Skip to main content
NCBI home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2026 Feb 20;31(2):e70093. doi: 10.1111/gtc.70093

Senescence in Normal Human Dermal Fibroblasts Induces Heterogeneous Fibril Orientation of Type I Collagen Through Downregulation of BMP‐1

Koji Moriya 1, Yuki Shibaike 2, Katsura Sano 2, Toshiaki Tanaka 1,✉
PMCID: PMC12923988  PMID: 41721484

ABSTRACT

Considering that the body accumulates senescent fibroblasts during the progression of aging, the character of collagen fibrils secreted from the senescent cells associates with the skin condition. In this study, we examined the alteration of collagen fibrogenesis using groups of normal human dermal fibroblasts with different cumulative population doubling levels (PDLs). We found that the density of extracellular collagen fibrils in late PDLs was lower than that in early or middle PDLs, and their orientation was disturbed in late PDLs. Visualized type I procollagen imaging indicated that cells in late PDLs had a defect in the C‐terminal propeptide (C‐pp) cleavage of procollagen. Biochemical analyses confirmed decreases in intracellular C‐pp and extracellular collagen accompanied by PDL progression. Cells in late PDLs downregulated BMP‐1 and PCPE‐1, and BMP‐1 knockdown in cells of early PDLs decreased the amount of extracellular collagen and disturbed the fibril orientation. These fibrils contained more C‐pp than the control fibrils. Our results showed that cell senescence decreases C‐pp cleavage and secretion of type I collagen through downregulation of BMP‐1, resulting in the accumulation of extracellular procollagen and loss of fibril orientation.

Keywords: aging, BMP‐1, cell senescence, collagen, processing, procollagen

Senescent fibroblasts construct collagen fibrils, whose orientation is disturbed. We found that senescent fibroblasts downregulate C‐pp cleavage enzymes BMP‐1 and PCPE‐1, which results in downregulation of C‐pp cleavage. This was demonstrated by conducting BMP‐1 knockdown experiments in young fibroblasts, which led to a disturbance in the orientation of collagen fibrils containing C‐pp, similar to that observed in fibrils constructed by senescent fibroblasts. Our data indicate that cell senescence increases procollagen within fibrils, resulting in loss of their orientation.

graphic file with name GTC-31-0-g003.jpg

1. Introduction

Skin is the largest organ in the body and plays an important role as a physiological barrier against ultraviolet (UV) rays, environmental factors, and pathogens (Chambers and Vukmanovic‐Stejic 2020). The dermis of the skin is composed of several types of cells such as fibroblasts, vascular endothelial cells, adipocytes, and nerve cells. Fibroblasts secrete collagen, which is used to construct extracellular matrices (ECM) in the dermis. Type I collagen is a representative fibrillar collagen and accounts for more than 90% of all collagens in the body. With the progression of aging, the quality and quantity of type I collagen are decreased in the dermis, resulting in an increase in wrinkles, dried surfaces on the skin, and low moisture capacity (Eklouh‐Molinier et al. 2015). Thus, it is important to improve the production of type I collagen by fibroblasts in the aged dermis.

Type I collagen helps maintain moisture levels in the dermis of the skin because it contains water molecules (Bella et al. 1995; Zhang et al. 2011). In addition, the mechanical elasticity of the skin can be regulated by collagen fibrils (Silver et al. 2003). Type I collagen is generally composed of two α1 chains and one α2 chain: two pro‐α1 procollagen chains and one pro‐α2 procollagen assemble into a triple helical structure from C‐terminal propeptide (C‐pp) to N‐terminal propeptide (N‐pp) with a collagen chaperon, HSP47, in a fibroblast cell (Ito and Nagata 2019). After heterotrimerization of procollagen, C‐pp is cleaved by procollagen C‐proteinases (PCPs), including BMP‐1, mTLD, mTLL1/2, and this process is highly stimulated in the presence of another protein family, the procollagen C‐proteinase enhancers (Adar et al. 1986; Bourhis et al. 2013; Kessler et al. 1996; Li et al. 1996; Steiglitz et al. 2002; Takahara et al. 1994). It is generally accepted that this cleavage of C‐pp occurs extracellularly. BMP‐1 recognizes the amino acid sequence of type I collagen α1 chain [aa1218–aa1219] and cleaves the C‐pp from procollagen (Kessler et al. 1996; Li et al. 1996). The C‐pp cleavage step is essential for collagen fibril formation (Kadler et al. 1987; Miyahara et al. 1982). Recently, we developed a visualized type I procollagen. This construct can be cleaved at its N‐ and C‐propeptides, leading to the secretion of GFP‐tagged collagen from the cells. We confirmed its capacity to form collagen fibrils using immunoelectron microscopy (Tanaka et al. 2022). Our findings with this visualized type I procollagen showed that many propeptides of procollagen are cleaved intracellularly, and the cleaved N‐pp is transported along with the repeating structure domain, while the cleaved C‐pp is degraded in lysosomes (Tanaka et al. 2022). Notably, Stephens' group independently reported similar intracellular cleavages of propeptides through a biochemical approach (Stevenson et al. 2021).

