Differential effects of biologically and chemically synthesized copper oxide nanoparticles on artemisinin biosynthesis gene expression in Artemisia absinthium

Abstract

Artemisinin is an effective antimalarial compound produced by Artemisia absinthium. Due to its low natural yields, it is crucial to investigate novel strategies to enhance biosynthesis of artemisinin. The impact of copper oxide nanoparticles (CuO NPs) on the expression of important genes involved in the biosynthesis of artemisinin was examined in this work. CuO NPs were synthesized using both green microwave irradiation and conventional wet chemical methods. Application of a variety of techniques, including XRD, DLS, FESEM, EDX, and FTIR confirmed the proper synthesis of CuO NPs. Nodal segments of A. absinthium were treated with CuO NPs at 2 and 4 ppm in MS medium and gene expression was analyzed using qRT-PCR. The results showed significant increases in key biosynthetic genes, including FDS, ADS, CYP71AV1, DBR2, and ALDH1. Specifically, a high level of expression of several transcripts associated with ADS, CYP71AV1, and DBR2 was observed in the cultures treated with 4 ppm of green synthesized CuO NPs (with 2.03-, 2.00-, and 1.83-fold increases, respectively) and 2 ppm of chemically synthesized CuO NPs (with 2.35-, 1.86-, and 2.34-fold increases, respectively), in comparison with the control. Additionally, there was only a slight increase in RED1, a gene that redirects metabolic flow away from artemisinin production. It can be concluded that CuO NPs, particularly those synthesized with green method, can be considered as potent nano-elicitors, enhancing the biosynthesis of artemisinin by modifying gene expression. This study demonstrates how nanotechnology can be used to increase pharmaceutical compound production of medicinal plants in a sustainable manner.

Introduction

Artemisia absinthium, a perennial herb, has antimalarial characteristics and is considered as one of the primary natural sources of artemisinin (a sesquiterpene lactone) (Fig. 1). The World Health Organization has claimed that artemisinin-based combination therapies are one of the most effective forms of treatment for malaria currently available^1–3. Low yield of artemisinin from plants has been always a great challenge for mass production in industrial scale. Thus, novel strategies should be introduced to increase plant biosynthesis of artemisinin. Recently, genetic engineering, metabolic pathway optimization, and nanotechnology have played a crucial role in this regard^4,5. One typical advanced approach that can be applied to raise the bioactive metabolite production of plants is plant tissue culture in combination with nanoparticles (NPs) elicitation^6,7. Plant tissue culture provides a stable and continuous opportunity for bioactive compound production rather than relying on natural environmental conditions. Further, it would significantly lessen unnecessary large harvesting schemes on natural sources that can potentially affect not just environmental degradation but also biodiversity loss over time⁸.

Fig. 1.

Arial parts of Artemisia absinthium.

The artemisinin biosynthetic pathway encompasses a collection of enzymes that their modulation has been considered as the main area of focus for increasing the production of this valuable metabolite. Biosynthesis of artemisinin generally occurs from the mevalonate (MVA) and non-mevalonate (MEP) pathways containing the main enzymes amorpha-4,11-diene synthase (ADS), cytochrome P450 monooxygenase (CYP71AV1), aldehyde dehydrogenase1 (ALDH1), and artemisinic aldehyde Delta (11(13)) reductase (DBR2); and furthermore also farnesyl diphosphate synthase (FDS) for precursor (farnesyl diphosphate) production (Fig. 2)^9,10. Recent research indicates that a number of factors, including genetics, developmental stages, glandular trichome density, and also external stimuli, including exposure to NPs, influence the production of artemisinin^11,12. Studies have revealed the potential of NPs to serve as alternative triggers for secondary metabolite production, instead of traditional biological inducers like phytohormones and microbial extracts¹³. In this regard, copper oxide (CuO) NPs have shown varying biological responses in plants which can be attributed to their specific physicochemical characteristics, including a high surface area/volume ratio, antimicrobial activity, and interactions at the molecular level, which may affect growth, stress, and the production of secondary metabolites¹⁴. Since Cu is a necessary element in plants that exists in enzymatic redox functions, the nano form of Cu has been extensively studied in various biosynthetic pathways considering the regulation of gene expression in plants^15–17. Indeed, their application can reduce the dependency on traditional chemical fertilizers and contribute to cost-effective culture optimization. Characterized by a narrow bandgap, good electrochemical activity, and strong redox potentials, CuO NPs exhibit efficient electron transfer in biocatalytic processes¹⁸. Additionally, CuO NPs are more chemically stable in various media and biologically active compared to the other copper-based NPs such as copper metal (Cu NPs) or copper (I) oxide (Cu₂O NPs)¹⁹. On the other hand, because of their extensive applications in medical and agricultural fields, the interactions between CuO NPs and different biological systems have been more extensively studied related to Cu and Cu₂O NPs. It is reported that Cu₂O NPs showed more toxicity to sea urchins embryos in comparison with Cu and CuO NPs that had approximately similar sizes²⁰. Despite these advantages, potential environmental toxicity must be carefully investigated and managed to ensure the safe and effective application of CuO NPs in the different areas. Therefore, we herein have selected the CuO NP to evaluate its impacts on A. absinthium as a case study.

