF and VEGF expression compared to diabetic control wounds, indicating enhanced fibroblast activity and angiogenic signaling. The observed reduction in bFGF and VEGF expression at day 21 may represent a physiological transition from the proliferative to the remodeling phase of wound healing, during which angiogenic signaling is downregulated. In diabetic wounds, however, altered temporal regulation of these factors may reflect delayed or dysregulated remodeling processes. These molecular findings were supported by histological evidence of improved granulation tissue formation and increased collagen fiber deposition. Biochemical assays further confirmed elevated levels of hydroxyproline and glycosaminoglycans (GAGs), both of which are indicative of active ECM remodeling. The observed increase in bFGF and VEGF expression may be attributed to esculin’s antioxidant effects, which preserve cellular viability and signaling under diabetic conditions. Previous reports have also indicated that reducing oxidative stress can restore fibroblast responsiveness³⁵. Collectively, these results suggest that esculin effectively promotes fibroblast proliferation, ECM synthesis, and neovascularization, three core processes essential for successful progression through the proliferative phase of wound healing.

One of the key findings of the present study was the significant improvement in wound contraction and re-epithelialization rates in the esculin-treated groups compared to diabetic controls. Wound contraction is a critical phase of healing characterized by the centripetal movement of wound edges, primarily mediated by myofibroblasts differentiated from fibroblasts within the granulation tissue. This process involves a complex interplay among cells, the ECM, and cytokines, where myofibroblasts exert contractile forces to draw wound margins together, reducing wound size and facilitating closure⁴⁶. The observed enhancement in contraction in esculin-treated wounds may reflect improved fibroblast activity, supported by previous reports linking accelerated contraction to myofibroblast-mediated collagen deposition and ECM remodeling⁴⁷. Additionally, esculin’s anti-inflammatory properties¹¹ likely contributed to a more favorable wound microenvironment by reducing cytokine-mediated tissue damage and facilitating the timely recruitment and activation of fibroblast. These findings align with ECM previous studies where agents such as curcumin enhanced wound closure and epithelial regeneration by promoting keratinocyte migration and increasing dermal collagen content^48,49.

Although several studies have reported near-complete wound closure in diabetic rats by approximately day 21, the persistence of residual wounds observed in the present study reflects the deliberate stringency of the experimental model rather than a methodological limitation. In this work, a relatively large full-thickness excisional wound (2 cm in diameter) was created to induce a robust and reproducible delayed-healing phenotype under diabetic conditions. Larger wound sizes are known to prolong the inflammatory and proliferative phases of healing, particularly in the presence of sustained hyperglycemia. Moreover, diabetes was induced using streptozotocin, resulting in persistent metabolic dysregulation that impairs angiogenesis, collagen deposition, and re-epithelialization. The absence of topical or systemic antimicrobial agents or occlusive dressings further increased the challenge of the healing environment, allowing wounds to heal under untreated conditions. Collectively, these factors contributed to delayed wound closure in diabetic animals at day 21 and provided a stringent and clinically relevant platform for evaluating the therapeutic efficacy of the tested intervention.

The remodeling phase represents the final and critical stage of wound healing, during which the newly formed tissue undergoes structural reorganization and maturation to restore functional integrity. This phase is characterized by the replacement of the provisional with a more organized and cross-linked collagen network, increased tensile strength, and resolution of cellular infiltrates. Transforming growth factor-beta 1 (TGF-β1) plays a pivotal role in this process by regulating fibroblast-to-myofibroblast differentiation, collagen synthesis, and ECM remodeling, thereby ensuring the formation of a stable and functional scar⁵⁰. In diabetic wounds, this phase is often prolonged or impaired, leading to fragile scar tissue and an increased risk of wound recurrence.

In the present study, esculin treatment significantly enhanced key histopathological markers of remodeling, including collagen fiber maturation and organization in the long term. The increased hydroxyproline content further supports improved collagen synthesis and stabilization in esculin-treated wounds. These biochemical and histological improvements were accompanied by favorable modulation of molecular markers, such as upregulation of TGF-β1, a pivotal growth factor that regulates fibroblast function and ECM remodeling.

Moreover, esculin’s antioxidant and anti-inflammatory properties likely contributed to a more conducive microenvironment for effective remodeling by reducing oxidative damage and chronic inflammation, which are known to disrupt collagen maturation in diabetic wounds. Collectively, these findings suggest that esculin not only accelerates the earlier phases of wound healing but also promotes the quality and durability of the repaired tissue during the remodeling phase.

Although both concentrations of esculin demonstrated beneficial effects on various parameters of wound healing in diabetic rats, including reductions in inflammation and oxidative stress, as well as the upregulation of key growth factors, the 10% formulation consistently yielded more pronounced improvements. In the esculin 10% group, there were greater increases in hydroxyproline and GAGs levels, higher antioxidant enzyme activities (SOD, GPx), and more significant downregulation of pro-inflammatory markers such as IL-1β and MPO. Moreover, gene expression analysis revealed that the 10% concentration more effectively upregulated bFGF and VEGF, indicating stronger angiogenic and fibroblast-mediated regenerative responses. While the 5% formulation produced moderate effects, particularly in histological parameters, the superior outcomes observed with 10% esculin suggest a dose-dependent response, with the higher concentration providing greater therapeutic efficacy without any observable adverse effects.

