Skip to main content
Cell Reports Medicine logoLink to Cell Reports Medicine
. 2026 Feb 17;7(2):102618. doi: 10.1016/j.xcrm.2026.102618

Transgenic mouse-derived human monoclonal antibodies targeting EBV gp350 and gp42 provide basis for therapeutic development

Crystal B Chhan 1,2, Kevin Lang 1, Amelia R Davis 1, Yu-Hsin Wan 1, Nicholas T Aldridge 1, Gargi Kher 1, Samuel C Scharffenberger 1,3, Samantha R Hardy 1, Roman Iureniev 1, Natalia V Giltiay 1, Kristina R Edwards 1,2, Stefan Radtke 4,5, Hans-Peter Kiem 4,5,6, Marie Pancera 1, Andrew T McGuire 1,2,3,7,
PMCID: PMC12923964  PMID: 41707657

Summary

Epstein-Barr virus (EBV) causes infectious mononucleosis and contributes to neurodegenerative disorders and malignancies, particularly in immune-compromised hosts. Transplant patients face high risk of post-transplant lymphoproliferative disease, a life-threatening EBV-driven lymphoma. There are no EBV-specific vaccines or treatments; however, neutralizing antibodies against EBV glycoproteins may offer utility as therapeutic agents. EBV entry into B cells involves gp350, which binds complement receptors, and gp42, which engages HLA class II to trigger fusion. Most existing monoclonal antibodies (mAbs) against these antigens are non-human, limiting clinical use. Using a transgenic mouse model, we generate two gp350 and eight gp42 genetically human neutralizing mAbs that block receptor binding. Structural analyses reveal extended sites of vulnerability relevant to vaccine development. Delivery of a gp42 mAb protects humanized mice from EBV challenge, while a gp350 mAb provides partial protection. These mAbs highlight the utility of transgenic mice to produce therapeutic mAbs for preventing EBV-driven disease.

Keywords: EBV, monoclonal antibodies, transgenic mice, gp350, gp42, neutralizing antibodies

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • Transgenic mice were used to make genetically human EBV mAbs against gp350 and gp42

  • mAbs potently neutralize EBV infection by blocking receptor-ligand interactions

  • mAbs prevent EBV infection following EBV challenge in humanized mice


Epstein-Barr virus (EBV) can cause serious illness, including cancer, especially in immunocompromised patients. There are no EBV-specific treatments. Chhan et al. leverage a transgenic mouse model to develop human monoclonal antibodies that block EBV entry. These antibodies prevent EBV infection in a murine challenge model offering hope for new therapies.

Introduction

Epstein-Barr virus (EBV) is a ubiquitous gamma herpesvirus.1 The most common sequelae of EBV infection is infectious mononucleosis, a self-limiting illness that can occur following primary infection with EBV.2,3 EBV is also associated with multiple sclerosis,4,5,6,7,8,9,10 systemic lupus erythematosus,11 rheumatoid arthritis,12,13 and complications of COVID-19 infection.14,15,16 Importantly, EBV was the first virus shown to be oncogenic in humans and is associated with approximately 358,000 new cases of cancer, resulting in 209,000 deaths each year.17,18 Most EBV cancers originate from epithelial cells and B cells,19 the primary cell types infected by EBV, and the sites of replication and latency, respectively.

EBV relies on several glycoproteins and utilizes distinct entry pathways to infect B cells and epithelial cells.19,20 The viral fusion machinery gH, gL, and gB is critical for infection, irrespective of the cell type.21,22 gH and gL form a 1:1 heterodimeric complex that acts as a regulator of membrane fusion. Upon binding one or more host cell surface receptors, gH/gL relays a triggering signal to the fusogen gB.22,23,24 EBV infection of B cells is initiated by attachment to complement receptors 1 (CD35) and/or 2 (CD21) by the viral glycoprotein gp350 or splice variant gp220.25,26,27 B cell infection requires an additional viral protein, gp42, that forms a tripartite complex with gH and gL.28 The extended N terminus of gp42 wraps around gH/gL, while the position of the C-terminal domain of gp42 relative to gH/gL is conformationally dynamic and can exist in an “open” or “closed” state.29 Binding of gp42 to class II human leukocyte antigens (HLA) on the B cell surface leads to triggering of gB-mediated fusion through the gH/gL-gp42 complex.29,30,31 A hydrophobic pocket on gp42 that is distinct from the HLA-binding site makes contact with domain II (DII) of gH/gL in the “closed” conformation, and binding to HLA class II induces structural changes in this pocket.29,32 The pocket is functionally important, as it is the target of neutralizing antibodies,33,34 and mutating this region inhibits fusion without affecting the gH/gL or HLA interactions.35,36,37

Following primary infection, a latent state persisting in resting memory B cells is established.19,38 Latently infected cells can reactivate expression of lytic genes, but these are typically eliminated by cytotoxic lymphocytes.38,39 As a result, most infected individuals carry the virus asymptomatically for life.19,39,40 However, immune-compromised hosts have reduced immune surveillance resulting in higher rates of EBV-driven malignancies, such as in the case of HIV-infected individuals compared to the general population.41,42 Additionally, individuals undergoing medically supervised immune suppression in the context of stem cell or organ transplant are at a high risk for post-transplant lymphoproliferative disease (PTLD), a life-threatening lymphoma driven by unchecked proliferation of EBV-infected cells.19,43,44

The incidence of PTLD is substantially higher in EBV-seronegative individuals compared to seropositive individuals, suggesting that pre-existing immunity plays an important role in preventing PTLD.45,46 It has been speculated that passive transfer of neutralizing antibodies could protect against EBV acquisition in EBV-seronegative solid-organ transplant recipients and reduce the risk of PTLD.47,48 Passive transfer of EBV-neutralizing monoclonal antibodies (mAbs) against gH/gL, gB, gp350, and gp42 into humanized mice prior to EBV challenge can prevent viremia, splenomegaly, EBV-driven lymphoma, and death to varying degrees depending on the experimental model and individual mAb.33,34,49,50,51,52,53,54 Similarly, mAbs against gp350 and gH/gL can protect against experimental challenge with rhesus lymphocryptovirus, the EBV ortholog infecting rhesus macaques.54,55 Combined, these data provide in vivo proof of concept that antibody-mediated prophylaxis may be an effective intervention.

As for human studies, a murine mAb 72A1,56 which potently neutralizes EBV infection of B cells in vitro, was evaluated in a small pilot study of EBV-seronegative liver transplant recipients.48 72A1 appeared to provide short-term protection against EBV acquisition; however, all participants developed anti-drug antibodies and one developed a hypersensitivity reaction, indicating that alternative mAbs with reduced reactogenicity are needed. This spurred subsequent efforts to humanize 72A1.57,58 Alternatively, mAbs targeting EBV glycoproteins have been isolated from human memory B cells of EBV-infected individuals using phage display libraries or antigen-specific cell sorting.33,50,52,59 The latter technique relies on using fluorescently labeled antigens to identify pathogen-specific memory B cells through their cell surface B cell receptors. Historically, isolating gp350 and gp42 mAbs with native glycoproteins using this approach was not possible due to their ability to bind to complement receptors and HLA class II on the B cell surface, respectively, negating B cell receptor-specific staining.59 A recombinant gp350 variant engineered to disrupt complement receptor binding recently enabled the identification of human memory B cells and the corresponding gp350 mAbs through cell sorting.60 Panning of human antibody phage display libraries has enabled isolation of mAbs against gp42.33

As an alternative, we leveraged a rearranging mouse model (ATX-GK) from Alloy Therapeutics61 where both murine antibody heavy chain variable, diversity, and joining genes and kappa variable and joining genes were replaced with human ones. These mice produce a human-origin antibody repertoire. To isolate and discover mAbs against EBV proteins, ATX-GK mice were immunized with recombinant gp350 and gp42 to generate hybridomas, which were screened for antigen reactivity and neutralizing activity. Using this approach, we identified two unique gp350 mAbs and eight gp42 mAbs, representing two distinct clonal lineages, which were produced as recombinant, fully human IgG mAbs. The binding kinetics, neutralizing activities, and inhibition of receptor binding by the mAbs, combined with structural analyses of them in complex with their targets, demonstrate that they neutralize EBV infectivity of B cells by directly inhibiting viral glycoprotein interactions with host complement receptors (in the case of gp350) and HLA class II (in the case of gp42). Passive transfer of a gp42 mAb prevented splenomegaly, viremia, and detectable viral DNA in the spleens of humanized mice, while a gp350 mAb showed partial protection. These results motivate the continued development of these antibodies as prophylactic agents for the prevention of EBV-driven diseases.

Results

Isolation of genetically human anti-EBV monoclonal antibodies from transgenic mice

We sought to isolate genetically human mAbs against gp350 and gp42 by immunizing ATX-GK transgenic mice (Figure 1A). Paired sequencing of IgM B cell receptors expressed by B cells collected from naive mice show diverse VH and VL gene usage (Figures S1A and S1B). The 3rd complementarity heavy chain determining region (CDRH3) lengths followed a Gaussian distribution with an average length of 13 amino acids (Figure S1C). The CDRL3 lengths were less variable with most being nine amino acids long (Figure S1D). We observed diverse clonotypes in each mouse with a slight skewing to IGKVD1-39 (Figures S1D and S1E), consistent with this being the most highly expressed VK gene (Figure S1B). We reasoned that ATX-GK mice were, therefore, an appropriate model to elicit genetically human antibodies.

Figure 1.

Figure 1

Isolation of anti-EBV antibodies from ATX-GK mice

(A) Overview of mAb discovery pipeline. Created with BioRender.com.

(B) Binding of 190 polyclonal hybridoma culture supernatants to gp42- or gp350-coupled beads.

(C) Supernatant from hybridoma cultures with gp42 or gp350 binding activity in (B) were evaluated for their ability to neutralize EBV infection of B cells.

(D) Monoclonal cell lines isolated from cultures with neutralizing activity in (C) were re-screened for the ability to neutralize EBV infection of B cells. Dashed line represents 50% infectivity in (C and D).

ATX-GK mice were co-immunized with a truncated recombinant gp350 protein encompassing the first three structural domains and the gp42 ectodomain and used to generate hybridomas, which were seeded at a density of ∼50–100 cells perwell and cultured in 384 well plates. Culture supernatants with gp350-or gp42-binding antibodies were identified using a high-throughput, flow-based, antigen-coupled bead assay (Figure 1B). Wells with the desired binding activity were re-arrayed in 96-well plates, sub-cultured, and screened for neutralizing activity against EBV infection of Raji B cells (Figure 1C). Culture supernatants that showed at least a 50% reduction in infectivity were then sub-cloned using a ClonePix colony picker to establish monoclonal cell lines. Supernatants from monoclonal lines were re-screened for B cell neutralization (Figure 1D). Those that exhibited at least 50% neutralizing activity were sequenced and produced as recombinant human IgG1 mAbs for further characterization. We identified two gp350- and eight gp42-neutralizing antibodies, herein deemed ATX-350 and ATX-42 mAbs. Seven of the eight gp42 mAbs (ATX-42-1.1–ATX-42-1.7) were determined to be clonal variants based on VH and VL gene usage as well as CDRH3 and CDRL3 sequence similarities (Table S1).

ATX-350 mAbs bind with high affinity and inhibit EBV infection of B cells

To further characterize the ATX-350 mAbs, we measured the binding affinity of antigen-binding fragments (Fabs) to recombinant gp350 using biolayer interferometry (BLI). ATX-350-2 had the highest affinity (0.4 nM), which was 2-fold higher than the control 72A1 Fab (0.8 nM, Figure 2A; Table S2). The affinity of ATX-350-1 (3.4 nM) was ∼10-fold lower than that of ATX-350-2 (Figure 2A; Table S2).

Figure 2.

Figure 2

Binding and neutralizing activity of ATX-350 mAbs

(A) Binding affinity of the ATX-350 Fabs to recombinant gp350 was measured by biolayer interferometry. Each data point represents the KD calculated from an independent experiment, and the bars reprent the mean (n = 3 per mAb).

(B) The indicated mAbs were evaluated for their ability to neutralize EBV (B95.8/F-GFP) infection of Raji cells. Representative curves from one experimental replicate are shown. Each mAb concentration was tested in duplicate, and error bars represent the standard deviation.

(C) Half-maximal inhibitory concentration (IC50) for the indicated mAbs was calculated from neutralization dose-response curves. Each data point represents an independent experiment measured in duplicate (ATX-350-1, n = 9; ATX-350-2, n = 6; 72A1, n = 11; 769A9, n = 2; 770E11, n = 2). Bars represent the mean. Asterisks denote a statistically significant difference between two mAbs determined using a Mann-Whitney test where ∗p ≤ 0.05, ∗∗∗p ≤ 0.0005, and ∗∗∗∗p ≤ 0.0001.

(D) The indicated mAbs were evaluated for their ability to neutralize EBV (Akata-GFP) infection of SVKCR2 cells. Each data point represents the mean of two technical replicates, and the error bars represent the standard deviation. Representative curves from one of two experimental replicates are shown.

(E) The indicated mAbs were evaluated for their ability to neutralize infection of EBV (M81-Luc) in CD21-negative AGS epithelial cells at a concentration of 10 μg/mL. Each data point represents the average infectivity of two technical replicates from an independent experiment (cells only, n = 4; isotype control, n = 4; ATX350-1, n = 4; 72A1, n = 4; ATX-350-2, n = 4; AMMO1, n = 4), and the error bars represent the standard deviation.

(F) The ability of gp350 to bind to soluble CD21 in the presence of the indicated mAbs was determined using biolayer interferometry. One replicate per mAb was performed.

(G) The indicated mAbs were evaluated for their ability to inhibit binding of APC-conjugated gp350 to Raji cells by flow cytometry. One replicate per mAb was performed.

(H) The indicated mAbs were evaluated for their ability to inhibit binding of gp350 to primary B cells. One replicate per mAb was performed.

We next assessed whether the ATX-350 mAbs could neutralize EBV (B95.8/F) infection of Raji B cells. For comparison, we included known gp350 human mAbs, 769A9 and 770E11,60 as well as a version of the 72A1 mAb with a human IgG1 Fc region. The half-maximal inhibitory concentration (IC50) of ATX-350-2 (0.02 μg/mL) was comparable to 72A1 (IC50 = 0.03 μg/mL, Figures 2B and 2C). ATX-350-1 was significantly less potent (IC50 = 9.8 μg/mL) than either ATX-350-2 or 72A1 (Figures 2B and 2C). The 50-fold weaker neutralization by ATX-350-1 compared to ATX-350-2 is greater than the 10-fold difference in binding affinity, implying that affinity and neutralization are not strictly correlated. Neither ATX-350-1 nor ATX-350-2 was as potent as the recently described 769A9 (IC50 = 0.006 μg/mL) and 770E11 (IC50 = 0.004 μg/mL) mAbs isolated from humans (Figures 2B and 2C).

We next assessed the ability of the ATX-350 mAbs to inhibit EBV (Akata-GFP) infection of SVKCR2 epithelial cells. In this assay, ATX-350-2 was >10-fold more potent than 72A1 and comparable to the gH/gL mAb AMMO1 (Figure 2D),59 while ATX-350-1 was non-neutralizing. SVKCR2 cells are engineered to express CD21 to overcome the relatively poor infectivity of cultured epithelial cells.62 We therefore tested the ability of the mAbs to neutralize EBV infection in a CD21-negative AGS cell line.63,64 Here we used the M81 EBV strain, which has an increased propensity to infect epithelial cells and is engineered to express a luciferase reporter gene.63,65,66 In this assay, none of the gp350 mAbs could reduce infectivity by 50%, while the gH/gL mAb AMMO1 retained neutralizing activity (Figure 2E). 72A1 has shown reduced binding to M81 lymphoblastoid cell lines (LCLs) compared to B95.8 LCLs, potentially due to gp350 sequence differences between the strains.67 Therefore, to verify that the lack of neutralization by ATX-350-2 and 72A1 is not due to neutralization resistance by M81, we confirmed that these two mAbs neutralize M81 infectivity in SVKCR2 cells (Figure S2).

These results indicate that the gp350 mAbs neutralize EBV by inhibiting the gp350-CD21 interaction. To confirm this, we evaluated whether the gp350 mAbs could prevent the gp350-CD21 interaction using BLI. ATX-350-1, ATX-350-2, and 72A1 strongly inhibited soluble recombinant CD21 binding to gp350 immobilized on biosensors, while an isotype control mAb did not (Figure 2F). CD35 has been identified as another receptor for gp350,27 but we were unable to assess whether the mAbs directly disrupt the gp350-CD35 interaction as we were unable to detect binding of gp350 to the recombinant CD35 ectodomain (Figure S3). To assess whether the mAbs inhibit binding of gp350 to native CD21 and/or CD35 receptors on B cells, we evaluated whether they could prevent gp350 binding to the surface of Raji B cells. ATX-350-1, ATX-350-2, and 72A1 inhibited APC-conjugated gp350 staining in a dose-dependent manner (Figure 2G), consistent with their relative potencies in the CD21-positive epithelial cell neutralization assay (Figure 2D). We further confirmed that high concentrations of these three mAbs could inhibit binding of gp350 to primary B cells as well (Figure 2H). As expected, the gH/gL AMMO1 mAb did not inhibit APC-gp350 staining of Raji cells (Figure 2G) or primary B cells (Figure 2H). Taken together, these data demonstrate that ATX-350-1 and ATX-350-2 mAbs neutralize EBV infection of B cells with differing potencies by inhibiting gp350 from binding to CD21 and presumably CD35.