Fig. 2.

Artemisinin biosynthetic pathway adopted from Zhao et al.¹⁰ with modifications. MVA: mevalonate, MEP: methylerythritol phosphate, FDS: farnesyl diphosphate synthase, ADS: amorpha-4,11-diene synthase, CYP71AV1: cytochrome P450 monooxygenase, CPR: cytochrome P450 reductase, ALDH1: aldehyde dehydrogenase1, DBR2: artemisinic aldehyde delta (11(13)) reductase, RED1: dihydroartemisinic aldehyde reductase.

Green and chemical synthesis of NPs are the two main methods used to fabrication of CuO NPs. Green synthesis methods produce NPs in an eco-friendly way by using organic or plant-derived compounds as stabilizing and reducing agents. Conversely, common methods for nanomaterial syntheses are based on chemical synthesis that use chemical reagents which are toxic to the living systems. The synthesized NPs with the two different methods have significantly varied interactions in favor of green synthesis^21,22. According to the literature, green synthesized CuO NPs typically have better quality and functionality than those made chemically²³. This may be because of the bioactive molecules remained after green synthesis of NPs that can enhance their biocompatibility, reduce toxicity, and provide extra biological activities like antioxidant or antimicrobial effects^21,24. These properties can be used in nano-biotechnological strategies to promote plant growth, stress tolerance, and secondary metabolite production.

In the current study, the impact of both green and synthetic CuO NPs on A. absinthium organ cultures were investigated by the means of expression of important genes, including FDS, ADS, CYP71AV1, CPR, DBR2, ALDH1, and RED1, influencing artemisinin production. This work provides valuable evidence for the potential of nanotechnology to modulate artemisinin yield in the medicinal plants.

Materials and methods

Synthesis of CuO NPs

CuO NPs were prepared using both green and chemical methods. A plant-mediated approach was utilized for the green synthesis, employing an aqueous extract of A. absinthium leaves as both reducing and stabilizing agents. For this purpose, the microwave irradiation technique was applied according to the method described by Jafarirad et al.²⁵. To prepare the plant extract, approximately 5 mg of powdered dried leaves was mixed with 50 mL of deionized water and shaken for 48 h, followed by a 15-minute incubation in an oven at 15 °C. The obtained extract was then filtered and centrifuged to be utilized in the synthesis of CuO NPs. Then, 12 mL of the extract was mixed with 100 mL of Copper (II) nitrate solution (0.05 M), and the pH was adjusted to 6. The resulting solution was stirred at 130 °C for a duration of 5 h. After centrifuging and washing, the precipitate was exposed to microwave irradiation at 320 W for 8 h. Concurrently, chemically synthetized CuO NPs were produced via a conventional wet chemical reduction process. Briefly, copper (II) nitrate (20 mM) as metal precursor refluxed at 70 °C with NaBH₄ (1 mM) as reducing agent and PVP (2 mM) as capping agent for 6 h. Occurrence of dark brown precipitate indicated the formation of CuO NPs²⁶.