Although esculin was applied topically in the present study and systemic exposure is expected to be minimal, no direct assessment of systemic absorption or off-target toxicity was performed. This represents a limitation of the study. However, previous experimental and pharmacological studies have reported a favorable safety profile for esculin, supporting its potential translational applicability in wound-healing contexts^11,18.

Limitations

Despite the strengths of the present study, several limitations should be considered when interpreting the findings. Histopathological assessments were primarily based on morphological evaluation of H&E- and Masson’s trichrome–stained sections and were therefore observational and semi-quantitative in nature. Although this approach is widely used in experimental wound-healing studies, it does not allow definitive immunophenotypic characterization of inflammatory cell subtypes, macrophage polarization, or angiogenic markers. Consequently, parameters such as neutrophil activation status, NET formation, and macrophage phenotype could not be specifically determined. In addition, systemic absorption and potential off-target toxicity of topically applied esculin were not directly evaluated, although topical administration is generally associated with minimal systemic exposure. Functional properties of the regenerated tissue, including biomechanical strength and tensile integrity, were also not assessed and should be addressed in future studies to better distinguish healing quality from healing rate. Finally, while the streptozotocin-induced diabetic rat model is well established and reproducible, it does not fully capture the multifactorial nature of chronic human diabetic ulcers, which often involve ischemia, infection, and repeated mechanical stress. Future investigations incorporating functional outcome measures, extended follow-up periods, and clinically relevant models will be essential to further validate the translational potential of esculin for diabetic wound management.

Conclusion

The findings of the present study suggest that esculin may represent a promising topical agent for supporting wound healing under diabetic conditions. Treatment with esculin was associated with modulation of multiple components of the wound repair process, including attenuation of inflammatory responses, enhancement of antioxidant defense, promotion of angiogenesis, and increased fibroblast activity. These effects were accompanied by improvements in histological organization, increased collagen and glycosaminoglycan deposition, and altered expression of growth factors such as bFGF, VEGF, and TGF-β1. In parallel, reduced levels of pro-inflammatory mediators, including IL-1β and MPO, further indicate a potential role for esculin in regulating inflammatory and oxidative stress–related pathways in diabetic wounds. The 10% formulation consistently showed greater effects than the 5% concentration, suggesting a dose-related trend within the tested range. Nevertheless, these observations should be interpreted in light of the experimental limitations, and further studies are required to evaluate additional concentrations, long-term outcomes, functional tissue properties, and relevance in human skin models. Overall, topical esculin may hold translational potential as an adjunctive strategy for diabetic wound management, particularly when integrated into advanced wound dressings or biomaterial-based delivery systems.

Abbreviations

PI

post injury

SOD

superoxide dismutase

TAC

total antioxidant capacity

GPx

glutathione peroxidase

MPO

myeloperoxidase

MDA

malondialdehyde

IL-1ß

interleukin-1β

TGF-β1

transforming growth factor-β1

bFGF

basic fibroblast growth factor

VEGF

vascular endothelial growth factor

ROS

reactive oxygen species, STZ, streptozotocin

PDAB

paradimethyl-amino-benzaldehyde

GAGs

glycosaminoglycans

DMMB

Dimethylmethylene blue

ICAM-1

intercellular cell adhesion molecule-1

TLR4

toll-like receptor 4

HMGB1

high mobility group box 1

NF-κB

nuclear factor-kappa B

ECM

extracellular matrix

iNOS

inducible nitric oxide synthase

Author contributions

Mohamadreza almasifard: investigation, resources. Mohammad Hashemnia: conceptualization, formal analysis, methodology, validation, supervision, writing – review & editing. Hadi Cheraghi: validation, formal analysis, methodology. Adel Mohammadalipour: formal analysis, methodology. All authors have read and approved the manuscript.

Funding

This research did not receive any specific grants from funding agencies in the public, commercial, or not-for-profit sectors.

Data availability

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Declarations

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Ethics approval

All experimental procedures involving animals were reviewed and approved by the Ethics Committee of Razi University, Kermanshah, Iran (Approval ID: IR.RAZI.AEC.1403.63). All animal experiments were conducted in accordance with the relevant institutional, national, and international guidelines and regulations, including the recommendations of the European Council Directive 86/609/EEC for the protection of animals used for experimental purposes. The study is fully compliant with the ARRIVE guidelines (Animal Research: Reporting of In Vivo Experiments; https://arriveguidelines.org). Efforts were made to minimize the number of animals used and their suffering throughout the study.

This article does not involve any studies with human participants performed by any of the authors.