ATX-350 mAbs bind partially overlapping epitopes on the CD21-binding site of gp350

To understand whether epitope differences between ATX-350-1, ATX-350-2, and 72A1 could explain the differences in their neutralizing potencies, we evaluated whether they compete for binding to recombinant gp350 via BLI. gp350 was immobilized on a biosensor, saturated with an mAb of interest, and then immersed in a solution of potentially competing mAb. Inhibition is read out as a reduction in binding of the second mAb relative to its binding in the absence of the first mAb. As expected, all mAbs self-competed for gp350 binding (Figure 3A). ATX-350-1 and ATX-350-2 strongly competed with each other for gp350 binding. We observed partial competition between 72A1 and ATX-350-2, while 72A1 and ATX-350-1 did not compete (Figure 3A). These data suggest that all the mAbs have unique binding footprints on gp350.

Figure 3.

Figure 3

ATX-350 mAbs share partially overlapping epitopes on the CD21-binding site of gp350

(A) mAb competition for binding to gp350 was assessed via BLI.

(B) X-ray crystal structure of gp350/ATX-350-2 Fab complex.

(C) Zoom in of the binding interactions of ATX-350-2 with gp350. Hydrogen bonds are indicated by cyan dashed lines, salt bridges by orange dashed lines, and residues are labeled and shown in sticks. The first panel shows interactions with the light chain. The central and right panels show interactions with the heavy chain.

(D–F) ns-EM 3D reconstruction of the gp350/ATX-350-1 Fab (D), gp350/72A1 Fab (E), and gp350/ATX-350-1 Fab/72A1 Fab complexes (F). Coordinates of gp350 (yellow, PDB: 8SM0) and AlphaFold 3 predictions of the different mAbs (ATX-350-1, blue; 72A1, cyan) were fitted in the 3D map.

(G) Alignment of the gp350/ATX-350-1 model with structures of gp350/ATX-350-2 (this paper) and gp350/CD21-SRI-II (Sushi repeat I and II subunit, purple; PDB: 8SM0).

(H) Alignment of the gp350/72A1 model with the gp350/ATX-350-2 structure (this paper) and gp350/CD21-SRI-II (purple).

(I–K) Structural comparison of gp350-ATX-350-2 structure (this paper) with other mAbs; gp350 in yellow, ATX-350-2 in red, and 769A9 in pink (PDB: 8SM1) (I); Cy137C02 in light blue (PDB: 8SIC) (J); and Cy651H02 in orange (PDB: 8SGN) (K).

Since ATX-350-2 showed the highest neutralizing potency against EBV infection of B cells, we determined the crystal structure of ATX-350-2 Fab in complex with gp350 to a resolution of 3.93 Å (Table S3) to gain a better understanding of the interactions at the molecular level (Figures 3B, S4A, and S4B). The structure revealed that the ATX-350-2 epitope is discontinuous (Figures 3B and 3C), mainly focused on domain 1, around residues 147–155 of gp350, an area that accounts for nearly 59% of the total buried surface area (Figure S4E). ATX-350-2 buries ∼849 Å2, with ∼628 Å2 contributed by the heavy chain and ∼221 Å2 from the light chain (Figure S4E). Similarly, gp350 buries ∼847 Å2 on ATX-350-2 surface, with ∼618 Å2 on the heavy chain and ∼229 Å2 on the light chain (Figure S4F). All three CDRs are involved in the interaction for the heavy chain, whereas the first and third light chain CDRs are involved in the interaction (Figure S4F). Interactions are concentrated around residues His17, Leu18, Thr19, Gln147, and Asn148 of gp350 with the light chain (Figure 3C, left). Notably the hydroxyl group of Tyr32 (light chain) forms a hydrogen bond with the carboxyl group of Leu18 of gp350 (Figure 3C, left). The heavy chain contacts residues Glu21, Asp53, Gln121, Gln122, Asn148, Pro149, Tyr151, and Ile153 of gp350 (Figure 3C, middle and right). In particular, the guanidinium group of arginines 33, 58, and 99 from the heavy chain make salt bridges with Glu21 and Asp53 of gp350. Additionally, hydrogen bonds are observed between Asn54 (heavy chain) and the carboxyl group of Gln121 of gp350, as well as between the carboxyl group of Tyr100A (heavy chain) and Asn148 of gp350, and between Asn54 (heavy chain) and Gln122 of gp350. A possible CH-π stacking interaction is also observed between Trp100 (heavy chain) and Pro149 of gp350 (Figures 3C and S4E). The ATX-350-2-binding site on gp350 overlaps significantly with the CD21-binding footprint (Figures S4C and S4D), and many of the contact residues on gp350 buried in the gp350/CD21 complex are also buried in the gp350/ATX-350-2 complex (Figure S4E). To gain a better understanding of the epitopes targeted by ATX-350-1 and 72A1, we used negative stain electron microscopy (nsEM). We obtained 3D reconstructions of gp350 in complex with ATX-350-1 Fab (Figure 3D), 72A1 Fab (Figure 3E), and both ATX-350-1 and 72A1 Fabs (Figure 3F), which confirmed that the mAbs bind to distinct epitopes on gp350. While the 72A1 and ATX-350-1 epitopes do not overlap (Figure 3F), alignment of the fitted gp350/ATX-350-1 Fab to the gp350/ATX-350-2 Fab and the gp350-CD21 crystal structures60 reveals that the epitopes of these two mAbs overlap and clash with CD21 (Figure 3G); however, the clash with CD21 is more obvious for ATX-350-2 compared to ATX-350-1 (Figure 3G). Thus, differences in epitopes and affinities of these mAbs for gp350 may explain the difference in neutralizing potency between the two (Figure 2B). Alignment of the fitted gp350/72A1 Fab to the gp350/ATX-350-2 Fab and the gp350-CD21 crystal structures60 demonstrates that the two mAbs bind adjacent epitopes on gp350 (Figure 3H). This suggests that the partial competition measured between ATX-350-2 and 72A1 by BLI (Figure 3A) may be due to steric inhibition rather than direct epitope overlap.

Figure 4.

Figure 4

Binding and neutralizing activity of anti-gp42 mAbs

(A) Binding affinity of the indicated mAbs to recombinant gp42 (closed circles) or to gp42/gH/gL complex (open circles) was measured by biolayer interferometry. Each data point represents the KD calculated from one experiment.

(B) The indicated mAbs were evaluated for their ability to neutralize EBV (B95.8/F-GFP) infection of Raji B cells. Representative curves from one experimental replicate are shown. Each mAb concentration was tested in duplicate, and error bars represent the standard deviation.

(C) Half-maximal inhibitory concentration (IC50) for the indicated mAbs calculated from neutralization dose-response curves. Each data point represents an independent experiment measured in duplicate, and bars represent the mean (ATX-42-1.1-ATX-42-1.4, n = 4; ATX-42-1.5, n = 7; ATX-42-1.6, n = 3; ATX-42-1.7, n = 7; ATX-42-2, n = 7; F-2-1, n = 12; A10, n = 3 4C12, n = 3).

(D) The indicated mAbs evaluated for their ability to neutralize EBV (AKATA-GFP) infection of SVKCR2 epithelial cells. Each data point represents the mean of two technical replicates, and the error bars represent the standard deviation. Representative curves from one of two experimental replicates are shown.

(E) The ability of gH/gL/gp42 to bind to recombinant HLA-DR in the presence of the indicated mAbs was determined using biolayer interferometry. One replicate per mAb was performed.

(F) The indicated mAbs were evaluated for their ability to inhibit binding of PE-conjugated gp42 to Raji cells by flow cytometry. One replicate per mAb was performed.

(G) The indicated mAbs were evaluated for their ability to inhibit binding of gp42 primary human B cells. One replicate per mAb was performed.

Finally, we compared the structure of the gp350/ATX-350-2 complex with those of previously described neutralizing mAbs.60 ATX-350-2 and another genetically human mAb, 769A9, partially overlap (Figure 3I) and both make contacts with Glu21 on gp350, but their epitope specificities are otherwise distinct (Figure S4E). These epitope differences may account for the difference in potency of the two mAbs (Figure 2C). ATX-350-2 also shows partial overlap with the simian mAbs Cy137C02 (Figure 3J) and CY651H02 (Figure 3K), emphasizing the discovery of an extended site of vulnerability that overlaps with CD21-binding site.

ATX-42 mAbs bind with high affinity and inhibit EBV infection of B cells

Next, we characterized the gp42 mAbs isolated from ATX-GK mice. We first measured the binding affinity of the ATX-42 mAbs to recombinant gp42 and to the recombinant gH/gL/gp42 heterotrimer complex (Figure S5). We included the A10 mAb isolated from an immunized non-human primate, which binds to the HLA-binding site on gp42, and the murine mAb 4C12, which binds to the hydrophobic patch on gp42.34 All ATX-42-1 clones bound both gp42 alone and gp42 in complex with gH/gL (KD = 0.29–2.5 nM) with no stark differences in affinity between the two (Figure 4A; Table S2). Relative to the ATX-42-1 clones, ATX-42-2 bound to gp42 with higher affinity (0.14 and 0.10 nM for gp42 monomer and gH/gL/gp42, respectively), similar to the affinity of A10 (Figure 4A; Table S2). In contrast, 4C12 showed ∼10-fold reduced affinity to the gH/gL/gp42 complex, consistent with steric occlusion of the hydrophobic patch on gp42 by gH/gL34 (Figure 4A).

We next assessed the ability of the ATX-42 mAbs to neutralize EBV infection of B cells. All ATX-42 mAbs neutralized EBV infection of Raji B cells comparably (IC50 = 0.1–0.3 μg/mL) with ATX-42-2 being the most potent (Figures 4B and 4C). The ATX-42 mAbs were more potent than 4C12 and the murine mAb F-2-1,68 but only approximately half as potent as A10 (IC50 = 0.06 μg/mL; Figures 4B and 4C). None of the gp42 mAbs could neutralize EBV infection of SVKCR2 epithelial cells, while the gH/gL mAb AMMO1 showed potent activity (Figure 4D).

Neutralizing epitopes on gp42 have been mapped to the HLA-binding site, the hydrophobic patch, and an epitope opposite the hydrophobic patch.33,34,53,69 We evaluated whether the gp42 mAbs could prevent the gp42-HLA-DRβ interaction using BLI. All ATX-42 mAbs, F-2-1, and A10 prevented binding of the soluble gH/gL/gp42 complex (Figure 4E) and the soluble gp42 monomer (Figure S6) to immobilized HLA-DR. In contrast, 4C12, which is known to bind to the hydrophobic pocket of gp42, did not inhibit, but rather enhanced gp42 binding to HLA-DRβ, consistent with an increase in avidity through immune-complex formation (Figures 4E and S6).

The ATX-42 mAbs, as well as A10, inhibited binding of PE-conjugated gp42 to Raji B cells with comparable potency (Figure 4F) and they could inhibit gp42 binding to the surface of primary B cells (Figure 4G), indicating that these mAbs inhibit binding to native HLA class II expressed on the B cell surface. As expected, the gp42 mAb 4C12, which binds the hydrophobic patch, and the gH/gL AMMO1 mAb did not inhibit gp42 binding to Raji or primary B cells (Figures 4F and 4G). Taken together, these results demonstrate that eight ATX-42 mAbs belong to two distinct clonal lineages that bind to gp42 with high affinity and neutralize EBV infection of B cells by preventing gp42 from binding to HLA class II.

ATX-42 mAbs target the HLA-binding site of gp42

To confirm that the ATX-42 mAbs target the HLA-binding site on gp42, we carried out epitope competition studies by BLI. The ATX-42-1 clones and ATX-42-2 strongly competed for gp42 binding with each other and with A10 and F-2-1—mAbs that target the HLA-binding site—but not with 4C12 (Figures 5A and S7). We next sought to structurally characterize the ATX-42-1.1 and ATX-42-2 Fabs in complex with the gH/gL/gp42 heterotrimer using nsEM. We observed different conformations within the 2D class averages relative to gH/gL for each complex (Figure 5B). We were able to generate 3D reconstructions of a closed and partially open conformation for the complex with ATX-42-2 (Figure 5C) and of a partially open and open conformation for the complex with ATX-42-1.1 (Figure 5D). These conformations were previously observed in the HLA-DQ2-gp42-gH/gL complex and are inherent to gp42 flexibility.29,32 We also generated a 3D reconstruction of an HLA-DR1β/gH/gL/gp42 complex in the closed confirmation (Figure 5E). Despite slight differences in the orientation of gp42, a superimposition of the 3D reconstructions of the ATX-42-2/gH/gL/gp42 and ATX-42-1.1/gH/gL/gp42 complexes in the partially open conformation suggests a clash between both mAbs (Figure 5F). A superimposition of the 3D reconstructions of the ATX-42-2/gH/gL/gp42 and HLA-DR1β/gH/gL/gp42 in the closed conformation reveals a clash between ATX-42-2 and HLA-DR1β despite slight differences in the orientation of gp42 (Figure 5G). The collective biochemical (Figures 4E–4G and 5A) and structural analyses (Figures 5B–5G) demonstrate that the ATX-42 mAbs neutralize EBV infection by inhibiting the gp42-HLA class II interaction. A comparison of the ATX-42-2/gH/gL/gp42 complex (Figure S8A) with that of previously characterized gp42 antibodies A10,34 5E3,53 and F-2-134 indicates potential epitope overlap with mAbs that block the HLAII-gp42 interaction (Figures S8B–S8D), but not with the non-HLA-blocking mAbs 3E8,53 2C1,33 and 4C1234 (Figures S8E–S8G).

Figure 5.

Figure 5

ATX-42 mAbs target the HLA-binding site of gp42

(A) mAb competition for binding to gp42 was assessed via BLI. One replicate per mAb combination was performed.

(B) Representative reference free 2D class averages of ATX42-2 Fabs and ATX-42-1.1 Fabs bound to gH/gL/gp42 complex. Class averages indicate that ATX-42 mAbs bind to the open and closed conformations of the gH/gL/gp42 complex as indicated by red and blue squares, respectively. Scale bars represent 170Å.

(C–E) 3D reconstructions of gH/gL/gp42 complex in closed, partially open, and open conformation bound to ATX-42-2 Fab (C), ATX-42-1.1 Fab (D), and HLA-DR1β (E) with coordinates of gH/gL (blue and green, PDB: 7CZF), gp42 (cyan, PDB: 1KG0), AF3 models of ATX-42-2 (purple) and ATX-42.1.1 (pink), and HLA-DR1β (red, PDB: 1KG0) fitted into the map.

(F) Superimposition of the gH/gL/gp42/ATX-42-1.1 Fab partially open complex map with the one from gH/gL/gp42/ATX-42-2 Fab open complex.

(G) Superimposition of the gH/gL/gp42/ATX-42-2 Fab closed complex map with the one from gH/gL/gp42/HLA-DRβ complex.

Passive transfer of mAbs limit EBV infection in humanized mice

To evaluate whether the mAbs isolated in this study confer protection against EBV challenge in vivo, we utilized a humanized mouse model of EBV infection50,51,54,70,71,72,73 (Figure 6A). Ten weeks following engraftment of human CD34+ cells, we confirmed the reconstitution of the human hematopoietic compartment and presence of human B cells in the mice (Figure S9). At 16 weeks post-engraftment, the mice received an intraperitoneal injection of 500 μg of ATX-42-2 (n = 5), ATX-350-2 (n = 5), 72A1 (n = 4), AMMO1 (n = 4), or an isotype control (HIV-envelope mAb VRC01,74 n = 4), followed by intravenous challenge of EBV B95.8/F equivalent to ∼25,000 Raji infectious units 24 h later. An additional group of uninfected control mice did not receive antibody or virus challenge (n = 4). Blood was collected on the day of challenge to confirm the presence of transferred mAbs. Antigen-specific ELISAs indicated that mAbs were successfully transferred to all mice with the exception of mouse 5 in the ATX-350-2 group and mouse 1 in the 72A1 group, which were removed from the study (Figure 6B; Table S4). Mice were monitored for 11 weeks post-challenge for weight loss and survival and bled weekly starting at week 4 to assess viremia (Figure S10; Table S4). At the time of euthanasia, spleens were harvested, examined for tumors, weighed, and processed for DNA extraction to quantify viral DNA using qPCR. Spleen sections from representative mice were also submitted for histological staining for CD20 and for EBER1, a non-coding RNA that is abundant in infected cells.75

Figure 6.

Figure 6

Passive transfer of mAbs limits EBV infection in humanized mice

(A) Schema of experiments: Humanized NSG or NBSGW mice received PBS and the indicated mAb via intraperitoneal injection. After 24 h, mice were bled and challenged with EBV via intravenous injection. The inlaid table provides details about three independent experiments that were performed. Mice were bled and weighed weekly and euthanized at the time point indicated in the table or earlier if humane endpoints were met. Created using BioRender.com.

(B) Levels of the indicated mAbs in sera of experiment 1 were measured at the time of challenge (ATX-42-2 and ATX-350-2, n = 5; 72A1, AMMO1, and isotype control, n = 4).

(C) Spleen weights from the animals with detectable serum mAbs in (B) at the time of euthanasia (ATX-42-2, n = 5; ATX-350-2, AMMO1, uninfected control, and isotype control, n = 4; 72A1, n = 3).

(D) Viral IR1 DNA copies were quantified in splenic DNA extracts from the mice in (B).