Characterization of CuO NPs

A variety of techniques were used to characterize the physicochemical properties of the as-produced CuO NPs. The chemical composition and shape of CuO NPs were assessed by field emission scanning electron microscopy (FESEM) equipped with energy dispersive X-ray (EDX; MIRA3 FEG-SEM, Czech Republic). X-ray diffraction (XRD, Siemens, Germany) with Cu Kα radiations (k = 1.54060 nm) at the 2θ range of 10°-80° was applied to analyze the crystallin structure and phase composition of the desired NPs. Dynamic light scattering (DLS; Nanotrac Wave, Microtrac, Germany) measurements were performed to assess hydrodynamic size distribution, polydispersity index (PDI), and zeta potential. Fourier transform infrared spectroscopy (FTIR; TENSOR 27, Bruker, Germany) analysis was conducted to identify functional groups and to elucidate the role of biomolecules in NPs stabilization.

Plant materials and culture conditions

Plant materials of A. absinthium were obtained from the Botanical Garden of the Pharmaceutical Research Center, Tabriz University of Medical Sciences; no wiled plant populations were collected or disturbed during this study. The study complies with relevant institutional, national, and international guidelines and legislation. Seeds of A. absinthium underwent surface sterilization with 70% ethanol for 2 min, and then treated with 5% sodium hypochlorite for 15 min, and were subsequently washed 3 times with sterile distilled water. Then, they were germinated on Murashige and Skoog (MS) medium (0.8% agar) under a 16 h light and 8 h dark photoperiod at 25 ± 2 °C. After approximately one month of germination period, the sterile nodal segment explants were prepared from A. absinthium plantlets and were used for NPs treatment experiments.

Treatment with CuO NPs

Based on previous studies and preliminary observations, the doses of 2 and 4 ppm were selected as non-toxic yet biologically effective concentrations for gene expression analysis. Different concentrations of CuO NPs (2 and 4 ppm, as-synthesized using green and chemical methods) were added to the MS culture media. Nodal segments as explants were transferred to the media containing the respective CuO NP concentrations, 30 g/L sucrose, and 8 g/L agar. All media were adjusted to pH 5.8 prior to autoclaving at 121 °C for 20 min. Cultures were incubated in a growth chamber at 25 ± 2 °C under a 16 h light and 8 h dark photoperiod with a light intensity of ~ 10,000 lx. Control plants received distilled water without CuO NPs. The experiment was designed as a completely randomized design form with three biological replicates per treatment.

RNA extraction and cDNA synthesis

After 30 days of in vitro culture, plantlets were collected and frozen instantly in liquid nitrogen and stored at − 80 °C. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Germany) complying the manufacturer’s protocol by the Trizol reagent method. The residual DNA was detached using RNase-Free DNase (Qiagen, 79254). A Nano Drop device (Takta-NDNM96, Iran) was used to quantitatively control the extracted RNA. In this evaluation, the 280/260 wavelength ratio indicates contamination of the extracted RNA with protein, and the 260/230 indicates contamination of the extracted RNA with phenol and polysaccharides. The concentration of extracted RNA samples was obtained in nanograms per microliter (ngµL^{- 1}). First-strand cDNA was synthesized from 1 µg of total RNA using MMLV Reverse Transcriptase complying the regulations to finally obtain a 20 µl cDNA solution (Addbio, 22701).

Quantitative Real-Time PCR (qRT-PCR)

Gene expression analysis was executed by qRT-PCR with SYBR Green Master Mix (Qiagen, Germany) in a Real-Time PCR System (Bio-Rad, USA), complying the manufacturer’s regulations. The qRT-PCR primers (Table 1) were taken from the study¹¹, in which they were experimentally validated. The Ef1 alpha gene was used as an internal reference and the primers were adopted from a study²⁷ where they were validated as suitable reference gene for qRT-PCR analysis.

Table 1.

Primer nucleotide sequences used in qRT-PCR assay.