The amount of type I collagen is decreased in the dermis along with the progression of aging. Additionally, the orientation of collagen fibrils becomes aberrant with aging (Eklouh‐Molinier et al. 2015; Imayama and Braverman 1989). Cell senescence is one of the aging hallmarks because the aged dermis accumulates senescent fibroblasts (Dimri et al. 1995; Ressler et al. 2006). Senescence of dermal fibroblasts appears to cause the decreasing amount of collagen in the aged dermis because the expression of type I collagen is downregulated in senescent fibroblasts and fibroblasts isolated from aged skin (Rittié and Fisher 2015). Senescent dermal fibroblasts were also reported to produce unstable and fragmented collagen protein (Escoffier et al. 1989; Fields 2013; Rittié and Fisher 2002; Van Doren 2015). However, it remains unclear how cell senescence affects extracellular fibril formation of type I collagen in the aged skin at the molecular level. In this study, we addressed this question using groups of normal human dermal fibroblasts (NHDFs), which have different population doubling levels (PDLs). We found that the progression of the PDL affects the C‐pp cleavage of procollagen with the visualized type I procollagen. Biochemical analyses showed that the defect of C‐pp cleavage is caused by the downregulation of BMP‐1, resulting in the construction of misoriented extracellular collagen fibrils.

2. Results

2.1. Cell Senescence Disoriented Order of Collagen Fibrils

To address how the senescence of fibroblast cells alters fibrogenesis of type I collagen, we prepared groups of normal human dermal fibroblasts with different PDLs. We prepared three groups of fibroblasts: early passages with 10–15 PDLs, middle passages with 21–26 PDLs, and late passages with 35–41 PDLs. Along with the progression of PDLs, these groups of cells showed a decreasing rate of cell proliferation, increasing expression of markers for cell senescence, namely p16 and p21, and upregulation of SA‐β‐gal staining (Figure S1). In addition, cells in late PDLs exhibited an enlarged and flattened cell shape (Figure S1). These cell characteristics distinguish the three groups of human fibroblasts with different PDLs.

Then, we examined how the PDL affects the construction of extracellular collagen fibrils. We cultured each group of fibroblasts for 1 month, and then stained collagen fibrils with Picro Sirius red. As shown in Figure 1A, early and middle PDLs formed a dense accumulation of fibrils with strong red color, whereas fibrils formed by late PDLs were rougher and exhibited attenuated red color. Magnified images help clarify the results; dense fibers were formed by early and middle PDLs, and rough fibers were formed by late PDLs (lower panels in Figure 1A). These results suggested that the amount of extracellular collagen fibril was decreased as PDLs progressed.

FIGURE 1.

FIGURE 1

Open in a new tab

Characterization of cell populations with different PDLs. (A) Extracellular collagen fibrils stained with Picro Sirius red after 1 month of culture. The upper panels show images of the whole dish. Bar: 1 cm. Each magnified image obtained by microscopy is shown in the lower panel. Bar: 100 μm. (B) Extracellular collagen fibril immunolabeled using the anti‐COL1A1 antibody without the permeability step after 1 week of culture. Nuclei were stained using Hoechst33342. Bar; 50 μm. (C) The 2D‐FFT power spectrum of the images in (B). (D) TEM images of extracellular collagen fibrils constructed by early and late PDL cells after 1 month of culture. Bar: 1 μm.