(E) Levels of the indicated mAbs were measured in sera of experiment 2 mice at the time of challenge using antigen-specific ELISA (ATX-42-2 and ATX-350-2, n = 5; AMMO1 and isotype control, n = 4).

(F and G) Spleen weights (F) and viral IR1 DNA copies in splenic DNA extracts (G) from the mice with detectable serum mAbs in (E) were measured at the time of euthanasia (ATX-350-2, n = 5; ATX42-2, AMMO1, and isotype control, n = 4).

(H) Levels of the indicated mAbs in sera of experiment 3 mice were measured at the time of challenge (n = 4 per group).

(I and J) Spleen weights (I) and viral IR1 DNA copies in splenic DNA extracts (J) from the mice in (H). Asterisks denote a statistically significant difference between the two groups determined using a Mann-Whitney test where ∗∗∗ p < 0.0005.

Each symbol represents the average of two technical replicates per individual mouse, bars represent the mean, and the dashed line represents the highest serum dilution tested in (B, E, and H). Serum samples without detectable mAb were plotted at half the highest serum dilution tested. Each symbol represents an individual mouse, and bars represent the mean in (C, F, and I). Each symbol represents the average of two technical replicates from an individual mouse, bars represent the mean, and dashed lines represent the limit of detection in (D, G, and J). In (D and G), asterisks denote a statistically significant difference between the two groups determined using a Kruskal-Wallis test with Dunn’s multiple comparisons where ∗∗p < 0.005, ∗∗∗p < 0.0005, and ∗∗∗∗p ≤ 0.0001. Only groups with a significant difference are shown.

Two of four challenged mice that received the isotype control mAb had consistently detectable viremia beginning at 4–5 weeks post-challenge (Figure S10B) and all had splenomegaly (Figure 6C) and viral DNA in splenocytes (Figure 6D). EBER transcripts were also detected in splenic sections from a mouse in the isotype control group (Figure 7, mouse 1). Despite all being infected, two of four mice in the isotype control group survived for 74 days following challenge (Figure S10A; Table S4). One of four spleens in the isotype control had an obvious tumor group (Figure S12, mouse 3).

Figure 7.

Figure 7

Immunohistochemical analyses of the spleens from EBV-challenged humanized mice

Splenic sections from representative mice from experiment 1 (Figure 6) were stained for hematoxylin and eosin (H&E), human CD20, and EBER1 transcripts at necropsy as indicated. Scale bars represent 100 μm. Each image is from one representative mouse per group.

Two of four mice that received AMMO1 did not survive until day 74 (Figure S10A; Table S4) and one exceeded 20% weight loss on day 74 (Figure S10C). A similar pattern of weight loss and survival was observed in the uninfected control group, indicating that survival in this experimental cohort was independent of EBV infection and likely due to the age of the mice at the time of challenge. None of animals in the AMMO1 group had splenomegaly (Figure 6C), viremia (Figure S10B), detectable viral DNA from splenocytes (Figure 6D), or detectable EBER1 RNA (Figure 7) in the spleen.

ATX-42-2 protected five of five mice from splenomegaly (Figure 6C). All mice survived for 74 days after challenge (Figure S10A; Table S4); however, one mouse reached euthanasia criteria at this point (Figure S10A; Table S4). One mouse exhibited transient viremia at week 8 (Figure S10B). Splenocytes from all mice in the ATX-42-2 group lacked detectable viral DNA (Figure 6D), and EBER transcripts were not observed in a representative mouse from this group (Figure 7).

Two of four mice that received ATX-350-2 survived until day 74 (Figure S10A; Table S4), and all had normal spleen weights (Figure 6C) at the time of euthanasia. Although none of the mice in the ATX-350-2 group had viremia (Figure S10B), viral DNA was detected in the spleen from two of four mice in this group (Figure 6D). A mouse in the ATX-350-2 group with high viral loads in the spleen (mouse 4) had detectable EBER RNA (Figure 7), while one absent of viral load (mouse 2) did not (Figure S13). Two of three mice that received 72A1 had splenomegaly (Figure 6C, mouse 3 and 4), of which one (mouse 4) had high levels of viral DNA (Figure 6D) and EBER transcripts (Figure 7) in the spleen, and a large tumor (Figure S12). Mouse 3 did not have a visible splenic tumor (Figure S12) or detectable viral DNA in the spleen (Figure 6D); however, in situ hybridization detected EBER1 RNA (Figure S13).

To confirm these results, we transferred ATX-42-2 (n = 5), ATX-350-2 (n = 5), AMMO1 (n = 4), and the isotype control mAb (n = 4) to a separate group of NBSGW mice engrafted with huCD34+ cells isolated from cord blood (Figures S9D and S9E). We were unable to detect transferred mAb in mouse 2 from the ATX-42-2 group (Figure 6E), and it was excluded from the study. In the remaining animals, we again observed higher levels of AMMO1 and ATX-42-2, relative to the other mAbs in the serum at the time of challenge (Figure 6E). One mouse from the ATX-42-2 group (mouse 3) and one from the ATX-350-2 group (mouse 3) required euthanasia 15 days post-challenge (Figure S10D; Table S4). Two additional mice from the ATX-350-2 group died at days 48 (mouse 1) and 65 (mouse 5) (Figure S10D; Table S4). Mouse 4 from the isotype control group died at day 68 (Figure S10D; Table S4). The remaining mice were euthanized at day 83. At the time of euthanasia, spleen weights were comparable in all mice, except for one (mouse 4) in the ATX-42-2 group (Figure 6F). However, EBV DNA was not detected in the spleens of any mice from the ATX-42-2 group (Figure 6G). In contrast, EBV DNA was present in the spleens from two of five (mice 1 and 2) and three of four (all but mouse 2) mice in the ATX-350-2 and isotype control groups, respectively (Figure 6G).

In the second experiment, we sought to assess whether the mAbs have different pharmacokinetic profiles. Therefore, we measured the mAb levels in sera over a 3-week period. One day post-mAb transfer, serum levels were higher for ATX-42-2 and AMMO1 than they were for ATX-350-2 and 72A1 (Figures 6E and S11A). ATX-350-2 and 72A1 decayed faster than ATX-42-2 and AMMO1 over the first 2 weeks such that only ATX-42-2 and AMMO1 were present above ∼0.1 μg/mL in sera at this time point. By week 3, only AMMO1 was present at levels above 0.1 μg/mL. To confirm these results, the same experiment was repeated in NSG mice, and comparable results were observed (Figures S11B and S11C). Thus, the favorable pharmacokinetic profiles of AMMO1 and ATX42-2 may have contributed to the superior protection conferred by these two mAbs over ATX-350-2 and 72A1 (Figures 6C, 6D, 6F, and 6G).

Given the favorable kinetic profile of ATX-42-2, we carried out an additional repeat experiment where ATX-42-2 (n = 4) or the isotype control (n = 4) was administered to another cohort of huCD34+-engrafted NSG mice (Figures S9F and S9G) and then challenged with EBV. Mice 1 and 2 from the ATX-42-2 group required euthanasia at days 88 and 82 post-challenge, respectively (Figure S10E; Table S4). The remaining mice were euthanized 95 days post-challenge. At the time of euthanasia, mice in the isotype control group had larger spleens than mice in the ATX-42-2 group (Figure 6I). Three of four mice in the isotype control group had detectable viral DNA in the spleen, while none in the ATX-42-2 group did (Figure 6J).

Discussion

Passive transfer of neutralizing antibodies has been demonstrated to be a safe and effective means of treatment for infectious diseases. In the context of EBV, passive transfer of neutralizing antibodies may be effective in vulnerable patient populations—in particular, organ transplant patients at high risk of PTLD. Proof of concept for antibody-mediated prophylaxis has been demonstrated in animal infection models; yet, the only study in humans to date evaluated 72A1, a murine antibody against gp350, which may have showed some efficacy but elicited anti-drug antibodies and led to adverse events.48 Here, we leveraged a transgenic mouse model capable of eliciting antibodies with genetically human variable regions to identify gp350 and gp42 mAbs.

The two gp350 mAbs described here neutralized EBV infection of B cells and CD21+ epithelial cells with differing potency. Like all other gp350-neutralizing mAbs, of murine or human origin, they block the interaction between gp350 and CD21.58,60 We propose that the differences in affinity of the two mAbs for gp350 and the position of the epitopes relative to the CD21-binding site on gp350 account for the differences in neutralizing potency. The ATX-350-2 mAb exhibited comparable neutralizing potency to 72A1 and would be appropriate for a follow-on study to Haque et al.48

Of 63 hybridoma cultures that showed gp350 binding activity, we identified two mAbs that were neutralizing. This suggests that the majority of gp350 mAbs elicited by immunization in ATX-GK mice were non-neutralizing. However, we acknowledge that our neutralization screen may have missed neutralizing antibodies if they were present at low levels in the culture supernatants. The finding that neutralizing antibodies are the minority is consistent with another study that found only 4 of 23 gp350 mAbs isolated from wild-type mice immunized with the gp350 ectodomain were neutralizing.58 Similarly, most hybridoma cultures with gp42 binding activity were non-neutralizing. These findings suggest that most antibodies directed at gp350 and gp42 in the context of immunization are non-neutralizing. Therefore, neutralizing potency might be improved through epitope-focused vaccine design,76 multimeric display,71,77,78 next-generation vaccine platforms,72 or combinations thereof.

gp42 mAbs have been isolated from immunized mice, non-human primates, rabbits, and human-derived phage display libraries.33,34,53,68,69 To date, the most potent mAb is A10, which was isolated from a non-human primate that binds the HLA class II-binding site. The only other human mAbs against gp42 bind to the hydrophobic patch or an epitope opposite the hydrophobic patch.33 The ATX-42 mAbs identified here are distinct from known gp42 mAbs in that they are genetically human and map to the HLA-DR-binding site. They may, therefore, have utility in a prophylactic or therapeutic setting without any need for humanization. In support of this notion, EBV was undetectable in splenocyte extracts from 13 of 13 mice who received prophylactic treatment with ATX-42-2; in contrast, EBV was present in the spleens of 10 of 12 mice that received isotype control across three independent experiments, demonstrating protection against challenge in humanized mice.

In contrast to ATX-42-2 and the gH/gL mAb AMMO1, we observed partial protection with the gp350 mAbs ATX-350-2 and 72A1. This may be related to the fact that gp350 is not essential for EBV infection of B cells,79 while gp42 and gH/gL are. However, we note that it is difficult to draw definitive conclusions about the protective efficacy of the 72A1 and ATX-350-2 mAbs due to small numbers of animals in the groups, the lower average levels of these two mAbs relative to AMMO1 and ATX-42-2 at the time of challenge, and potential differences in pharmacokinetics. These data are consistent with a lack of protection afforded by 72A1 in one study,54 but contrast with the results of another.48

Based on previous protection we observed with a single infusion of mAb or polyclonal sera in this challenge model,54,71,72 we only provided a single infusion of mAb prior to challenge here. Given that 72A1 and ATX-350-2 showed more rapid decay, it is possible that protection could be improved with additional infusions. An extensive determination of the pharmacokinetic parameters of each mAb combined with antibody engineering to improve half-life would inform an extended dosing regimen for clinical use. It is, nevertheless, encouraging that most animals treated with EBV-neutralizing Abs showed reduced viral loads in spleens, suggesting that prophylactic mAb treatment could lower viral load in transplant patients where high viral loads are a strong indicator of PTLD.

A key limitation of the animal model used here is that only human-origin lymphocytes are susceptible to infection80,81; therefore, we were unable to assess the ability of the ATX-42 and ATX-350 mAbs to prevent infection of epithelial cells in vivo. In vitro, the ATX-350 mAbs and 72A1 could neutralize EBV infection of CD21+ but not CD21 epithelial cells. It is unclear whether CD21 is a relevant receptor on oral epithelial cells. CD21 mRNA has been detected in tonsil epithelium, but not in epithelial cells from the buccal mucosa, uvula, soft palate, or tongue.82 However, primary polarized cells and primary organotypic cultures derived from primary gingiva and tonsil organotypic cultures that are permissive to EBV infection lack detectable CD21 protein.83,84 Unlike gp350 mAbs, the ATX-42 mAbs do not neutralize infection of CD21+ cells. Interestingly, HLA-DR expression has been observed in nasopharyngeal atypical dysplasia and nasopharyngeal carcinoma (NPC) tumor samples.85,86 Additionally, it has been suggested that increased gp42 antibody levels have an inverse association with the risk of NPC.86 Thus, it remains to be determined whether gp350 or gp42 mAbs would inhibit infection of human epithelial cells in a prophylactic or therapeutic setting. Dual-tropic neutralizing antibodies that interfere directly with the fusion machinery (i.e., gH/gL and gB) may be more effective in this regard.51,52,54 Alternatively, evaluating whether combinations of neutralizing mAbs targeting different epitopes or antigens show additive or synergistic activity in vitro and in vivo may overcome potential limitations of mAb monotherapy and compensate for strain diversity and/or selection of escape mutants.

Given the current lack of specific treatment and high mortality rate of PTLD, EBV-neutralizing mAbs described here and elsewhere have the potential to fulfill an unmet need. Ultimately, the ability of mAbs to protect against EBV-driven disease such as PTLD needs to be tested in clinical trials in humans to evaluate efficacy. Genetically human mAbs, such as the ones described herein, will enable these types of studies and potentially avoid adverse events previously observed with the passive transfer of murine mAbs.

Limitations of the study

Murine epithelial cells are not susceptible to infection in humanized mice. However, B cells and epithelial cells are susceptible to EBV infection, and thus antibodies that can neutralize infection of both types of cells are an important consideration for therapeutic approaches. Here, we delivered virus intravenously in humanized mice following prophylactic antibody treatment. The kinetics of viral replication and viral gene and protein expression may, therefore, differ in the context of iatrogenic EBV reactivation during immune suppression or acquisition of virus during organ transplant arising from a seropositive donor and a seronegative recipient. Addressing these limitations would ideally be addressed in human clinical trials.

Resource availability

Lead contact

Requests for resources and reagents should be directed to and will be fulfilled by Andrew T. McGuire (amcguire@fredhutch.org).

Materials availability

All materials generated herein are available upon request under a materials transfer agreement from the Fred Hutchinson Cancer Center (mta@fredhutch.org). The pTT3 vectors are used under license from the National Research Council of Canada.

Data and code availability

This paper does not report original code. X-ray coordinates and structure factors are deposited in the RCSB PDB under accession code PDB: 9PF9. Negative-staining EM maps are deposited in the EMDB with accession codes EMBD: EMD-71585 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-1.1 open conformation), EMBD: EMD-71586 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-2 Open conformation), EMBD: EMD-71587 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-1.1 partially open conformation), EMBD: EMD-71588 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-2 closed conformation), EMBD: EMD-71589 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and HLA-DR1 Beta chain), EMBD: EMD-71590 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-1 Fab and 72A1 Fab), EMBD: EMD-71592 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-2 Fab), EMBD: EMD-71593 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-1 Fab), and EMBD: EMD-71594 (Negative stain EM map of EBV glycoprotein gp350 in complex with 72A1 Fab). The ATX-350 VH and VL sequences have been deposited in GenBank: PV837517, PV837527, PV837518 and PV837528. The ATX-42 VH and VL sequences have been deposited in GenBank: PV837519-PV837526, PV837529-PV837536. The naive ATX-GK IgM BCR raw sequences have been deposited in BioProject: PRJNA1347123Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.

Acknowledgments

This research was supported by NIAID R01AI147846 and NCI R01CA285227 (to A.T.M.), NLHBI R01HL136135 (to H.-P.K.), and NIH P30 CA015704 to the Fred Hutch/University of Washington/Seattle Children’s Cancer Consortium, which includes the Flow Cytometry Shared Resource, RRID:SCR_022613; the Antibody Technology Shared Resource, RRID:SCR_022608; the Comparative Medicine Shared Resource, RRID:SCR_022610; the Electron Microscopy Shared Resource, RRID:SCR_022611; the Cellular Imaging Shared Resource, RRID:SCR_022609; the Immune Monitoring Shared Resource, RRID:SCR_022615; the Genomics and Bioinformatics Shared Resource, RRID:SCR_022606; and the Experimental Histopathology Shared Resource, RRID:SCR_022612. A portion of this research was supported by the NIH S10 instrumentation grant 1S10OD028581-01. X-ray diffraction data were collected at the Berkeley Center for Structural Biology. The Berkeley Center for Structural Biology is supported by the Howard Hughes Medical Institute, Participating Research Team members, and the National Institutes of Health, National Institute of General Medical Sciences, ALS-ENABLE grant P30 GM124169. The Advanced Light Source is a Department of Energy Office of Science User Facility under contract no. DE-AC02-05CH11231. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The Experimental Histopathology Shared Resource equipment is supported by a grant from the M.J. Murdock Charitable Trust grant SR-202221337. This work was also supported by the Evergreen Fund from The Fred Hutchinson Cancer Center. Further funding has been received from the José Carreras/E. Donnall Thomas Endowed Chair for Cancer Research, and the Stephanus Family Endowed Chair for Cell and Gene Therapy, as Markey Molecular Medicine Investigator. We thank the J. B. Pendleton Charitable Trust for its generous support of Formulatrix robotic instruments. We thank Masaru Kanekiyo for the kind gift of the 769A9 and 770E11 mAbs.