Gene	Forward primer sequence	Reverse primer sequence
FDS	GAACTCGCCAATGAGGAACA	TTTCAGCACCGCTTGGACT
ADS	TGTCAATGAGGAGTATGCCC	GTCTCCCATACGTGTGAAGT
CYP71AV1	CTCCACTACCCTTGGTTCTG	TCGTATTCTGCACCCATGAC
ALDH1	GATGTGTGTGGCAGGGTCTC	ACGAGTGGCGAGATCAAAAG
RED1	ATCGCGGTTAACGCATACAC	TTCCGAGGTCAACTCACCAG
CPR	GCTCGGAACAGCCATCTTAT	CCGAAGCCTTCTGAGTCATC
DBR2	CCAATGGAAGTGAGGAGGAA	CAAGGTCAGGATTCGAGACA
Ef1 alpha	AAGCCACTCCGTCTCCCACT	TCGGCAAACTTGACAGCAATA

Statistical analysis

The experiment was conducted using a completely randomized design, and data were analyzed using one-way analysis of variance (ANOVA) followed by Tukey’s multiple range test (DMRT) at a significance level of p < 0.05 using SPSS software (version 26). All experiments were performed in triplicate, and results are expressed as mean ± standard deviation (SD).

Results and discussion

Physical-chemical characteristics of CuO NPs

CuO NPs were successfully synthesized using green and chemical methods, and their formation was initially indicated by a visible color change of the reaction mixture (Fig. 3). The physical and chemical properties of the CuO NPs were evaluated via various characterization methods. The main characteristics of the NPs produced by green and chemical production methods are summarized in Table 2. The FESEM images of the green and synthetic CuO NPs showed spherical shaped particles with diameters 10–22 nm (green) and 12–16 nm (chemical) (Fig. 4a, b). The elemental analysis using EDX demonstrated the presence of Cu and O elements with no impurity in the structures of both CuO NPs (Fig. 4c, d). The XRD patterns of the synthesized NPs, recorded in the 2θ range of 10–80°, displays multiple distinct peaks indicative of the crystalline structure of CuO. According to both Fig. 5a and b, XRD patterns exhibited main peaks positions with 2θ value of 32.5°, 35.5°, 38.7°, 48.7°, 53.5°, 58.3°, 61.5°, 66.2°, 68.2°, 72.5°, and 75.2° are indexed as (110), (111), (111), (202), (020), (202), (113), (311), (220), (311), and (004) planes. The identified peaks correspond perfectly with the standard JCPDS card No. 410,254 for the monoclinic crystal structure of CuO, validating the successful synthesis of the desired phase. There were no identifiable impurity peaks suggesting that high purity CuO NPs had been produced. Also, the presence of well-defined sharp diffraction peaks suggested the crystalline nature of the CuO NPs (Fig. 5a, b).

Fig. 3.

Typical color change observed during the chemically synthesis (a) and phytochemically synthesis (b) of CuO NPs.

Table 2.

Physicochemical properties of the as-synthetized CuO NPs.

NPs	Diameter (nm)		PDI	Ζ (mV)
	FESEMa	DLSb
Green-synthesized CuO	10–20	19	0.562	+ 53.9
Chemically-synthesized CuO	12–16	53	0.927	− 33.8

^aParticle mean diameter measured by FESEM.

^bHydrodynamic diameter measured by DLS in distilled water.

^cPolydispersity index based on DLS.

^dZeta potential.

Fig. 4.

FESEM images of the green (a) and chemically synthesized (b) CuO NPs. EDX spectra of green (c) and chemically synthesized (d) CuO NPs.

Fig. 5.

XRD patterns of the green (a) and chemically synthesized (b) CuO NPs.

In order to identify the behavior of NPs in the liquid phase, the hydrodynamic particle size, PDI, and zeta potential were evaluated in distilled water by DLS technique. The predicted hydrodynamic diameter range, based on the DLS analysis, were 19 and 53 nm, with a PDI range of 0.562 and 0.927 for green and synthetic CuO NPs, respectively (Fig. 6a, b; Table 2). Zeta potential was calculated to be as + 53.9 mV and − 33.8 mV for the green and chemical CuO NPs, respectively (Table 2). Higher contents of zeta potential for both NPs proved the stability of NPs in the suspension, because high absolute zeta potential results in electrostatic repulsion on the NPs’ surface, thereby preventing NP aggregation. In addition, both CuO NPs presented low PDI values, showing their relatively good homogeneity in water media²⁸.