To obtain detailed information on extracellular collagen fibrils formed by each group of cells, we performed immunostaining analyses using the anti‐COL1A1 antibody without permeabilization of the cells (Tanaka et al. 2022). Fibrogenesis is regulated by parameters such as collagen concentration, pH, and ionic strength (Gobeaux et al. 2008) and not all secreted materials such as collagen are incorporated into the matrix fibrils. Therefore, the experiment required direct detection of collagen and procollagen incorporated into the ECM rather than those secreted into the medium. The detailed analyses supported the result obtained by Picro Sirius red staining and indicated that each fibril formed by early PDLs tends to be oriented in the same direction; however, each fibril formed by late PDLs does not (Figure 1B). We confirmed this result by examining the 2‐dimensional fast Fourier transform (2D‐FFT) power spectrum of the collagen fibril images in Figure 1B, with which periodicity and directionality in an image is visualized (Figure 1C). Because the bright spot reflects the direction of a cyclical pattern in the original image, Figure 1B shows that the direction of fibrils formed by early PDLs has an obliquely repeating pattern; however, that formed by late PDLs is dispersed randomly. Transmission electron microscopy (TEM) analyses also revealed that the thickness and orientation of extracellular collagen fibrils were more heterogeneous in the late PDL group than in the early PDL group (Figure 1D). These results suggested that cell senescence affects how secreted collagen forms fibrils.

2.2. Analyses With Visualized Type I Procollagen Indicated a Defect of C‐pp Processing in Late PDLs

We previously published a visualized type I procollagen, in which the GFP‐tag is inserted into the repeating structure domain and the mCherry‐tag is inserted into C‐pp (Tanaka et al. 2022). The visualized type I procollagen, which was designated as Gr‐CC (GFP in the repeating structure domain and mCherry in C‐pp), forms trimers and is processed as endogenous procollagen. The GFP‐tagged collagen proteins also form fibrils with D‐staggers outside of the cells. This construct not only enables tracking of the repeating structure domain and C‐pp, but also the detection of procollagen cleavage by alteration of the fluorescence (Tanaka et al. 2022). The expression vector coding Gr‐CC was transfected into each group of cells, and fluorescent signals were detected using a confocal microscope (Figure 2A). Early PDLs showed yellow particles at the perinuclear region owing to the green color of GFP merging with the red color of mCherry, and green particles at the pseudopodia. However, late PDLs showed a uniformly yellow color in the whole cell, including the pseudopodia. To confirm this result, the GFP and mCherry signals within the pseudopodia of each cell were measured from three independent locations in the images, and the ratios of their mean values were compared between early and late PDLs (Figure 2B). Because an increase in the ratio represents an increased presence of procollagen, which has both the repeating structure domain (GFP) and C‐pp (mCherry), this analysis revealed a defect in C‐pp cleavage in late PDLs.

FIGURE 2.

FIGURE 2

Open in a new tab

Secretion of procollagen detected with visualized type I procollagen. (A) Early and late PDL cells were transfected with the visualized type I procollagen (Gr‐CC) expression vector and cultured for 48 h. GFP and mCherry images were obtained by confocal microscopy. Bar: 20 μm. The left panels show low magnification images of representative pseudopodia of each cell, and the right panels show the corresponding high magnification images. Each whole cell shape is consistent with Figure S1C. (B) The signal intensities of GFP and mCherry within the pseudopodia of early and late PDL cells were measured at three independent locations in the images, and the ratio of their mean values (mCherry/GFP) is shown. Data are the means ± S.D. (n = 3). *p < 0.01.

2.3. Endogenous C‐pp Cleavage Was Downregulated in Late PDLs, Resulting in the Formation of Fibrils, Including Procollagen

Considering that C‐pp cleavage is an essential step for fibril formation of collagen (Kadler et al. 1987), we examined biochemical aspects of endogenous C‐pp cleavage in the three cell groups by western blotting using an anti‐C‐pp antibody. The results indicated a decrease in the C‐pp fragment, which is a product of intracellular cleavage of endogenous procollagen, as the PDL progressed, whereas the amount of procollagen was not significantly altered (Figure 3A–C), showing that C‐pp cleavage was downregulated with the progression of cell passages. We next examined collagen secreted into each cell culture medium by western blotting and found a decrease in secreted collagen of late PDLs, and the amount of secreted procollagen also decreased (Figure 4A,B). The ratio of collagen to procollagen indicated that early and middle PDLs secreted almost equal amounts of collagen and procollagen; however, late PDLs predominantly secreted procollagen (Figure 4C). Because both collagen and procollagen were secreted into the media, we addressed whether procollagen is also included in the fibrils. Immunofluorescent analysis using the anti‐C‐pp antibody showed that C‐pp signals were faint in the fibrils constructed by early PDLs, although many C‐pp signals were detected in the fibrils of late PDLs (Figure 4D), indicating that cells in late PDLs construct collagen fibrils containing procollagen.