Author contributions

Conceptualization, A.T.M. and C.B.C.; investigation, C.B.C., K.L., A.R.D., Y.-H.W., N.T.A., G.K., S.C.S., S.R.H., K.R.E., N.V.G., and S.R.; formal analysis, C.B.C., K.L., A.R.D., Y.-H.W., N.T.A., G.K., S.C.S., S.R.H., K.R.E., M.P., A.T.M., and S.R.; visualization, C.B.C., K.L., G.K., A.R.D., and R.I.; resources, M.P., H.-P.K., S.R., and A.T.M.; writing – original draft, A.T.M. and C.B.C. review and editing, all; funding acquisition, A.T.M., M.P., and H.-P.K.

Declaration of interests

A.T.M. and C.B.C. are listed as inventors on a patent application (63/771,474) related to the mAbs described herein.

Declaration of generative AI and AI-assisted technologies in the writing process

During the preparation of this work the authors used Microsoft Copilot to generate suggested titles for the manuscript. After using this tool/service, the authors reviewed and edited the content as needed and takes full responsibility for the content of the publication.

STAR★Methods

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Recombinant AMMO1 Snijder et al.59 N/A
Recombinant 72A1 with human constant regions Singh et al.54 N/A
Recombinant 769A9 Joyce et al.60 N/A
Recombinant 770E11 Joyce et al.60 N/A
F-2-1 Li et al.68 N/A
Recombinant A10 with human constant regions Bu et al.34 N/A
Recombinant 4C12 with human constant regions Bu et al.34 N/A
Recombinant VRC01 Wu et al.74 N/A
Cy137C02 Joyce et al.60 N/A
Cy651H02 Joyce et al.60 N/A
5E3 Hong et al.53 N/A
3E8 Hong et al.53 N/A
2C1 Hong et al.53 N/A
AF700 anti-human CD4 clone OKT4 eBioscience Cat #56-0048-82; RRID:AB_657741
BV421 anti-human CD8 clone RPA-T8 BD Biosciences Cat# 562429; RRID:AB_11154035
FITC anti-human CD45 clone 2D1 eBioscience Cat#11-9459-42; RRID:AB_1907394
PE anti-human CD33 clone WM53 BD Biosciences Cat# #555450; RRID: AB_395843
BV711 anti-human CD19 clone HIB19 Biolegend Cat#302246; RRID: AB_2562065
BV786 anti-human CD20 clone 2H7 BD Biosciences Cat#568713; RRID: AB_3684489
APC anti-mouse CD45 clone 30-F11 eBioscience Cat#17-0451-82; RRID:AB_469392
Mouse polyclonal anti-CD20cy clone L26 Dako Cat# M0755,; RRID:AB_2282030
Goat anti-human IgG-HRP Jackson ImmunoResearch Cat#109-035-088
Goat anti-human IgG Southern Biotech Cat. #2040-01

Bacterial and virus strains

EBV M81-Luc Bilger et al.65 N/A
EBV B95.8/F Delecluse et al.87 N/A
DH5Alpha cells New England Biolabs Cat#C2987H

Biological samples

PMBC from HIV-uninfected donors (Establishing Immunologic Assays for Determining HIV-1 Prevention and Control) This paper N/A
Human CD34-enriched PBSCs Fred Hutch Co-operative Center for Excellence in Hematology N/A
Human umbilical cord blood Bloodworks Northwest N/A

Chemicals, peptides, and recombinant proteins

Adjuplex Vaccine Adjuvant Empirion N/A
SureBlue Reserve TMB Microwell Peroxidase substrate SeraCare Cat#5120-0081
PEI MAX Polysciences Cat#24765
Phycoerythrin (PE)- streptavidin Agilent Cat#PJRS301-1
Allophycocyanin (APC)- streptavidin Agilent Cat#PJ27S-1
D-biotin Invitrogen Cat#B20656
eFluor 506 viability dye eBioscience Cat#65-0866-14
Anti-human IgG Fc capture (AHC) biosensors Sartorius Cat#18-5063
Streptavidin biosensors Sartorius Cat#:18-5020
Protein A Resin GoldBio Cat#P-400
Ni-NTA resin GoldBio Cat#H-350-100
Pierce IgG Elution Buffer Thermofisher Cat#21009
Dialysis cassettes Thermofisher Cat#66030
LysC enzyme NEB Cat#P8109S
0.25% trypsin ThermoFisher Cat#25200056
10% Formalin Millipore Sigma Cat#HT501128
EZ-Link NHS-PEG4-Biotin Kit ThermoFisher Cat#21330
BirA biotin-protein ligase standard reaction kit Avidity LLC Cat#BirA500
PowerVision Anti-Mouse Polymer HRP Leica Cat#PV6114
Bond Dewax Solution Leica Cat#AR9222
Bond Epitope Retrieval Solution 2 Leica Cat#AR9640
RNAscope 2.5 LS Positive Control Probe Human PPIB ADC BioTechne Cat#313908
Negative Control probe dapB ADC BioTechne Cat#312038
EBV RNAscope 2.5 LS Probe-V-EBER1 probe ACD BioTechne Cat#310278
HLA-DRβ1∗0101 monomer loaded with CLIP peptide Fred Hutch Immune Monitoring Core N/A
Recombinant CD21 SinoBiological Cat#10811-H08H
Recombinant CD35 ADC BioTechne Cat#6748-CD
GeneJuice Tranfection Reagent SigmaAldrich Cat# 70967
Endoglycosidase H New England Biolabs Cat#P0702S
Formvar, stabilized with Carbon-coated 400-mesh copper grids Ted Pella Cat#01754-F
Uranyl Formate Electron Microscopy Sciences Cat#22450
MCSG Crystallization Suite Anatrace Cat#MCSG-3
Zeba Spin Desalting Columns 40K MWCO ThermoFisher Cat#87766

Critical commercial assays

QuantiTect Multiplex PCR Kit Qiagen Cat#204543
TOPO cloning kit ThermoFisher Cat#450245
Steady-Glo luciferase reagent Promega Cat#PRE2520
DNeasy Blood & Tissue Kit Qiagen Cat#69504
TaqMan VIC-labeled RNase-P primer probe mix Fisher Scientific Cat#4316844
Mouse B cell enrichment kit StemCell Cat#19854
Human B cell enrichment kit StemCell Cat#19054
BOND Polymer Refine Detection Kit Leica Cat#DS9800
RNAscope 2.5 LS Reagent Kit – BROWN ADC BioTechne Cat#322100
Human CD34 MicroBead Kit UltraPure Cell Sorting kit Miltenyi Biotech Cat#130-100-453
Chromium Next GEM Single Cell 5′ Kit v2 10x Genomics Cat#PN-1000265

Deposited data

ATX-350 VH and VL sequences This paper GenBank: PV837517, PV837527, PV837518, PV837528
ATX-42 VH and VL sequences This paper GenBank: PV837519-PV837526, PV837529-PV837536
ATX-350-2/gp350 crystal structure This paper PDB: 9PF9
Naive ATX-GK IgM BCR raw sequences This paper BioProject ID: PRJNA1347123
Negative-staining EM map of gH/gL/gp42/ATX-42-1.1 Fab open conformation This paper EMD-71585
Negative-staining EM map of gH/gL/gp42/ATX-42-2 Fab open conformation This paper EMD-71586
Negative-staining EM map of gH/gL/gp42/ATX-42-1.1 Fab partially open conformation This paper EMD-71587
Negative-staining EM map of gH/gL/gp42/ATX-42-2 Fab closed conformation This paper EMD-71588
Negative-staining EM map of gH/gL/gp42/HLA-DR1 beta chain This paper EMD-71589
Negative-staining EM map of gp350/ATX-350-1 Fab/72A1 Fab This paper EMD-71590
Negative-staining EM map of gp350/ATX-350-2 Fab This paper EMD-71592
Negative-staining EM map of gp350/ATX-350-1 Fab This paper EMD-71593
Negative-staining EM map of gp350/72A1 Fab This paper EMD-71594

Experimental models: Cell lines

Raji ATCC RRID:CVCL_0511
HEK293-EBNA1-6E cells National Research Council, Canada RRID:CVCL_HF20
HEK293S GnTI−/− cells ATCC RRID:CVCL_A785
293–2089 Delecluse et al.87 N/A
SVKCR2 Li et al.68 RRID: CVCL_YD67
AGS cells ATCC RRID:CVCL_0139
293-M81-B1129 cells Bilger et al.65 N/A
AKATA-GFP Molesworth et al.88 N/A

Experimental models: Organisms/strains

NSG (NOD-scid Il2rgnull) mice Fred Hutch Comparative Medicine Core N/A
NBSGW (NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ; strain 026622) mice The Jackson Laboratory 026622
ATX-GK-CROSS mice Alloy Therapeutics N/A

Oligonucleotides

ATX-GK mice Universal Forward Primer
GATCTACACTCTTTCCCTACACGACGC
Alloy Therapeutics N/A
ATX-GK mice IgM First Round Reverse Primer
CACCAAATTCTCATCAGACAGGG
Alloy Therapeutics N/A
ATX-GK mice IgM Second Round Reverse Primer
GAAGACAGTTGGGGAGGACTG
Alloy Therapeutics N/A
ATX-GK mice IgK Second Round Reverse Primer
CAGTTGGTGCAGCATCAGCCC
Alloy Therapeutics N/A
ATX-GK mice IgK Second Round Reverse Primer
AGGCACCTCCAGTTGCTAAC
Alloy Therapeutics N/A
Forward primer specific for EBV BALF5 gene: CCCTGTTTATCCGATGGAATG Kimura et al.89 N/A
Reverse primer specific for EBV BALF5 gene: CGGAAGCCCTCTGGACTTC Kimura et al.89 N/A
FAM-labeled probe specific for EBV BALF5 gene: CGCATTTCTCGTGCGTGTACACC Kimura et al.89 N/A
Forward primer specific for EBV IR1 gene: GGCCAGAGGTAAGTGGACTTTAAT Palser et al.90 N/A
Reverse primer specific for EBV IR1 gene: GGGGACCCTGAGACGGG Palser et al.90 N/A
FAM-labeled probe specific for EBV IR1gene:
CCCAACACTCCACCACACCCAGGC
Palser et al.90 N/A

Recombinant DNA

p2670 Delecluse et al.87 N/A
p509 Neuhierl et al.91 N/A
pTT3-gp350-HIS-AVI Snijder et al.59 N/A
pTT3-gp42-HIS-AVI Snijder et al.59 N/A
pTT3-gH-HIS-AVI Snijder et al.59 N/A
pTT3-gL Snijder et al.59 N/A
pTT3-gp350 (AA 1–470) Snijder et al.59 N/A
VRC01 Heavy chain expression vector BEI Resources Cat# ARP-12035
VRC01 Light chain expression vector BEI Resources Cat# ARP12036
Double stranded BALF5 Target DNA for standard: ACCGAGACCCGGCAGGGGGT
CCTGCGGTCGAAGGTGCTGGCCTTGAG
GGCGCTGAGGACTGCAAACTCCACGTC
CAGACCCTGAGGCGCGCTGGCGTAGA
AGTAGGCCTGCTGCCCAAACACGTTCA
CACACACGCTGGCCCCATCGGCCTTG
CGCCGGCCCAGTAGCTTGATGACGAT
GCCACATGGCACCACATACCCCTGTTT
ATCCGATGGAATGACGGCGCATTTCTC
GTGCGTGTACACCGTCTCGAGTATGTC
GTAGACATGGAAGTCCAGAGGGCTTCC
GTGGGTGTCTGCCTCCGGCCTTGCCGT
GCCCTCTTGGGCACGCTGGCGCCACCA
CATGCCCTTTCCATCCTCGTCACCCCCC
ACCACCGTCAGGGAGTCTTGGTAGAAG
CACAGGGGGGGCTGAGGCCCCCGCAC
ATCCACCACCCCTGCGGCGCCTGGTGT
CTGG
AAACACTTGGGAATGAGACGCAGGTAC
TCCTTGTCAGGCTTTTTC
Singh et al.54 N/A
Double stranded IR1 Target DNA for standard:
GCCCGGGCCCCCCGGTATCGGGCCAG
AGGTAAGTGGACTTTAATTTTTTCTGCTA
AGCCCAACACTCCACCACACCCAGGCA
CACACTACACACACCCACCCGTCTCAG
GGTCCCCTCGGACAGCTCCTAAGAAGG
This paper N/A

Software and algorithms

Prism 7.03 or later software package Graph Pad Software N/A
FlowJo v10.9.0 Software BD Life Sciences N/A
Live Cell Analysis Software Sartorius N/A
CellRanger 10x Genomics N/A
Enclone 10x Genomics N/A
Leginon Suloway et al.92 N/A
CryoSPARC Punjani et al.93 N/A
UCSF ChimeraX Meng et al.94 N/A
Alphafold3 Abramson et al.95 N/A
XDS Kabsch et al.96 N/A
CCP4 suite Agirre et al.97 N/A
Coot Emsley et al.98 N/A
Phenix Liebschner et al.99 N/A
PDBePISA Krissinel et al.100 N/A
Octet BLI Analysis 12.2 software Sartorius N/A

Other

Octet Red 96E Sartorius N/A
iQue Sartorius N/A
ClonePix Molecular Devices N/A
MiSeq Illumina N/A
QuantStudio 7 Flex Real-Time PCR System Applied Biosystems N/A
Glomax Navigator Microplate Luminometer Promega N/A
Superdex 200 10/300 column Cytiva Cat#45-002-490
HiLoad 16/600 Superdex 200 pg column Cytiva Cat#28989335
Enrich 650 column BioRad Cat#7801650
0.22μm fiiters Corning Cat#431097
30kDa centrifugal filters Millipore Cat#UFC9030
Incucyte S2 Live-Cell Analysis Instrument Sartorius N/A
BD FACSCelesta BD Biosciences N/A
Talos L120C ThermoFisher N/A
PELCO easiGlow Ted Pella N/A
NT8 drop setter Formulatrix N/A
Advanced Light Source beamline 5.0.2 Department of Energy, Lawrence Berkeley National Laboratory N/A
SpectraMax M2 plate reader Molecular Devices N/A

Experimental model and study participant details

Human subjects

PBMC were collected from adults without HIV who were recruited at the Seattle HIV Vaccine Trials Unit (Seattle, Washington, USA) as part of the study “Establishing Immunologic Assays for Determining HIV-1 Prevention and Control”, also referred to as Seattle Assay Control (SAC) Cohort. All participants signed informed consent, and the Fred Hutchinson Cancer Center (Seattle, Washington, USA) Institutional Review Board approved the SAC protocol (FHIRB0005567) prior to study initiation. PBMC collected from one female donor were selected at random for B cell surface staining with gp42 and gp350. No considerations were made for age or sex. De-identified human umbilical cord blood (UCB) was obtained from Bloodworks Northwest after consent was obtained. huCD34+ cells purified from UCB were pooled from 3 male and 3 female donors and engrafted into a mix of male and female NBSGW mice (see below for details). All UCB work was approved under Fred Hutch’s Institutional Review Board Protocol (FHIRB0020199).

CD34-enriched peripheral blood stem cells mobilized by granulocyte colony-stimulating factor were obtained from two male and one female, de-identified adult donors were purchased from the Co-operative Center for Excellence in Hematology, Fred Hutchinson Cancer Center and engrafted into NSG mice (see below for details). Donors were selected at random and no considerations were made for age or sex.

Cell lines

HEK293-EBNA1-6E (Female) (RRID:CVCL_HF20) and HEK293S (Female) GnTI−/− (RRID:CVCL_A785) cells were cultured in Freestyle 293 expression medium (Thermo Fisher Scientific) and maintained at 37°C and 5% CO2 with gentle shaking at 130 rpm.

Raji cells (Male) (CVCL_0511) were cultured in RPMI-1640 (Corning) supplemented with 25 mM L-glutamine, 10% heat-inactivated fetal bovine serum, 200 U/mL Penicillin-Streptomycin (cRMPI), and maintained at 37°C and 5% CO2.

SVKCR2 cells (Male) (RRID:CVCL_YD67) were cultured in DMEM (Corning) supplemented with 25 mM L-glutamine, 10% heat-inactivated fetal bovine serum, 200 U/mL Penicillin-Streptomycin, 10 ng/mL cholera toxin, 400 μg/mL G418,88 and maintained at 37°C and 5% CO2.

AGS cells (Female) (RRID:CVCL_0139) were cultured in Ham’s F-21 medium (Thermo Fisher) supplemented with 10% heat-inactivated fetal bovine serum, 200 U/mL Penicillin-Streptomycin and maintained at 37°C and 5% CO2.

293–2089 cells (Female) were cultured in cRPMI containing 100 μg/mL hygromycin.

293 cells harboring a bacterial artificial chromosome encoding the M81 strain with GFP and luciferase reporter genes were cultured in cRPMI containing 100 μg/mL hygromycin.63,65

AKATA B cells harboring EBV in which the thymidine kinase gene has been replaced with a neomycin and GFP cassette virus (AKATA-GFP) were grown in cRPMI containing 350 μg/mL G418.88

None of the cell lines were authenticated or tested for mycoplasma contamination.

Mice

ATX-GK Mice were purchased from Alloy Therapeutics61 and shipped from Charles River Laboratories (Wilmington, MA). Hu-CD34+-engrafted NSG mice were engrafted at the Fred Hutchinson Cancer Center Comparative Medicine Facility. Mice were engrafted with Hu-CD34+ cells at 6 weeks of age. All recipient mice were female which may have affected the study outcome. Details can be found below under “EBV Challenge in NSG Humanized Mice.”