Fig. 6.

DLS analysis specified the particle size distribution of the green (a) and chemically synthesized (b) CuO NPs.

Figure 7 shows the FTIR peaks of the biologically- (a) and chemically-synthesized (b) CuO NPs. As it is seen in Fig. 7a, the plant extract on green synthesized CuO NPs reveals distinct absorption bands at approximately 3443 cm^{- 1} (O–H stretching of hydroxyl groups), 2923 cm^{- 1} (C–H stretching of aliphatic chains), 1744 cm^-1 (C = O bending) 1655 cm^{- 1} (C = C bending), and 1050–1100 cm^{- 1} (C–O stretching vibrations), signifying the presence of diverse phytochemicals, including polyphenols and alcohols. The majority of these peaks either move slightly or lose intensity after the chemically synthesis of CuO NPs (Fig. 7b), indicating the role of phytochemicals in stabilizing and reducing Cu²⁺ ions. In addition, strong evidence for the successful synthesis of CuO NPs (Fig. 7b) is also provided by the appearance of a new absorption band in the 535 cm⁻¹ region, which is referred to the Cu–O stretching vibration. In general, the physicochemical properties of the prepared NPs, including their small size and excellent colloidal stability, suggest that they are appropriate for the goal of the present investigation.

Fig. 7.

FTIR spectrum of the green (a) and chemically synthesized (b) CuO NPs.

Gene expression profiling in the artemisinin biosynthetic pathway under CuO NPs treatments

Since no previous studies have investigated the effect of CuO NPs on the expression levels of genes involved in the artemisinin metabolic route, this investigation sought to examine the effect of green and synthetic CuO NPs (at the concentrations of 2 and 4 ppm) on core genes in A. absinthium organ Cultures. In the present study the relative expression levels of seven key genes engaged in the artemisinin biosynthetic pathway. Gene expression was quantified, using qRT-PCR, relative to the untreated control, and fold changes were calculated to assess the induction potential of each treatment (Table 3). As shown in the artemisinin biosynthetic pathway (Fig. 2), the primary route from farnesyl diphosphate (FDP) precursor proceeds via the enzymes ADS, CYP71AV1, ALDH1, and DBR2, resulting in artemisinin production. However, competing branching pathways also exist which consume the FDP precursor, potentially diverting resources and thus negatively influencing artemisinin biosynthesis. Specifically, sesquiterpene synthases, including beta-caryophyllene synthase (CPS), germacrene A synthase (GAS), and epi-cedrol synthase (ECS) as well as squalene synthase (SQS), can negatively affect artemisinin yields²⁹. If RED1 is active, it converts a key intermediate into a non-productive product. To maximize artemisinin production, high expression of ADS, CYP71AV1, DBR2, ALDH1 genes is required. These genes encode enzymes that convert FDP into dihydroartemisinic acid, the immediate precursor of artemisinin. Low expression of RED1, SQS, CPS, GAS, and ECS is also necessary to inhibit the flux of FDP away from the artemisinin biosynthetic pathway²⁹. In the Current study it is demonstrated that CuO NPs significantly modulated the expression of key genes engaged in the artemisinin biosynthetic pathway in A. absinthium (Fig. 8).

Table 3.

Gene expression changes (relative to control) in response to CuO NPs treated A. absinthium.

Gene	Green CuO NPs-fold change (2 ppm)	Green CuO NPs-fold change (4 ppm)	Chemical CuO NPs-fold change (2ppm)	Chemical CuO NPs-fold change (4 ppm)
FDS	1.31×	1.75×	1.76×	1.00×
ADS	2.72×	2.03×	2.35×	1.29×
CYP71AV1	1.33×	2.00×	1.86×	0.98×
DBR2	1.33×	1.83×	2.34×	1.39×
ALDH1	1.40×	1.73×	1.34×	1.01×
RED1	1.23×	1.54×	1.54×	1.07×
CPR	1.21×	1.50×	1.65×	0.94×

Fig. 8.

Relative expression changes of artemisinin pathway genes in A. absinthium treated with green and chemically synthesized CuO NPs.

As shown in Fig. 8a, FDS expression reached a maximum of 2.80 ± 0.06 at 4 ppm of green CuO NPs and 2.82 ± 0.02 at 2 ppm of chemical CuO NPs treatments. Indeed, FDS, which supplies the FDP substrate, showed consistent upregulation, 1.31- and 1.76-fold, under green (at 4 ppm) and chemical (at 2 ppm) CuO NPs, respectively, suggesting an expanded precursor pool available for sesquiterpene biosynthesis (Table 3). Evidently, ADS was the most affected variable when subjected to green CuO NPs exposure, increased from 1.20 ± 0.06 in the control to 3.27 ± 0.09 at 2 ppm concentration. There was a similar trend with chemical CuO NPs exposure (2.82 ± 0.09 at 2 ppm) but much less pronounced (Fig. 8b). ADS expression showed the highest induction in both green and chemical NPs treatments, with an approximate 2.72- and 2.03-fold increase at 2 ppm and 4 ppm of green synthesized CuO NPs, respectively, as well as 2.35- and 1.29-fold at 2 ppm and 4 ppm of chemical synthesized CuO NPs, relative to the control (Table 3). This suggests a possible shift in the metabolic flux away from the competitive branch and toward artemisinin production. The expression of CYP71AV1, a multifunctional cytochrome P450 oxidase essential for oxidation of amorphadiene derivatives, increased to 2.40 ± 0.06 (green CuO NPs, 4 ppm) and 2.23 ± 0.03 (chemical CuO NPs, 2 ppm), compared to control value of 1.20 ± 0.06 (Fig. 8c), approximately 2.00- and 1.86-fold increase, respectively (Table 3). CPR (cytochrome P450 reductase) expression followed a dose-dependent pattern, reaching 2.10 ± 0.05 (green CuO NPs, 4 ppm) and 2.32 ± 0.01 (chemical CuO NPs, 2 ppm), from a control of 1.4 ± 0.05 (Fig. 8d). the transcriptome of CPR, an enzyme that facilitates electron transfer to CYP71AV1, was relatively modestly upregulated (∼1.50-fold for 4 ppm of green CuO NPs and ∼1.65-fold for 2 ppm of chemical CuO NPs), thereby most likely enhancing the series of oxidation steps critical for artemisinin biosynthesis. DBR2 was over expressed to 2.20 ± 0.06 (green CuO NPs, 4 ppm) and 2.80 ± 0.03 (chemical CuO NPs, 2 ppm) from a baseline of 1.20 ± 0.05 (Fig. 8e) and comparative expression relative to the control group corresponded to 1.83-fold and 2.34-fold upregulation, respectively (Table 3). ALDH1 expression was shown to increase to 2.60 ± 0.05 and 2.00 ± 0.01 at 4 ppm of green and 2 ppm of chemical CuO NPs, respectively (Fig. 8f). In fact, the terminal oxidizing enzyme, ALDH1, had moderate levels of upregulation (1.73-fold for 4 ppm green, and 1.33-fold for 2 ppm chemical CuO NPs) indicating a positive inclination towards generating dihydroartemisinate, the immediate precursor of artemisinin. In general, according to the results presented in Fig. 8; Table 3, green-synthesized CuO NPs at 4 ppm and chemically synthesized CuO NPs at 2 ppm were more effective in enhancing the expression of genes engaged in the artemisinin biosynthetic pathway in A. absinthium organ Cultures. Therefore, CuO NPs can function as a potent elicitor and modifiers of plant secondary metabolite biosynthesis in a dose and synthesis method related fashion.