NBSGW (NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ; strain 026622)101 breeding pairs were purchased from Jackson Labs and bred in house. Male and Female NBSGW neonates were engrafted with Hu-CD34+ cells at 1–3 days of age. Details can be found below under “Xenotransplantation and EBV challenge in NBSGW mice”.

All mice used in our studies were housed with free access to food and water with a 12:12 light:dark cycle. The animal facilities are accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. Mice were handled in accordance with the NIH Guide for the Care and Use of Laboratory Animals, and experiments were approved by the Fred Hutch Cancer Center Institutional Animal Care and Use Committee and Institutional Review Boards (Protocols 000051095, 202000018 and 202000029). Immunizations and retro-orbital bleeds were carried out under anesthesia, which was induced by administering isoflurane, set at 1–5% for 1–2 min in an induction chamber with the flow rate of O2 set at 1.0 L/min. Animals under anesthesia were then transferred to a nose cone and continued to receive 1–5% isoflurane at an O2 set to 1.0 L/min during injections and retro-orbital bleeds. Mice were euthanized by administering 100% CO2 in an induction chamber with a flow rate of 3.0 L/min to allow for 50% of the air in the chamber to be replaced per minute for at least 5 min, followed by cervical dislocation.

Method details

BCR analysis of naive ATX-GK mice

B cells were enriched from splenocytes of two ATX-GK mice independently (StemCell Technologies). Paired BCR sequencing of B cells was performed using the Chromium Next GEM Single Cell 5′ Kit v2 (10x Genomics). For each mouse, 16500 B cells were inputted to generate gel bead-in-emulsions (GEMs). Custom primers for IgM and IgK chains were utilized to amplify VH and VL sequences following manufacturer’s instructions. Library sequencing was performed on a Miseq (Illumina) by the Fred Hutch Cancer Center Genomics and Bioinformatics Core Facility (RRID:SCR_022606) resulting in a depth of 5000 reads per cell. The BCR libraries were then mapped to a human VDJ reference using Cell Ranger (10x Genomics). Each paired BCR’s V, D, and J genes for both heavy chain and light chains were determined utilizing Enclone (10x Genomics). Raw sequence data can be found in NCBI Sequence Read Archive under BioProject ID: PRJNA1347123.

Plasmids

Codon-optimized plasmids of neutralizing antibodies were ordered from BioIntron Biological Inc (Metuchen, New Jersey). Plasmids were transformed into DH5Alpha cells (New England Biolabs) and plated on agar plates containing ampicillin and grown overnight at 37°C. Colonies were used to seed 4 mL LB broth cultures containing ampicillin. Glycerol stocks of 500 μL of the overnight culture to 500 μL of 50% glycerol were stored at −80°C.

Recombinant protein expression

Plasmids encoding EBV proteins,59 pTT3-gp350-HIS-AVI, pTT3-gp42-HIS-AVI, pTT3-gH-HIS-AVI, pTT3-gL as well as a pTT3-gp350 (AA 1–470) construct without any tags for structural studies, were transfected into either HEK293-EBNA1-6E or HEK293S GnTI−/− cells using PEI MAX (Polysciences) at a 3:1 mass ratio in 1X PBS, incubated for 20 min at room temperature before dropwise addition to cells cultured at 1x106 cells/mL in Freestyle media. The transfected cultures were incubated at 37°C shaking at 130 rpm with 5% CO2 for six days. On day six, the culture was centrifuged at 4000 X g for 10 min at 4°C. The supernatant was collected and adjusted to 500 mM NaCl, 10 mM Imidazole, 0.02% Azide and then clarified through a 0.22 μm filter (Corning). The clarified supernatant was then passed over Ni-NTA resin (Gold Biotechnology) pre-equilibrated with Ni-NTA binding buffer (500 mM NaCl, 10 mM Tris, 10 mM imidazole, 0.02% Azide, pH 7.1), followed by extensive washing with Ni-NTA binding buffer, and then eluted with Ni-NTA elution buffer (10 mM Tris, 500 mM NaCl, 500 mM imidazole, 0.02% Azide, pH 8.0), or purified using Galanthus Nivalis Lectin (GNL) agarose resin (Vector Laboratories) equilibrated with GNA-A buffer (20 mM Tris, 100 mM NaCl, 1 mM EDTA, pH 7.4), the collected supernatant was adjusted with GNA-A buffer, followed by extensive washing with GNA-A buffer, and eluted with GNA-B buffer (20 mM Tris, 100 mM NaCl, 1 mM EDTA, 1 M Methyl-α-D-Mannopyranoside, pH 7.4). Ni-NTA and GNL captured proteins were concentrated using 30 kDa centrifugal filter (Millipore) and purified by size exclusion chromatography (SEC) using a HiLoad 16/600 Superdex 200 pg column (Cytiva Lifesciences) preequilibrated in 1X PBS or 1X HEPES running buffer, respectively. gp350 was further treated with Endoglycosidase H (Endo H, New England Biolabs) at 1:50 EndoH/protein ratio for 1 h at room temperature and used directly for complex formation or stored at −80°C.

Hybridoma generation

Four ATX-GK mice were injected three times at two-week intervals with of a cocktail of 15 μg recombinant EBV gp350, 15 μg gp42, and 15 μg gH/gL with Adjuplex (Empirion LLC). 7 weeks later, a final immunization was administered 3 days prior to endpoint. Spleens were harvested and used to generate hybridomas at the Fred Hutchinson Cancer Center Antibody Technology Shared Resource, which were seeded at a density of ∼50–100/well and cultured in 384 well plates. Hybridoma supernatants were initially screened against gp350, gp42, and gH/gL, using a fluidics-based high-throughput antigen-coupled bead array on an iQue instrument (Sartorius) to identify wells containing antibodies against gp350, gp42, or gH/gL. Supernatants from positive wells were diluted 1:1 to screen for their ability to neutralize EBV infection of Raji B cells (see below for assay details). Wells containing hybridomas that displayed at least 50% neutralizing activity were sub-cloned using the ClonePix (Molecular Devices) and re-screened for binding and neutralization. Data for gH/gL mAbs will be reported in a separate manuscript in preparation.

Antibody production

To produce recombinant mAbs, RNA was extracted from 1 × 106 hybridoma cells using the Monarch Total RNA Miniprep Kit, and cDNA encoding the heavy and light chain variable regions of the murine hybridomas were by reverse transcribed and amplified using the procedures outlined in Meyer et al.102 Amplicons were Sanger sequenced directly or TOPO cloned (Thermo FisherScientific) and then sequenced. Plasmids encoding antibody heavy and light chains were co-transfected into HEK293-EBNA1-6E with PEI Max at a 3:1 ratio in PBS and incubated at 37°C, shaking at 130 rpm with 5% CO2 for six days. On day six, the cultures were centrifuged at 4000 X g. The supernatant was passed through a 0.22 μm filter (Corning), and then passed over protein A agarose resin (Gold Biotechnology) pre-equilibrated with 1X PBS followed by washing with 5 column volumes of 1X PBS and eluted using with IgG elution buffer (Pierce). Elution fractions were captured in tubes containing a 1:10 ratio of 1 M Tris pH 8.0 to elution volume. The mAbs were then dialyzed overnight (Thermo Fisher Scientific) into PBS and stored at 4°C for short-term use, or at −80°C for long term use.

Fabs were generated from full-length IgG antibodies by incubating antibodies with endoproteinase LysC (New England Biolabs) at a 10:1 ratio by mass at 37°C, rotating at 13 rpm for 16 h. The antibodies were then passed over protein A agarose resin pre-equilibrated in PBS to remove undigested full-length antibody and Fc regions. Fabs were further purified by size exclusion chromatography (SEC) using an Enrich 650 (BioRad) equilibrated into PBS to remove LysC and any remaining Fc or undigested IgG.

Biotinylation of EBV proteins

Recombinant gp42 and recombinant gp350 were biotinylated using either BirA (Avidity) or EZ-Link NHS-PEG4 biotin (Thermo Fisher Scientific) at a theoretical 1:1 biotin to protein ratio. Excess biotin was removed using Zeba spin desalting columns (Thermo Fisher Scientific). Biotinylated proteins were flash frozen and stored at −80°C until use.

Generation of gH/gL/gp42 complex

Recombinant gp42 was incubated with recombinant gH/gL at a 1.5:1 molar ratio at 4°C, with gentle rotation for 16 h. The gH/gL/gp42 complex was purified by size exclusion chromatography using a HiLoad 16/600 Superdex 200 pg column (Cytiva Lifesciences) pre-equilibrated in 1X PBS.

Fluorescently labeled streptavidin tetramer production

Biotinylated gp42 or gp350 were incubated with either streptavidin-R-phycoerythrin (SA-PE, Agilent) or streptavidin allophycocyanin (SA-APC, Agilent) at a 4:1 molar ratio. Proteins and SA conjugates were incubated in the dark at RT for 5 min followed by an addition of 25 nmol D-biotin (Invitrogen) to quench unoccupied binding sites on SA.

Measuring glycoprotein binding to Raji B cells

To measure inhibition of gp350 binding, a 2-fold dilution series of mAbs starting at 800 nM in 20 μL PBS was incubated with 20 μL of 4 nM gp350 conjugated to SA-APC at 37°C for 1 h. To measure inhibition of gp42 binding, a 2-fold dilution series of mAbs starting at 1200 nM in 20 μL PBS was incubated with 20 μL of 125 nM gp42 conjugated to SA-PE in 20 μL PBS at 37°C for 1h. Then, 50,000 Raji cells in 40 μL cRPMI were added to the antigen-mAb mixture to stain for 30 min at 4°C. Cells were washed twice with FACS buffer (1X PBS +2% FBS+ 1 mM EDTA), then fixed with 10% formalin for 15 min at RT. The percentage of tetramer-positive Raji B cells was measured on a BD FACSCelesta flow cytometer and analyzed using FlowJo software.

Measuring glycoprotein binding to primary B cells

B cells were enriched from human PBMC using EasySep Human B cell Enrichment Kit (Stemcell Technologies). To measure inhibition of gp350 binding, 20 μL of PBS containing 200 nM of each mAb was incubated with 20 μL of 4 nM gp350 conjugated to SA-APC at 37°C for 1 h. To measure inhibition of gp42 binding, 20 μL of PBS containing 400 nM of each mAb was incubated with 20 μL of 125 nM gp42 conjugated to SA-PE at 37°C for 1h 2 nM gp350 conjugated to SA-APC and 62.5 nM gp42 conjugated to SA-PE were incubated without mAb as controls. Then, 40,000 enriched B cells in 40 μL of FACS buffer were added to the antigen-mAb mixture for 30 min at 4°C. Cells were washed twice with FACS buffer, then fixed with 10% formalin for 15 min at RT. The percentage of tetramer-positive B cells were measured on a BD FACSCelesta flow cytometer and analyzed using FlowJo software.

Biolayer interferometry (BLI)

All experiments were carried out on an Octet RED96e at 30°C with 1000 rpm shaking.

Recombinant CD21 and CD35 binding screen

Biotinylated gp350 was immobilized on streptavidin biosensors (Sartorius) for 150 s. Sensors were immersed in KB for 30 s to collect a baseline measurement. Sensors were then immersed in wells containing 250 nM of recombinant soluble CD21 (SinoBiological) or recombinant soluble CD35 (Bio-Techne) in 1X KB buffer (1X PBS containing 0.01% BSA, 0.02% Tween 20, and 0.005% sodium azide). Then the association was measured for 300 s, followed by immersion in 1X KB for 300 s to measure disassociation.

Kinetic measurements

Biotinylated gp350 monomers were immobilized on streptavidin biosensors (Sartorius) for 150 s. Sensors were immersed in KB for 30 s to collect a baseline measurement. Sensors were then immersed in wells containing 2-fold serial dilutions of Fabs in 1X KB buffer and the association was measured for 300 s, followed by immersion in 1X KB for 600 s to measure dissociation.

Anti-gp42 mAbs were immobilized on anti-human IgG Fc Capture (AHC) biosensors (Sartorius) for 150 s. Sensors were then immersed in KB for 30 s to collect a baseline measurement. Sensors were then immersed in wells containing 2-fold serial dilutions of gp42 or a gH/gL/gp42 complex in 1X KB buffer and the association was measured for 300 s. The sensors were then immersed in 1X KB for 600 s to measure dissociation.

Empty reference sensors were used to measure the background signal from each analyte-containing well. Additionally, each ligand-coupled sensor was associated in wells containing only buffer as a reference. Double reference subtraction was performed for each corresponding ligand-coupled sensor at each time-point. Curve fitting was performed using a 1:1 binding model in Octet BLI Analysis 12.2 software. Mean kdis (1/s) and kon (1/Ms) values were determined by averaging all binding curves that matched the theoretical fit with an R2 value of ≥0.99. The KD value was calculated by taking the mean kdis value divided by the mean kon value.

Epitope binning

mAb competition was assessed via biolayer interferometry. Biotinylated gp350 or gp42 was loaded onto streptavidin sensors, immersed in buffer containing 500 nM of the first mAb to achieve saturable binding, and then immersed in buffer alone or buffer containing 250 nM of a second mAb for 300 s. The % binding inhibition was calculated as the binding signal measured for the second mAb divided by the binding signal in the absence of any competing mAb × 100%.

CD21-gp350 binding competition

Biotinylated gp350 was immobilized on SA biosensors for 150 s. The sensors were immersed in KB buffer containing 500 nM of mAb to achieve saturable binding for 300 s and then immersed in KB buffer containing 250 nM of recombinant human CD21 for 300s.

HLA-DR-gp42 competition

Biotinylated HLA-DRβ1∗0101 monomer loaded with CLIP peptide (Fred Hutch Immune Monitoring Core) was immobilized on streptavidin sensors for 150 s and then immersed in wells containing KB to measure a baseline. Biosensors were then immersed in cells containing 125 nM gp42 or 125 nM of the gH/gL/gp42 complex that had, or had not been, pre-incubated with 250 nM of mAbs for 1h at 37°C for 300 s.

Preparation of EBV reporter viruses

To produce B-cell tropic GFP reporter viruses (B95-8/F), 5×106 293–2089 cells were seeded on a 100 mm tissue culture dish. 48 h later the cells were washed with PBS, the media was replaced with cRPMI without hygromycin, and cells were transfected with 6 μg each of p50987 and p2670,91 expressing BZLF1 and BALF4, respectively, using GeneJuice transfection reagent (SigmaAldrich). 72 h post transfection, the cell supernatant was collected and centrifuged at 500 × g for 3 min to pellet any cell debris and passed through a 0.45 μm filter. Virions were concentrated 25- to 50-fold by centrifugation at 25,000 × g for 2 h and re-suspended in cRPMI. Virus was stored at −80°C and thawed immediately before use.

EBV M81-Luc, expressing GFP and luciferase reporter genes,63,65 was induced by co-transfection of p509 and p2670 following the steps described to produce B95-8/F virus. Virus was stored at −80°C and thawed immediately before use.

Epithelial cell tropic virus was produced from Akata-GFP EBV cells suspended at 4×106 cells/mL in RPMI containing 1% FBS by adding goat anti-human IgG (Southern Biotech) to a final concentration of 100 μg/mL, and the culture was incubated at 37°C for 4 h. Cells were then diluted to 2×106 cells/mL in RPMI containing 1% FBS and cultured for 72 h. Cultures were centrifuged at 300 × g for 10 min to pellet cells and supernatant was passed through a 0.8 μm filter. Bacitracin was added to a final concentration of 100 μg/mL. Virions were concentrated 25× by centrifugation at 25,000 × g for 2 h and re-suspended in RPMI containing 100 μg/mL bacitracin. Virus was stored at −80°C and thawed immediately before use.

EBV neutralization assay in B cells

B cell neutralization assays were carried out in Raji cells as described by Sashihara et al.103 Either 25 μL of supernatant from hybridoma cultures or serially diluted monoclonal antibodies in cRPMI were plated in duplicate wells of 96-well round-bottom plates. 12.5 μL of B95-8/F virus (diluted to achieve an infection frequency of 1–5% at the final dilution) was added and incubated at 37°C for 1 h 12.5 μL of cRMPI containing 4×106 Raji cells/mL was added to each well and incubated for another hour at 37°C. The cells were then pelleted, washed once with cRPMI, and re-suspended in cRPMI. Antibody concentration is reported relative to the final infection volume (50 μL). After 3 days at 37°C, cells were fixed in 10% formalin. The percentage of GFP+ Raji cells as determined on a BD FACSCelesta cytometer. To account for any false positive cells due to auto-fluorescence in the GFP channel, the %GFP+ cells in negative control wells (no virus, n = 4) was subtracted from each well. % neutralization in each well was defined as: [%GFP+ cells in the positive control wells containing virus alone (n = 5 wells) – %GFP+ cells in the antibody containing well]/%GFP+ cells in the positive control wells × 100. The % neutralization for each well was plotted as a function of the log10 of the mAb concentration. The neutralization curve was fit using the log(inhibitor) vs. response-variable slope (four parameters) analysis in Graphpad Prism 10 software.

M81 EBV neutralization assay in AGS or SVKCR2 epithelial cells

5×104 AGS cells or SVKCR2 cells per well were seeded into a 96-well flat-bottom tissue culture plate. The following day, 30 μL of 10μg/mL mAbs in media was incubated with 30 μL of M81-Luc virus for 15 min at 37°C in duplicate. Culture media was aspirated from the cells and replaced with 50 μL of the antibody-virus mixture. Plates were incubated at 37°C for 72 h. Then 50 μL of Steady-Glo reagent (Promega) was added to each well and incubated at RT for 5 min. Luminescence was read using a Promega GloMax Plate Reader. % neutralization is reported as the luminescence signal obtained in the presence of the indicated mAb divided by the average signal obtained in the presence of an isotype control × 100%.