The present investigation shows that CuO NPs cause an upregulation of essential genes involved in the artemisinin metabolic pathway. Interestingly, the upregulation of ADS and CYP71AV1, both involved in early stages of the pathway, signals that CuO NPs reroute flux from the primary metabolite to sesquiterpene lactone biosynthesis. Furthermore, under CuO NPs treatments, the upregulation of DBR2 and CPR are important factors that possibly promote increased artemisinin biosynthesis. These results are in line with earlier studies reporting that increased production of artemisinin was associated with high expression of the above-mentioned genes in high-yielding Artemisia species^29,30. It appears that CuO NPs can act similarly to other previously reported NPs, such as chitosan NPs³¹ and Ag-SiO₂ NPs³², in promoting the collection of artemisinin and upregulating its biosynthetic pathway genes. It is stated that the observed transcriptional activation of these genes is most likely because of the oxidative stress induction and the activation of antioxidant defense system in the plants, as suggested by the increased enzymatic activities of SOD, CAT, PAL, and POX. On the other hand, accumulating evidence suggest that ROS generation may facilitate spontaneous changes at the last steps of artemisinin biosynthetic pathway. At this phase, spontaneous autoxidation mechanisms, with no enzymatic activities, transform dihydroartemisinate to artemisinin^33,34. According to a previous study, CuO NPs can activate the antioxidant system in callus Cultures of A. absinthium³⁵. It is shown that Agrobacterium-mediated transformation of A. annua to overexpression of many artemisinin biosynthesis pathway genes such as FDS, ADS, CYP71AV1, CPR, and ALDH1 is a helpful method to accelerate artemisinin biogenesis^36,37. In conclusion, based on our results, the transcriptional upregulation of these genes via CuO NPs could be a feasible alternative method to improve artemisinin yield. Precious studies have shown that CuO NPs, particularly those synthesized by plant extracts, can act as efficient elicitors to boost the manufacturing of specific secondary metabolites. For example, it is claimed that the use of CuO NPs increased the production of morphinan alkaloids and taxanes in Papaver orientale and Corylus avellana, respectively, by activating key biosynthetic genes and inducing oxidative stress^38,39.

The evidence presented in this investigation suggests that concentration and method of synthesis have the greatest impact on the elicitation potential of CuO NPs. An examination of the gene expression analysis showed that 4 ppm of the green synthesized NPs maximally induced most of the genes engaged in the artemisinin route, while the 2 ppm of the chemically synthesized NPs elicited similar and, in some instances, greater effects with genes such as DBR2. It appears that variations in the physiochemical characteristics of NPs, such as their size distribution, surface chemistry, or particle shape, can significantly affect how they interact with plants. For instance, green synthesis approaches often use simple aqueous extracts of plants to reduce and stabilize the NPs and therefore they may get some extra bioactivity or biocompatibility compared to their chemically synthesized equivalents, which have generally shown greater phytotoxicity^21,22. Previous studies have demonstrated that the green-synthesized NPs can positively influence secondary metabolite production and the expression of genes associated with their biosynthetic pathways. For instance, Tripathi et al.⁴⁰ showed that the biosynthesized Ag NPs, at low concentrations, increased withanolides production and augmented the expression of terpenes biosynthetic genes in Withania coagulans. The combined treatment of 0.5 mg/L of the biosynthesized Ag NPs and 3 h exposure to ultraviolet B resulted in high accumulation of artemisinin and upregulation of the related biosynthetic pathway genes in A. annua⁴¹. To achieve maximal induction of secondary metabolite production in plants with the least cytotoxicity effects, simultaneously optimization of these parameters will be necessary.

Although artemisinin content was not directly quantified in the present study, several independent investigations have demonstrated that transcriptional upregulation of key artemisinin biosynthetic genes is strongly correlated with increased artemisinin accumulation, as confirmed by chromatographic analyses such as HPLC. A comparative overview of representative studies reporting nanoparticle- or elicitor-induced gene expression changes together with HPLC-based artemisinin quantification is summarized in Table 4. These reports provide supporting evidence for the biological relevance of the transcriptional responses observed in the present work.

Table 4.

Summary of published studies correlating enhanced expression of Artemisinin biosynthetic genes with Artemisinin accumulation confirmed by chromatographic analyses.

Plant	Enhanced gene expressions	Elicitors	Method of assessment and main findings	Reference
Artemisia annua	AaWRKY1, AaMYB2, HMGR, and CYP71AV1	Fe3O4-NPs	HPLC showed artemisinin increase in plants treated with 50, 100 and 200 mg/L Fe3O4-NP by 98.5%, 76.3%, and 77%	43
Artemisia annua	AaMYB17	Graphene	HPLC demonstrated artemisinin increase in plants treated with graphene in low concentrations of 10 and 20 mg/L	44
Artemisia annua	ADS, CYP71A1, and PAL	Ag NPs and UV-B	artemisinin increase was confirmed with HPLC in plants treated with 0.5 mg/L of Ag NPs and 3 h of UV-B	41
Artemisia absinthium	FDS, ADS, CYP71AV1, DBR2, and ALDH1	CuO NPs	qRT-PCR analysis revealed significant upregulation of key artemisinin biosynthetic genes under CuO NP treatments (2 and 4 ppm); metabolite levels were not assessed in this study	Current study

Moderate upregulation of competing pathway genes

The expression of RED1, an enzyme that divert dihydroartemisinic aldehyde toward a useless alcohol derivative, exhibited a mild increase under green and chemically produced CuO NPs treatments (1.54-fold), at 4 and 2 ppm concentrations, respectively (Table 3). Specifically, RED1 transcript levels reached 2.00 ± 0.05 (green CuO NPs, 4 ppm) and 2.01 ± 0.02 (chemical CuO NPs, 2 ppm), compared to control levels of approximately 1.3 ± 0.06 (Fig. 8g). This suggests that metabolic competition against artemisinin biosynthesis probably remained minimal. Although RED1 was moderately upregulated, the simultaneous and significant increase in ALDH1 expression did not lead to a notable redirection of flux toward the dihydroartemisinic alcohol pathway. This indicates that the formation of this non-productive intermediate was not a major bottleneck for artemisinin biosynthesis. Prior studies have identified that a high ALDH1/DBR2 expression ratio indicates favorability to a metabolic switch toward artemisinic acid rather than artemisinin, particularly in A. deserti, where high expression of ALDH1 lead to accumulation of artemisinic acid in place of artemisinin³⁰. In our study, DBR2 expression was significantly upregulated, which can be interpreted as a possible shift towards biosynthesis of artemisinin. In another investigation, leaf-derived calli treated with cobalt NPs (5 mg/L) for 24 h showed higher amounts of artemisinin in comparison to the control samples, but the production pf artemisinin declined over time. Expression profiling indicated that SQS and DBR2 expression was ultimately downregulated, possibly causing dramatic decline in artemisinin content with time⁴².

Conclusion

This research clearly provides evidence that both biologically synthesized and chemically synthesized CuO NPs can effectively modulate the expression of key genes involved in the artemisinin biosynthetic pathway in A. absinthium organ cultures. Among the analyzed genes, ADS, CYP71AV1, DBR2, ALDH1, and FDS showed the most pronounced transcriptional responses, particularly under treatment with 4 ppm green-synthesized CuO NPs and 2 ppm chemically synthesized CuO NPs. Collectively, these molecular analyses imply that the upregulation of precursor-supplying and pathway-specific genes together with the limited induction of the competing gene RED1, suggests a favorable redirection of metabolic flux toward artemisinin biosynthesis. This work highlights the potential of integrating nanotechnology with plant tissue culture as a sustainable strategy for improving the production of valuable pharmaceutical metabolites.

To translate these molecular findings into practical applications, several strategic directions are proposed for future development. Synergistic approaches combining breeding and genetic engineering represent an important strategy. Quantifying artemisinin and artemisinic acid levels in tissues using LC-MS or HPLC can optimize cultures conditions and further strengthen conclusions and should be considered in future studies. Finally, regulatory and environmental safety assessment should be conducted.

Author contributions

SM, MK-N, and SJ designed the study, revised, and edited the manuscript; R MR, FS, AK, M FG, S EF, and RB performed the investigations and analyzed data; RT interpreted the results and wrote the manuscript; All authors reviewed the manuscript.

Data availability

All data generated or analyzed during this study are included in this published article and are also available from the corresponding author on reasonable request.

Declarations

Competing interests

The authors declare no competing interests.