Akata-EBV neutralization assay in SVKCR2 epithelial cells

1.5×104 SVKCR2 cells per well were seeded into a 96-well flat-bottom tissue culture plate. The following day, antibodies were serially diluted in duplicate wells containing 20 μL of media in a 96-well round-bottom plate, followed by the addition of 20 μL Akata-GFP virus and incubated for 15 min at 37°C. Media was aspirated from the SVKCR2 cells and replaced with the antibody-virus mixture. Plates were incubated at 37°C. 48 h later, the number of GFP+ cells were determined on a Sartorius Incucyte S3 Live-Cell Analysis Instrument. Four images per well were taken at 20x objective in the phase and green channels using the adherent cell-by-cell setting. GFP+ cells were determined by the machine’s basic analyzer software using green segmentation surface fit with area range of 8μm2 to 1000 μm2 and intensity minimum of 0.49, and the number of positive cells was averaged across the four images for each well. To account for any false positive cells due to auto-fluorescence in the GFP channel, the average number of GFP+ cells detected by the software in negative control wells (no virus, n = 8) was subtracted from each experimental well. % neutralization in each well was defined as: [number of GFP+ cells in the positive control wells containing virus alone (n = 8 wells) – number of GFP+ cells in the antibody containing well]/number of GFP+ cells in the positive control wells × 100%. The % neutralization for each well was plotted as a function of the log10 of the mAb concentration. The neutralization curve was fit using the log(inhibitor) vs. response-variable slope (four parameters) analysis in Graphpad Prism 10 software.

Protein complex formation for nsEM analysis

ATX-350-2 Fab and ATX-350-1 Fab complex formation with gp350

Purified EndoH-treated gp350 was incubated with ATX-350-2 or ATX-350-1 Fabs at a 1:1.5 gp350:Fab molar ratio for 30 min at room temperature before purification over a Superdex 200 16/600 (Cytiva) size exclusion chromatography (SEC) column, pre-equilibrated in TBS (10 mM Tris HCl, 150 mM NaCl, pH 7.5). Fractions corresponding to the complex peak were pooled, concentrated, run on SDS-PAGE and immediately stained on grids at 0.02 mg/mL in 1x TBS.

gp350/72A1 Fab and gp350/ATX-350-1/72A1 Fab complex formation

Purified gp350-EndoH treated was incubated with a 1:1.5 gp350:Fab72A1 molar ratio. and 1:1.5:1.5 gp350:ATX-350-1:72A1 molar ratio for 1 h at room temperature before purification over a Superdex 200 16/600 SEC column. Fractions corresponding to the complex peak were pooled, concentrated, validated by SDS-PAGE and immediately stained on grids at 0.02 mg/mL and 0.03 mg/mL, respectively, in 1x TBS.

ATX-42-1.1 fab/gp42/gHgL complex formation

Purified gp42/gH/gL complex was incubated with a 1:1.5 gH/gL/gp42:Fab molar ratio, then incubated with a 1:1.3 Complex:ATX-42-1.1 molar ratio and 1:2 Complex:ATX-42-2 for 30 min at room temperature. Afterward, the complex was immediately stained at 0.03 mg/mL with 1x TBS.

ATX-42-2 fab/gp42/gHgL complex formation

Purified gp42/gHgL complex was incubated with a 1:1.5 gH/gL/gp42:ATX-42-2 molar ratio, then incubated with a 1:2 Complex:ATX-42-1.1 molar ratio for 30 min at room temperature. Afterward, the complex was immediately stained at 0.04 mg/mL with 1x TBS.

HLA-DR1β/gp42/gHgL complex formation

Purified gp42/gHgL complex was incubated with a 1:2 gHgL/gp42: HLA-DR1β molar ratio. The complex was mixed for 1 h at room temperature and then was immediately stained on grids at 0.01 mg/mL in 1xTBS.

Negative stain electron microscopy grid preparation, acquisition and data analysis

Complexed proteins were deposited onto Formvar, stabilized with Carbon-coated 400-mesh copper glow discharged grids, hole size: 42 μm (Ted Pella). Proteins were incubated for 30 s on grids before being washed twice with water and once with 2% (w/v) Uranyl -Formate with blotting against filter paper between each step. The grids were then stained with 2% (w/v) uranyl-formate for 30 s followed by blotting on a filter paper and air drying for 3 min. Grids were then imaged at 120 keV on a Talos L120C G2 (Thermo Fisher Scientific) using a 4 K × 4 K Thermo Scientific Ceta CMOS Camera at 92,000× magnification, −2 μm defocus, total dose of 40 e−/Å2 and a pixel size of 1.58 Å. Micrographs were collected using Leginon92 and the images were transferred to CryoSPARC V493 for processing. Particle stacks were generated with particles picked using a Gaussian signal. Particle stacks were then submitted to multiple rounds of 2D classification followed by generation of initial 3D models directly from particle with an ab-initio reconstruction job. Selected 3D classes were refined using homogeneous structure refinement and used to make figures with UCSF ChimeraX.94 Micrographs were collected using Leginon92 and the images were transferred to CryoSPARC V493 for processing. Particle stacks were generated with particles picked using a Gaussian signal. Particle stacks were then submitted to multiple rounds of 2D classification followed by generation of initial 3D models directly from particle with an ab-initio reconstruction job. Selected 3D classes were refined using homogeneous structure refinement and used to make figures with UCSF ChimeraX.94 Published gp350 (PDB ID: 8SGN chain C),60 gHgL/gp42 (PDB: 5T1D CHAIN A, B, C)32 and gp350-CD21 (PDB ID: 8SM0 chain A)60 structures were used and Alphafold 395 predictions of the different Fabs were fit in the nsEM 3D reconstructions for our structural analysis.

Crystal screening and structure determination for gp350/ATX-350-2 Fab complex

The gp350/ATX-350-2 Fab complex was formed as described above.

Initial crystal screening was performed by sitting-drop vapor-diffusion in the MCSG Crystallization Suite (Anatrace) using an NT8 drop setter (Formulatrix) at a complex concentration of 30 mg/mL. Crystals grew in MCSG3 E5 (0.1 M Sodium Citrate:HCl pH 5, 3.15 M Ammonium Sulfate) and diffracting crystals were harvested directly from the 96-well screen and cryoprotected using 20% glycerol. Diffraction data was collected at Advanced Light Source beamline 5.0.2 at 12.7 keV. Data were processed using XDS96 and data reduction was performed using AIMLESS in CCP497 to a resolution of 3.93 Å. Initial phases were solved by molecular replacement (MR) using Phaser in CCP4 with a search model of gp350 (PDBID: 8SM0) and ATX-350-2 fab Alphafold 3 prediction divided into Fv and CH1/CL domains. Model building was completed using Coot98 and refinement was performed in Phenix.99 The crystal belonged to space group P43212, with one complex in the asymmetric unit. The structure was solved by molecular replacement, yielding Rwork and Rfree of 0.2413 and 0.2800, respectively. The data collection and refinement statistics are summarized in Table S3. Structural figures were made in UCSF ChimeraX.94 BSA data was determined using the PDBePISA server.100

EBV challenge in NSG humanized mice

6-week old, female NSG mice were irradiated (275R of total body irradiation) prior to receiving 1x106 CD34+ granulocyte colony-stimulating factor-immobilized huPBSC (purchased from Cooperative Center of Excellence in Hematology at the Fred Hutchinson Cancer Center) in 200 μL PBS via intravenous (i.v.) injection. Ten weeks later, successful human cell engraftment was confirmed by the presence of human CD45+ lymphocytes in peripheral blood by flow cytometry. Using 50 μL blood, RBCs were lysed and cells were stained using a BV510 viability dye (eBioscience) at 1:200 dilution, and the following antibodies at a 1:100 dilution unless otherwise noted: hCD45 FITC (eBioscience), mCD45 APC (eBioscience, 1:200 dilution), hCD33 PE (BD Bioscience), hCD19 BV711 (Biolegend) or hCD20 BV786 (BD, 1:200 dilution), hCD4 AF700 (eBioscience, 1:250 dilution), and hCD8 BV421 (BD Bioscience). Cells were stained for 30 min on ice, washed twice in FACS buffer, fixed in 200 μL of 10% formalin for 15 min on ice, washed, and resuspended in 200 μL FACS buffer for acquisition and analysis on a BDFACS Celesta. Frequency of human CD45+ lymphocytes was calculated from the total of mouse CD45+ plus human CD45+ cell populations. Frequency of human CD19 was calculated from total human CD45+ cell population.

16 weeks post-engraftment, 500 μg of control or experimental mAbs were injected per humanized NSG mouse (n = 4 or 5 mice per mAb group) via intraperitoneal injection. 24 h later, blood was collected via retro-orbital (RO) bleed behind the left eye and then challenged with a dose of EBV B95.8/F equivalent to 20,000 or 25,000 Raji infectious units (RIU) via RO injection behind the right eye. Each group of mice receiving the same mAb were housed together. Following viral challenge, mice were weighed three times weekly. Beginning at four weeks post-challenge, RO blood samples were collected weekly to measure the presence of EBV DNA in whole blood. Mice were euthanized 12 to 14 weeks post-challenge, or until mice lost 20% of their starting weight. Terminal bleeds were collected via cardiac puncture. Spleens were photographed, weighted, and sectioned for DNA extraction utilizing the DNeasy Blood & Tissue Kit (QIAGEN) according to manufacturer’s instructions or fixed in 10% formalin overnight and embedded in paraffin for histological staining by the Fred Hutchinson Cancer Center Experimental Histopathology shared resource (see below for assay details).

Xenotransplantation and EBV challenge in NBSGW mice

UCB-derived CD34+ cells were isolated using Magnetic Assisted Cell sorting (MACS) from Miltenyi Biotech. NBSGW neonates aged 1–3 days were intrahepatically injected with 30,000–50,000 UCB-derived CD34+ hematopoietic stem and progenitor cells per animal in 30 mL of injection media (filtered RPMI, 1 mM EDTA) as previously described.73,104,105 Starting at 8 weeks after injection, human chimerism was measured as the percentage of human CD45+ cells among the mouse and human CD45+ in the PB. Blood analysis was performed every other week.

Male and female mice were used. All mice were ear tagged and assigned to experimental and control groups to evenly distribute the percentage of human CD45+ and human CD19+ cells. 15 to 16 weeks post-engraftment of UCB-derived CD34+ cells, 500 μg of mAbs were transferred via IP injection. 1 day later, mice were bled then challenged with 36,000 RIU of EBV via RO injection. RO blood samples were also collected at week 1, 2, and 3 post challenge to measure mAb levels in sera as described above. Twelve weeks post-challenge, or until mice lost 20% of their starting weight, mice were euthanized. Endpoints were collected and measured as described above.

Pharmacokinetics of mAbs in humanized mice

A cohort of humanized NSG mice received 500 μg of control or experimental mAbs per mouse (n = 4 or 5 mice per mAb group) via intraperitoneal injection at 11 weeks post-engraftment. Blood was collected via RO bleed at 1 day, 1 week, 2 weeks, and 3 weeks post injection. Serum was heat-inactivated at 56°C for 10 min, then kept at 4°C. Sera from all four time points were assessed for mAb levels compared to each group’s respective mAb standard via antigen-specific ELISA.

Measurement of passive transferred IgG in huCD34+ engrafted mice

384-well microplates were coated with 190 ng/well of gp350, or with 60 ng/well gp42, gH/gL, or HIV Env 426c.TM4ΔV1-3 in 0.1 M NaHCO3 pH 9.4–9.6 (ELISA coating buffer) at RT overnight at 30 μL/well. The next day, plates were washed 4 times with 1x PBS and 0.02% Tween 20 (ELISA wash buffer) prior to blocking for 1 h with 100 μL/well of PBS containing 10% non-fat milk and 0.02% Tween 20 (ELISA blocking buffer) at 37°C. After blocking, serial dilutions of serum or serially diluted mAb standards (2 μg/mL- 0.14 pg/mL) in ELISA blocking buffer was added and incubated for 1 h at 37°C. 32 control wells were included that contained only blocking buffer without sera or mAb standard. Plates were incubated for 1 h at 37°C. After washing, a 1:4000 dilution of goat anti-human IgG-HRP (Jackson ImmunoResearch) in ELISA blocking buffer was added to each well and incubated 1h at 37°C. After four washes, 30 μL/well of SureBlue Reserve TMB Microwell Peroxidase substrate (SeraCare) was added. After 5 min at room temperature, 30 μL/well of 1 N sulfuric acid was added and the A450 of each well was read on a Molecular Devices SpectraMax M2 plate reader. The average A450 values of buffer only control wells were subtracted from each serum containing well and plotted in GraphPad Prism 10. A450 values were plotted as a function of the log10 of the serum dilution. A binding curve of the mAb standard was fit using the sigmoidal, 4PL, X is log(concentration) least squares fit function. The mAb concentration in the serum was determined by interpolating the concentration of each dilution from the standard curve, multiplying by the dilution factor, and calculating the mean.

Quantitative PCR analysis EBV DNA in huCD34+ engrafted mice

A primer-probe mix specific for the EBV IR1 gene90 was used to quantify EBV in DNA extracted from splenocytes collected from huCD34+ engrafted NSG or NBSGW mice. For DNA extracted from blood, a primer-probe mix specific the EBV BALF5 gene89 was used. Each 25 μL qPCR reaction contained 12.5 μL QuantiTect Probe PCR Master Mix (QIAGEN), 600 nM of each primer and 300 nM of FAM-labeled probe (IDT), 1.25 μL of a TaqMan VIC-labeled RNase-P primer probe mix (Fisher Scientific). For analysis of splenocytes, reactions contained 1 μg DNA extracted from splenocytes as template. To analyze EBV in peripheral blood, DNA was extracted from 50 μL of blood collected via cardiac puncture or retro-orbital bleed using the DNeasy Blood and Tissue Kit (QIAGEN) and eluted in 50 μL of Buffer AE (QIAGEN). 10 μL of extracted DNA was used as template in qPCR. Reactions were heated to 95°C for 15 min to activate DNA polymerase followed by 50 cycles of 95°C for 15 s 60°C for 60 s, on an Applied Biosystems QuantStudio 7 Flex Real-Time PCR System. Synthetic DNA fragments containing either the IR1 or BALF5 target gene as well as flanking genomic regions were synthesized as double-stranded DNA gBlocks (Integrated DNA Technolgies) and were used to generate a standard curve with known gene copy numbers ranging from 106-100 copies/μl. The viral copy number was determined by interpolating from the standard curve. Serial dilutions of reference standard were used to experimentally determine a limit of detection of 6.25 copies, which corresponds to the amount of template that can be detected in >95% of reactions. For graphical purposes, samples with no amplification or those yielding values below the limit of detection were assigned a value of 0.625 copies.

Immunohistochemistry and in situ hybridization

Formalin-fixed paraffin-embedded tissues were sectioned at 4 μm onto positively charged slides and incubated for 60 min at 60°C. The slides were then dewaxed and stained on a Leica BOND RX autostainer (Leica, Buffalo Grove, IL) using Bond reagents for deparaffinization (Leica).

For immunohistochemistry (IHC), antigen retrieval was conducted at 100°C for 20 min with Bond Epitope Retrieval Solution 2 (Leica). Endogenous peroxidase was blocked using 3% H2O2 for 5 min, followed by protein blocking with TCT buffer (0.05M Tris, 0.15M NaCl, 0.25% Casein, 0.1% Tween 20, 0.05% ProClin300, pH 7.6) for 10 min. Anti-CD20 (mouse polyclonal, Dako clone L26 at a dilution of 1:4000) was applied to slides for 60 min at room temperature. For detection, slides were then incubated with Refine Rabbit Polymer HRP (Leica), or PowerVision Anti-Mouse Polymer HRP (Leica) for 12 min, mixed Refine DAB (Leica) for 10 min, followed by counterstaining with Refine Hematoxylin (Leica) for 4 min. Slides were then dehydrated, cleared, and coverslipped with permanent mounting media.

For in situ hybridization (ISH), antigen retrieval was conducted with Epitope Retrieval Solution 2 for 15 min at 95°C, protease digestion at 40°C for 15 min and rinses after each step (Bond Wash Solution). All other steps were performed at ambient temperature. Staining was performed with RNAscope 2.5 LS Reagent Kit – BROWN (ACD Bio Techne). RNAscope 2.5 LS Positive Control Probe Human PPIB (ACD Bio Techne), Negative Control probe dapB (ACD Bio Techne), and EBV RNAscope 2.5 LS Probe-V-EBER1 probe (ACD Bio Techne) was applied and incubated at 42°C for 120 min. Chromogenic staining was performed using BOND Polymer Refine Detection (Leica DS9800). Slides were then dehydrated, cleared, and coverslipped with permanent mounting media and imaged on Evident VS200.

Quantification and statistical analysis

GraphPad Prism (version 10) was used to perform Mann-Whitney and Kruskal-Wallis tests. p values <0.05 were regarded as significant. Information on the specific analyses performed for indivdual experiments can be found in the relevant figure legends.

Published: February 17, 2026

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.xcrm.2026.102618.

Supplemental information

Document S1. Figures S1–S13 and Tables S1–S4
mmc1.pdf (2.7MB, pdf)
Document S2. Article plus supplemental information
mmc2.pdf (24.8MB, pdf)

References

  • 1.Cohen J.I. Epstein-Barr virus infection. N. Engl. J. Med. 2000;343:481–492. doi: 10.1056/NEJM200008173430707. [DOI] [PubMed] [Google Scholar]
  • 2.Henle G., Henle W., Diehl V. Relation of Burkitt’s tumor-associated herpes-ytpe virus to infectious mononucleosis. Proc. Natl. Acad. Sci. USA. 1968;59:94–101. doi: 10.1073/pnas.59.1.94. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dunmire S.K., Hogquist K.A., Balfour H.H. Infectious Mononucleosis. Curr. Top. Microbiol. Immunol. 2015;390:211–240. doi: 10.1007/978-3-319-22822-8_9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Levin L.I., Munger K.L., O'Reilly E.J., Falk K.I., Ascherio A. Primary infection with the Epstein-Barr virus and risk of multiple sclerosis. Ann. Neurol. 2010;67:824–830. doi: 10.1002/ana.21978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Handel A.E., Williamson A.J., Disanto G., Handunnetthi L., Giovannoni G., Ramagopalan S.V. An updated meta-analysis of risk of multiple sclerosis following infectious mononucleosis. PLoS One. 2010;5 doi: 10.1371/journal.pone.0012496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Thacker E.L., Mirzaei F., Ascherio A. Infectious mononucleosis and risk for multiple sclerosis: a meta-analysis. Ann. Neurol. 2006;59:499–503. doi: 10.1002/ana.20820. [DOI] [PubMed] [Google Scholar]
  • 7.Munger K.L., Levin L.I., O'Reilly E.J., Falk K.I., Ascherio A. Anti-Epstein-Barr virus antibodies as serological markers of multiple sclerosis: a prospective study among United States military personnel. Mult. Scler. 2011;17:1185–1193. doi: 10.1177/1352458511408991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nielsen T.R., Rostgaard K., Askling J., Steffensen R., Oturai A., Jersild C., Koch-Henriksen N., Sørensen P.S., Hjalgrim H. Effects of infectious mononucleosis and HLA-DRB1∗15 in multiple sclerosis. Mult. Scler. 2009;15:431–436. doi: 10.1177/1352458508100037. [DOI] [PubMed] [Google Scholar]
  • 9.Ascherio A., Munger K.L. Epstein-barr virus infection and multiple sclerosis: a review. J. Neuroimmune Pharmacol. 2010;5:271–277. doi: 10.1007/s11481-010-9201-3. [DOI] [PubMed] [Google Scholar]
  • 10.Bjornevik K., Cortese M., Healy B.C., Kuhle J., Mina M.J., Leng Y., Elledge S.J., Niebuhr D.W., Scher A.I., Munger K.L., Ascherio A. Longitudinal analysis reveals high prevalence of Epstein-Barr virus associated with multiple sclerosis. Science. 2022;375:296–301. doi: 10.1126/science.abj8222. [DOI] [PubMed] [Google Scholar]
  • 11.Robinson W.H., Younis S., Love Z.Z., Steinman L., Lanz T.V. Epstein-Barr virus as a potentiator of autoimmune diseases. Nat. Rev. Rheumatol. 2024;20:729–740. doi: 10.1038/s41584-024-01167-9. [DOI] [PubMed] [Google Scholar]
  • 12.Balandraud N., Roudier J. Epstein-Barr virus and rheumatoid arthritis. Jt. Bone Spine. 2018;85:165–170. doi: 10.1016/j.jbspin.2017.04.011. [DOI] [PubMed] [Google Scholar]
  • 13.Fechtner S., Berens H., Bemis E., Johnson R.L., Guthridge C.J., Carlson N.E., Demoruelle M.K., Harley J.B., Edison J.D., Norris J.A., et al. Antibody Responses to Epstein-Barr Virus in the Preclinical Period of Rheumatoid Arthritis Suggest the Presence of Increased Viral Reactivation Cycles. Arthritis Rheumatol. 2022;74:597–603. doi: 10.1002/art.41994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Su Y., Yuan D., Chen D.G., Ng R.H., Wang K., Choi J., Li S., Hong S., Zhang R., Xie J., et al. Multiple early factors anticipate post-acute COVID-19 sequelae. Cell. 2022;185:881–895.e20. doi: 10.1016/j.cell.2022.01.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bernal K.D.E., Whitehurst C.B. Incidence of Epstein-Barr virus reactivation is elevated in COVID-19 patients. Virus Res. 2023;334 doi: 10.1016/j.virusres.2023.199157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Chen T., Song J., Liu H., Zheng H., Chen C. Positive Epstein-Barr virus detection in coronavirus disease 2019 (COVID-19) patients. Sci. Rep. 2021;11 doi: 10.1038/s41598-021-90351-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wong Y., Meehan M.T., Burrows S.R., Doolan D.L., Miles J.J. Estimating the global burden of Epstein-Barr virus-related cancers. J. Cancer Res. Clin. Oncol. 2022;148:31–46. doi: 10.1007/s00432-021-03824-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Khan G., Fitzmaurice C., Naghavi M., Ahmed L.A. Global and regional incidence, mortality and disability-adjusted life-years for Epstein-Barr virus-attributable malignancies, 1990–2017. BMJ Open. 2020;10 doi: 10.1136/bmjopen-2020-037505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Taylor G.S., Long H.M., Brooks J.M., Rickinson A.B., Hislop A.D. The Immunology of Epstein-Barr Virus–Induced Disease. Annu. Rev. Immunol. 2015;33:787–821. doi: 10.1146/annurev-immunol-032414-112326. [DOI] [PubMed] [Google Scholar]
  • 20.Escalante G.M., Mutsvunguma L.Z., Muniraju M., Rodriguez E., Ogembo J.G. Four Decades of Prophylactic EBV Vaccine Research: A Systematic Review and Historical Perspective. Front. Immunol. 2022;13 doi: 10.3389/fimmu.2022.867918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bu G.-L., Xie C., Kang Y.-F., Zeng M.-S., Sun C. How EBV Infects: The Tropism and Underlying Molecular Mechanism for Viral Infection. Viruses. 2022;14:2372. doi: 10.3390/v14112372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Connolly S.A., Jardetzky T.S., Longnecker R. The structural basis of herpesvirus entry. Nat. Rev. Microbiol. 2021;19:110–121. doi: 10.1038/s41579-020-00448-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Gonzalez-Del Pino G.L., Heldwein E.E. Well Put Together-A Guide to Accessorizing with the Herpesvirus gH/gL Complexes. Viruses. 2022;14 doi: 10.3390/v14020296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li Y., Zhang H., Sun C., Dong X.D., Xie C., Liu Y.T., Lin R.B., Kong X.W., Hu Z.L., Ma X.Y., et al. R9AP is a common receptor for EBV infection in epithelial cells and B cells. Nature. 2025;644:205–213. doi: 10.1038/s41586-025-09166-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Fingeroth J.D., Weis J.J., Tedder T.F., Strominger J.L., Biro P.A., Fearon D.T. Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc. Natl. Acad. Sci. USA. 1984;81:4510–4514. doi: 10.1073/pnas.81.14.4510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tanner J., Weis J., Fearon D., Whang Y., Kieff E. Epstein-barr virus gp350/220 binding to the B lymphocyte C3d receptor mediates adsorption, capping, and endocytosis. Cell. 1987;50:203–213. doi: 10.1016/0092-8674(87)90216-9. [DOI] [PubMed] [Google Scholar]
  • 27.Ogembo J.G., Kannan L., Ghiran I., Nicholson-Weller A., Finberg R.W., Tsokos G.C., Fingeroth J.D. Human Complement Receptor Type 1/CD35 Is an Epstein-Barr Virus Receptor. Cell Rep. 2013;3:371–385. doi: 10.1016/j.celrep.2013.01.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kirschner A.N., Omerovic J., Popov B., Longnecker R., Jardetzky T.S. Soluble Epstein-Barr virus glycoproteins gH, gL, and gp42 form a 1:1:1 stable complex that acts like soluble gp42 in B-cell fusion but not in epithelial cell fusion. J. Virol. 2006;80:9444–9454. doi: 10.1128/JVI.00572-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sathiyamoorthy K., Jiang J., Hu Y.X., Rowe C.L., Möhl B.S., Chen J., Jiang W., Mellins E.D., Longnecker R., Zhou Z.H., Jardetzky T.S. Assembly and Architecture of the EBV B Cell Entry Triggering Complex. PLoS Pathog. 2014;10 doi: 10.1371/journal.ppat.1004309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Haan K.M., Kwok W.W., Longnecker R., Speck P. Epstein-Barr virus entry utilizing HLA-DP or HLA-DQ as a coreceptor. J. Virol. 2000;74:2451–2454. doi: 10.1128/jvi.74.5.2451-2454.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Spriggs M.K., Armitage R.J., Comeau M.R., Strockbine L., Farrah T., Macduff B., Ulrich D., Alderson M.R., Müllberg J., Cohen J.I. The extracellular domain of the Epstein-Barr virus BZLF2 protein binds the HLA-DR beta chain and inhibits antigen presentation. J. Virol. 1996;70:5557–5563. doi: 10.1128/jvi.70.8.5557-5563.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sathiyamoorthy K., Hu Y.X., Möhl B.S., Chen J., Longnecker R., Jardetzky T.S. Structural basis for Epstein–Barr virus host cell tropism mediated by gp42 and gHgL entry glycoproteins. Nat. Commun. 2016;7 doi: 10.1038/ncomms13557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zhao G.-X., Fang X.-Y., Bu G.-L., Chen S.-J.-B., Sun C., Li T., Xie C., Wang Y., Li S.-X., Meng N., et al. Potent human monoclonal antibodies targeting Epstein-Barr virus gp42 reveal vulnerable sites for virus infection. Cell Rep. Med. 2024;5 doi: 10.1016/j.xcrm.2024.101573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bu W., Kumar A., Board N.L., Kim J., Dowdell K., Zhang S., Lei Y., Hostal A., Krogmann T., Wang Y., et al. Epstein-Barr virus gp42 antibodies reveal sites of vulnerability for receptor binding and fusion to B cells. Immunity. 2024;57:559–573.e6. doi: 10.1016/j.immuni.2024.02.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Silva A.L., Omerovic J., Jardetzky T.S., Longnecker R. Mutational analyses of Epstein-Barr virus glycoprotein 42 reveal functional domains not involved in receptor binding but required for membrane fusion. J. Virol. 2004;78:5946–5956. doi: 10.1128/jvi.78.11.5946-5956.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Kirschner A.N., Sorem J., Longnecker R., Jardetzky T.S. Structure of Epstein-Barr Virus Glycoprotein 42 Suggests a Mechanism for Triggering Receptor-Activated Virus Entry. Structure. 2009;17:223–233. doi: 10.1016/j.str.2008.12.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mullen M.M., Haan K.M., Longnecker R., Jardetzky T.S. Structure of the Epstein-Barr Virus gp42 Protein Bound to the MHC Class II Receptor HLA-DR1. Mol. Cell. 2002;9:375–385. doi: 10.1016/S1097-2765(02)00465-3. [DOI] [PubMed] [Google Scholar]
  • 38.Hislop A.D., Taylor G.S., Sauce D., Rickinson A.B. Cellular Responses to Viral Infection in Humans: Lessons from Epstein-Barr Virus. Annu. Rev. Immunol. 2007;25:587–617. doi: 10.1146/annurev.immunol.25.022106.141553. [DOI] [PubMed] [Google Scholar]
  • 39.Rickinson A.B., Long H.M., Palendira U., Münz C., Hislop A.D. Cellular immune controls over Epstein-Barr virus infection: new lessons from the clinic and the laboratory. Trends Immunol. 2014;35:159–169. doi: 10.1016/j.it.2014.01.003. [DOI] [PubMed] [Google Scholar]
  • 40.Thorley-Lawson D.A., Duca K.A., Shapiro M. Epstein-Barr virus: a paradigm for persistent infection - for real and in virtual reality. Trends Immunol. 2008;29:195–201. doi: 10.1016/j.it.2008.01.006. [DOI] [PubMed] [Google Scholar]
  • 41.da Silva S.R., de Oliveira D.E. HIV, EBV and KSHV: viral cooperation in the pathogenesis of human malignancies. Cancer Lett. 2011;305:175–185. doi: 10.1016/j.canlet.2011.02.007. [DOI] [PubMed] [Google Scholar]
  • 42.Grulich A.E., van Leeuwen M.T., Falster M.O., Vajdic C.M. Incidence of cancers in people with HIV/AIDS compared with immunosuppressed transplant recipients: a meta-analysis. Lancet. 2007;370:59–67. doi: 10.1016/s0140-6736(07)61050-2. [DOI] [PubMed] [Google Scholar]
  • 43.Law N., Logan C., Taplitz R. EBV Reactivation and Disease in Allogeneic Hematopoietic Stem Cell Transplant (HSCT) Recipients and Its Impact on HSCT Outcomes. Viruses. 2024;16 doi: 10.3390/v16081294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Dharnidharka V.R., Ruzinova M.B., Marks L.J. Post-Transplant Lymphoproliferative Disorders. Semin. Nephrol. 2024;44 doi: 10.1016/j.semnephrol.2024.151503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Cockfield S.M. Identifying the patient at risk for post-transplant lymphoproliferative disorder. Transpl. Infect. Dis. 2001;3:70–78. doi: 10.1034/j.1399-3062.2001.003002070.x. [DOI] [PubMed] [Google Scholar]
  • 46.Walker R.C., Marshall W.F., Strickler J.G., Wiesner R.H., Velosa J.A., Habermann T.M., McGregor C.G., Paya C.V. Pretransplantation assessment of the risk of lymphoproliferative disorder. Clin. Infect. Dis. 1995;20:1346–1353. doi: 10.1093/clinids/20.5.1346. [DOI] [PubMed] [Google Scholar]
  • 47.Glotz D., Chapman J.R., Dharnidharka V.R., Hanto D.W., Castro M.C.R., Hirsch H.H., Leblond V., Mehta A.K., Moulin B., Pagliuca A., et al. The Seville expert workshop for progress in posttransplant lymphoproliferative disorders. Transplantation. 2012;94:784–793. doi: 10.1097/TP.0b013e318269e64f. [DOI] [PubMed] [Google Scholar]
  • 48.Haque T., Johannessen I., Dombagoda D., Sengupta C., Burns D.M., Bird P., Hale G., Mieli-Vergani G., Crawford D.H. A mouse monoclonal antibody against Epstein-Barr virus envelope glycoprotein 350 prevents infection both in vitro and in vivo. J. Infect. Dis. 2006;194:584–587. doi: 10.1086/505912. [DOI] [PubMed] [Google Scholar]
  • 49.Hong J., Zhong L., Zheng Q., Wu Q., Zha Z., Wei D., Chen H., Zhang W., Zhang S., Huang Y., et al. A Neutralizing Antibody Targeting gH Provides Potent Protection against EBV Challenge In Vivo. J. Virol. 2022;96 doi: 10.1128/jvi.00075-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhu Q.Y., Shan S., Yu J., Peng S.Y., Sun C., Zuo Y., Zhong L.Y., Yan S.M., Zhang X., Yang Z., et al. A potent and protective human neutralizing antibody targeting a novel vulnerable site of Epstein-Barr virus. Nat. Commun. 2021;12:6624. doi: 10.1038/s41467-021-26912-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Chen W.H., Kim J., Bu W., Board N.L., Tsybovsky Y., Wang Y., Hostal A., Andrews S.F., Gillespie R.A., Choe M., et al. Epstein-Barr virus gH/gL has multiple sites of vulnerability for virus neutralization and fusion inhibition. Immunity. 2022;55:2135–2148.e6. doi: 10.1016/j.immuni.2022.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Zhang X., Hong J., Zhong L., Wu Q., Zhang S., Zhu Q., Chen H., Wei D., Li R., Zhang W., et al. Protective anti-gB neutralizing antibodies targeting two vulnerable sites for EBV-cell membrane fusion. Proc. Natl. Acad. Sci. USA. 2022;119 doi: 10.1073/pnas.2202371119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Hong J., Zhong L., Liu L., Wu Q., Zhang W., Chen K., Wei D., Sun H., Zhou X., Zhang X., et al. Non-overlapping epitopes on the gHgL-gp42 complex for the rational design of a triple-antibody cocktail against EBV infection. Cell Rep. Med. 2023;4 doi: 10.1016/j.xcrm.2023.101296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Singh S., Homad L.J., Akins N.R., Stoffers C.M., Lackhar S., Malhi H., Wan Y.-H., Rawlings D.J., McGuire A.T. Neutralizing Antibodies Protect against Oral Transmission of Lymphocryptovirus. Cell Rep. Med. 2020;1 doi: 10.1016/j.xcrm.2020.100033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Mühe J., Aye P.P., Quink C., Eng J.Y., Engelman K., Reimann K.A., Wang F. Neutralizing antibodies against Epstein-Barr virus infection of B cells can protect from oral viral challenge in the rhesus macaque animal model. Cell Rep. Med. 2021;2 doi: 10.1016/j.xcrm.2021.100352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Hoffman G.J., Lazarowitz S.G., Hayward S.D. Monoclonal antibody against a 250,000-dalton glycoprotein of Epstein-Barr virus identifies a membrane antigen and a neutralizing antigen. Proc. Natl. Acad. Sci. USA. 1980;77:2979–2983. doi: 10.1073/pnas.77.5.2979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Tanner J.E., Hu J., Alfieri C. Construction and Characterization of a Humanized Anti-Epstein-Barr Virus gp350 Antibody with Neutralizing Activity in Cell Culture. Cancers (Basel) 2018;10 doi: 10.3390/cancers10040112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Mutsvunguma L.Z., Rodriguez E., Escalante G.M., Muniraju M., Williams J.C., Warden C., Qin H., Wang J., Wu X., Barasa A., et al. Identification of multiple potent neutralizing and non-neutralizing antibodies against Epstein-Barr virus gp350 protein with potential for clinical application and as reagents for mapping immunodominant epitopes. Virology. 2019;536:1–15. doi: 10.1016/j.virol.2019.07.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Snijder J., Ortego M.S., Weidle C., Stuart A.B., Gray M.D., McElrath M.J., Pancera M., Veesler D., McGuire A.T. An antibody targeting the fusion machinery neutralizes dual-tropic infection and defines a site of vulnerability on Epstein-Barr virus. Immunity. 2018;48:799–811.e9. doi: 10.1016/j.immuni.2018.03.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Joyce M.G., Bu W., Chen W.-H., Gillespie R.A., Andrews S.F., Wheatley A.K., Tsybovsky Y., Jensen J.L., Stephens T., Prabhakaran M., et al. Structural basis for complement receptor engagement and virus neutralization through Epstein-Barr virus gp350. Immunity. 2025;58:295–308.e5. doi: 10.1016/j.immuni.2025.01.010. [DOI] [PubMed] [Google Scholar]
  • 61.Alloy Therapeutics Inc. Alloy Therapeutics. 2025. https://alloytx.com/
  • 62.Li Q.X., Young L.S., Niedobitek G., Dawson C.W., Birkenbach M., Wang F., Rickinson A.B. Epstein-Barr virus infection and replication in a human epithelial cell system. Nature. 1992;356:347–350. doi: 10.1038/356347a0. [DOI] [PubMed] [Google Scholar]
  • 63.Tsai M.H., Raykova A., Klinke O., Bernhardt K., Gärtner K., Leung C.S., Geletneky K., Sertel S., Münz C., Feederle R., Delecluse H.J. Spontaneous lytic replication and epitheliotropism define an Epstein-Barr virus strain found in carcinomas. Cell Rep. 2013;5:458–470. doi: 10.1016/j.celrep.2013.09.012. [DOI] [PubMed] [Google Scholar]
  • 64.Minab R., Bu W., Nguyen H., Wall A., Sholukh A.M., Huang M.L., Ortego M., Krantz E.M., Irvine M., Casper C., et al. Maternal Epstein-Barr Virus-Specific Antibodies and Risk of Infection in Ugandan Infants. J. Infect. Dis. 2021;223:1897–1904. doi: 10.1093/infdis/jiaa654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Bilger A., Plowshay J., Ma S., Nawandar D., Barlow E.A., Romero-Masters J.C., Bristol J.A., Li Z., Tsai M.-H., Delecluse H.-J., Kenney S.C. Leflunomide/teriflunomide inhibit Epstein-Barr virus (EBV)-induced lymphoproliferative disease and lytic viral replication. Oncotarget. 2017;8:44266–44280. doi: 10.18632/oncotarget.17863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Delecluse S., Poirey R., Zeier M., Schnitzler P., Behrends U., Tsai M.-H., Delecluse H.-J. Identification and Cloning of a New Western Epstein-Barr Virus Strain That Efficiently Replicates in Primary B Cells. J. Virol. 2020;94 doi: 10.1128/jvi.01918-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Slabik C., Kalbarczyk M., Danisch S., Zeidler R., Klawonn F., Volk V., Krönke N., Feuerhake F., Ferreira de Figueiredo C., Blasczyk R., et al. CAR-T Cells Targeting Epstein-Barr Virus gp350 Validated in a Humanized Mouse Model of EBV Infection and Lymphoproliferative Disease. Mol. Ther. Oncolytics. 2020;18:504–524. doi: 10.1016/j.omto.2020.08.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Li Q., Turk S.M., Hutt-Fletcher L.M. The Epstein-Barr virus (EBV) BZLF2 gene product associates with the gH and gL homologs of EBV and carries an epitope critical to infection of B cells but not of epithelial cells. J. Virol. 1995;69:3987–3994. doi: 10.1128/JVI.69.7.3987-3994.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Wu Q., Zhong L., Wei D., Zhang W., Hong J., Kang Y., Chen K., Huang Y., Zheng Q., Xu M., et al. Neutralizing antibodies against EBV gp42 show potent in vivo protection and define novel epitopes. Emerg. Microbes Infect. 2023;12 doi: 10.1080/22221751.2023.2245920. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Cui X., Cao Z., Ishikawa Y., Cui S., Imadome K.I., Snapper C.M. Immunization with Epstein-Barr Virus Core Fusion Machinery Envelope Proteins Elicit High Titers of Neutralizing Activities and Protect Humanized Mice from Lethal Dose EBV Challenge. Vaccines (Basel) 2021;9 doi: 10.3390/vaccines9030285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Malhi H., Homad L.J., Wan Y.-H., Poudel B., Fiala B., Borst A.J., Wang J.Y., Walkey C., Price J., Wall A., et al. Immunization with a self-assembling nanoparticle vaccine displaying EBV gH/gL protects humanized mice against lethal viral challenge. Cell Rep. Med. 2022;3 doi: 10.1016/j.xcrm.2022.100658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Edwards K.R., Malhi H., Schmidt K., Davis A.R., Homad L.J., Warner N.L., Chhan C.B., Scharffenberger S.C., Gaffney K., Hinkley T., et al. A gH/gL-encoding replicon vaccine elicits neutralizing antibodies that protect humanized mice against EBV challenge. npj Vaccines. 2024;9:120. doi: 10.1038/s41541-024-00907-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Choo S., Wolf C.B., Mack H.M., Egan M.J., Kiem H.P., Radtke S. Choosing the right mouse model: comparison of humanized NSG and NBSGW mice for in vivo HSC gene therapy. Blood Adv. 2024;8:916–926. doi: 10.1182/bloodadvances.2023011371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.Wu X., Yang Z.-Y., Li Y., Hogerkorp C.-M., Schief W.R., Seaman M.S., Zhou T., Schmidt S.D., Wu L., Xu L., et al. Rational Design of Envelope Identifies Broadly Neutralizing Human Monoclonal Antibodies to HIV-1. Science. 2010;329:856–861. doi: 10.1126/science.1187659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Tierney R.J., Steven N., Young L.S., Rickinson A.B. Epstein-Barr virus latency in blood mononuclear cells: analysis of viral gene transcription during primary infection and in the carrier state. J. Virol. 1994;68:7374–7385. doi: 10.1128/JVI.68.11.7374-7385.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Kanekiyo M., Bu W., Joyce M.G., Meng G., Whittle J.R.R., Baxa U., Yamamoto T., Narpala S., Todd J.-P., Rao S.S., et al. Rational Design of an Epstein-Barr Virus Vaccine Targeting the Receptor-Binding Site. Cell. 2015;162:1090–1100. doi: 10.1016/j.cell.2015.07.043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Bu W., Joyce M.G., Nguyen H., Banh D.V., Aguilar F., Tariq Z., Yap M.L., Tsujimura Y., Gillespie R.A., Tsybovsky Y., et al. Immunization with Components of the Viral Fusion Apparatus Elicits Antibodies That Neutralize Epstein-Barr Virus in B Cells and Epithelial Cells. Immunity. 2019;50:1305–1316.e6. doi: 10.1016/j.immuni.2019.03.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Wei C.J., Bu W., Nguyen L.A., Batchelor J.D., Kim J., Pittaluga S., Fuller J.R., Nguyen H., Chou T.H., Cohen J.I., Nabel G.J. A bivalent Epstein-Barr virus vaccine induces neutralizing antibodies that block infection and confer immunity in humanized mice. Sci. Transl. Med. 2022;14 doi: 10.1126/scitranslmed.abf3685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Janz A., Oezel M., Kurzeder C., Mautner J., Pich D., Kost M., Hammerschmidt W., Delecluse H.J. Infectious Epstein-Barr virus lacking major glycoprotein BLLF1 (gp350/220) demonstrates the existence of additional viral ligands. J. Virol. 2000;74:10142–10152. doi: 10.1128/jvi.74.21.10142-10152.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Fujiwara S., Matsuda G., Imadome K.I. Humanized mouse models of epstein-barr virus infection and associated diseases. Pathogens. 2013;2:153–176. doi: 10.3390/pathogens2010153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Fujiwara S., Nakamura H. Animal Models for Gammaherpesvirus Infections: Recent Development in the Analysis of Virus-Induced Pathogenesis. Pathogens. 2020;9 doi: 10.3390/pathogens9020116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 82.Jiang R., Gu X., Nathan C.A., Hutt-Fletcher L. Laser-capture microdissection of oropharyngeal epithelium indicates restriction of Epstein-Barr virus receptor/CD21 mRNA to tonsil epithelial cells. J. Oral Pathol. Med. 2008;37:626–633. doi: 10.1111/j.1600-0714.2008.00681.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Hayman I.R., Temple R.M., Burgess C.K., Ferguson M., Liao J., Meyers C., Sample C.E. New insight into Epstein-Barr virus infection using models of stratified epithelium. PLoS Pathog. 2023;19 doi: 10.1371/journal.ppat.1011040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Tugizov S.M., Berline J.W., Palefsky J.M. Epstein-Barr virus infection of polarized tongue and nasopharyngeal epithelial cells. Nat. Med. 2003;9:307–314. doi: 10.1038/nm830. [DOI] [PubMed] [Google Scholar]
  • 85.Jin S., Li R., Chen M.-Y., Yu C., Tang L.-Q., Liu Y.-M., Li J.-P., Liu Y.-N., Luo Y.-L., Zhao Y., et al. Single-cell transcriptomic analysis defines the interplay between tumor cells, viral infection, and the microenvironment in nasopharyngeal carcinoma. Cell Res. 2020;30:950–965. doi: 10.1038/s41422-020-00402-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Kong X.-W., Bu G.-L., Chen H., Huang Y.-H., Liu Z., Kang Y.-F., Li Y.-C., Yu X., Wu B.-H., Li Z.-Q., et al. A large-scale population-based study reveals that gp42-IgG antibody is protective against EBV–associated nasopharyngeal carcinoma. J. Clin. Investig. 2024;135 doi: 10.1172/JCI180216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Delecluse H.J., Hilsendegen T., Pich D., Zeidler R., Hammerschmidt W. Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells. Proc. Natl. Acad. Sci. USA. 1998;95:8245–8250. doi: 10.1073/pnas.95.14.8245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Molesworth S.J., Lake C.M., Borza C.M., Turk S.M., Hutt-Fletcher L.M. Epstein-Barr virus gH is essential for penetration of B cells but also plays a role in attachment of virus to epithelial cells. J. Virol. 2000;74:6324–6332. doi: 10.1128/jvi.74.14.6324-6332.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Kimura H., Morita M., Yabuta Y., Kuzushima K., Kato K., Kojima S., Matsuyama T., Morishima T. Quantitative analysis of Epstein-Barr virus load by using a real-time PCR assay. J. Clin. Microbiol. 1999;37:132–136. doi: 10.1128/jcm.37.1.132-136.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Palser A.L., Grayson N.E., White R.E., Corton C., Correia S., Ba Abdullah M.M., Watson S.J., Cotten M., Arrand J.R., Murray P.G., et al. Genome diversity of Epstein-Barr virus from multiple tumor types and normal infection. J. Virol. 2015;89:5222–5237. doi: 10.1128/JVI.03614-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Neuhierl B., Feederle R., Hammerschmidt W., Delecluse H.J. Glycoprotein gp110 of Epstein-Barr virus determines viral tropism and efficiency of infection. Proc. Natl. Acad. Sci. USA. 2002;99:15036–15041. doi: 10.1073/pnas.232381299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Suloway C., Pulokas J., Fellmann D., Cheng A., Guerra F., Quispe J., Stagg S., Potter C.S., Carragher B. Automated molecular microscopy: the new Leginon system. J. Struct. Biol. 2005;151:41–60. doi: 10.1016/j.jsb.2005.03.010. [DOI] [PubMed] [Google Scholar]
  • 93.Punjani A., Rubinstein J.L., Fleet D.J., Brubaker M.A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat. Methods. 2017;14:290–296. doi: 10.1038/nmeth.4169. [DOI] [PubMed] [Google Scholar]
  • 94.Meng E.C., Goddard T.D., Pettersen E.F., Couch G.S., Pearson Z.J., Morris J.H., Ferrin T.E. UCSF ChimeraX: Tools for structure building and analysis. Protein Sci. 2023;32 doi: 10.1002/pro.4792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Abramson J., Adler J., Dunger J., Evans R., Green T., Pritzel A., Ronneberger O., Willmore L., Ballard A.J., Bambrick J., et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature. 2024;630:493–500. doi: 10.1038/s41586-024-07487-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Kabsch W. XDS. Acta Crystallogr. D Biol. Crystallogr. 2010;66:125–132. doi: 10.1107/s0907444909047337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Agirre J., Atanasova M., Bagdonas H., Ballard C.B., Baslé A., Beilsten-Edmands J., Borges R.J., Brown D.G., Burgos-Mármol J.J., Berrisford J.M., et al. The CCP4 suite: integrative software for macromolecular crystallography. Acta Crystallogr. D Struct. Biol. 2023;79:449–461. doi: 10.1107/S2059798323003595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Emsley P., Lohkamp B., Scott W.G., Cowtan K. Features and development of Coot. Acta Crystallogr. D Biol. Crystallogr. 2010;66:486–501. doi: 10.1107/S0907444910007493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Liebschner D., Afonine P.V., Baker M.L., Bunkóczi G., Chen V.B., Croll T.I., Hintze B., Hung L.W., Jain S., McCoy A.J., et al. Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in Phenix. Acta Crystallogr. D Struct. Biol. 2019;75:861–877. doi: 10.1107/s2059798319011471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Krissinel E., Henrick K. Inference of macromolecular assemblies from crystalline state. J. Mol. Biol. 2007;372:774–797. doi: 10.1016/j.jmb.2007.05.022. [DOI] [PubMed] [Google Scholar]
  • 101.McIntosh B.E., Brown M.E., Duffin B.M., Maufort J.P., Vereide D.T., Slukvin I.I., Thomson J.A. Nonirradiated NOD, B6.SCID Il2rγ-/- Kit(W41/W41) (NBSGW) mice support multilineage engraftment of human hematopoietic cells. Stem Cell Rep. 2015;4:171–180. doi: 10.1016/j.stemcr.2014.12.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Meyer L., López T., Espinosa R., Arias C.F., Vollmers C., DuBois R.M. A simplified workflow for monoclonal antibody sequencing. PLoS One. 2019;14 doi: 10.1371/journal.pone.0218717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Sashihara J., Burbelo P.D., Savoldo B., Pierson T.C., Cohen J.I. Human antibody titers to Epstein-Barr Virus (EBV) gp350 correlate with neutralization of infectivity better than antibody titers to EBV gp42 using a rapid flow cytometry-based EBV neutralization assay. Virology. 2009;391:249–256. doi: 10.1016/j.virol.2009.06.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 104.Traggiai E., Chicha L., Mazzucchelli L., Bronz L., Piffaretti J.C., Lanzavecchia A., Manz M.G. Development of a human adaptive immune system in cord blood cell-transplanted mice. Science. 2004;304:104–107. doi: 10.1126/science.1093933. [DOI] [PubMed] [Google Scholar]
  • 105.Saito Y., Ellegast J.M., Manz M.G. Generation of Humanized Mice for Analysis of Human Dendritic Cells. Methods Mol. Biol. 2016;1423:309–320. doi: 10.1007/978-1-4939-3606-9_22. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Document S1. Figures S1–S13 and Tables S1–S4
mmc1.pdf (2.7MB, pdf)
Document S2. Article plus supplemental information
mmc2.pdf (24.8MB, pdf)

Data Availability Statement

This paper does not report original code. X-ray coordinates and structure factors are deposited in the RCSB PDB under accession code PDB: 9PF9. Negative-staining EM maps are deposited in the EMDB with accession codes EMBD: EMD-71585 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-1.1 open conformation), EMBD: EMD-71586 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-2 Open conformation), EMBD: EMD-71587 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-1.1 partially open conformation), EMBD: EMD-71588 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and Fab ATX-42-2 closed conformation), EMBD: EMD-71589 (Negative stain EM map of EBV glycoprotein gH/gL in complex with glycoprotein gp42 and HLA-DR1 Beta chain), EMBD: EMD-71590 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-1 Fab and 72A1 Fab), EMBD: EMD-71592 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-2 Fab), EMBD: EMD-71593 (Negative stain EM map of EBV glycoprotein gp350 in complex with ATX-350-1 Fab), and EMBD: EMD-71594 (Negative stain EM map of EBV glycoprotein gp350 in complex with 72A1 Fab). The ATX-350 VH and VL sequences have been deposited in GenBank: PV837517, PV837527, PV837518 and PV837528. The ATX-42 VH and VL sequences have been deposited in GenBank: PV837519-PV837526, PV837529-PV837536. The naive ATX-GK IgM BCR raw sequences have been deposited in BioProject: PRJNA1347123Any additional information required to reanalyze the data reported in this paper is available from the lead contact upon request.


Articles from Cell Reports Medicine are provided here courtesy of Elsevier

RESOURCES