FIGURE 3.

FIGURE 3

Open in a new tab

Comparison of intracellular procollagen/collagen among cell populations with different PDLs. (A) Western blot of cell lysate of early, middle, and late PDL cells detected using anti‐C‐pp antibody. Cropped blotting data are displayed, and original data are shown in Figure S1. (B and C) Quantification of Pro‐α1 (I) (B) and C‐pp (C). The signal intensities of Pro‐α1 (I) and C‐pp were normalized with those of α‐tubulin. The values of early PDL cells are defined as 100%. Data are the means ± S.D. (n = 3). *p < 0.05, **p < 0.01.

FIGURE 4.

FIGURE 4

Open in a new tab

Comparison of extracellular procollagen/collagen among cell populations with different PDLs. (A) Western blotting analysis of culture medium using anti‐COL1A1 antibody. Upper bands show Pro‐α1 (I) and lower bands show α1 (I). Cropped blotting data are displayed, and original data are shown in Figure S6. (B and C) Quantification of Pro‐α1 (I) and α1 (I) in the culture medium. The values of early PDL cells are defined as 100%. (B) α1 (I), (C) the ratio of α1 (I)/Pro‐α1 (I). Data are shown as means ± S.D. (n = 3) *p < 0.05, **p < 0.01. (D) Detection of extracellular procollagen by immunofluorescent staining with the anti‐C‐pp antibody. Arrowheads indicate major C‐pp signals. Nuclei were stained using Hoechst33342. Bar: 50 μm.

2.4. The Intracellular BMP‐1 and PCPE‐1 Were Downregulated Along With Cell Senescence

Next, to elucidate the underlying mechanism of decreased C‐pp cleavage in late PDLs, we examined expression levels of PCPs, namely BMP‐1, mTLD, and mTLL1/2, which can process C‐pp in procollagen (Kessler 2013). qPCR analysis showed that TLL1 was not changed, but BMP‐1 was significantly downregulated in late PDLs (Figure 5A and Figure S2). We examined its protein by western blotting, showing that the amount of BMP‐1 also decreased in late PDLs (Figure 5B,C). Because C‐pp cleavage by BMP‐1 is highly stimulated in the presence of the protein, we also examined PCPE‐1. We found that PCPE‐1 was significantly downregulated in late PDLs (Figure 5D). PCPE‐1 is processed to be a mature protein (36 kDa), and both the precursor (55 kDa) and mature proteins accelerate C‐pp processing by BMP‐1 (Lagoutte et al. 2021). Using western blotting analyses, we found that both proteins were downregulated as PDLs progressed (Figure 5E,F). Therefore, we considered BMP‐1 to be a key factor in the downregulation of C‐pp processing in late PDLs. An in vitro BMP‐1 activity assay (Bijakowski et al. 2012) supported a decrease in its activity as PDLs progressed (Figure S3). These results suggested that the downregulation of BMP‐1 activity, which was induced by the decreasing expression of BMP‐1 or BMP‐1/PCPE‐1, caused a decrease in C‐pp processing in late PDLs.

FIGURE 5.

FIGURE 5

Open in a new tab

The alteration of C‐pp cleavage activity by cell senescence. (A) Relative gene expression level of BMP‐1. (B) Western blot analysis of cell lysates using the anti‐BMP‐1 antibody. (C) The signal intensities of BMP‐1 and α‐tubulin in (B) were quantified using ImageJ. The intensities of BMP‐1 were normalized with those of α‐tubulin. The values of early PDL cells are defined as 100%. (D) Relative gene expression level of PCPE‐1(PCOLCE). (E) Intracellular precursor and mature PCPE‐1 were detected using the anti‐PCPE‐1 antibody. (F) Western blot analysis of cell lysates using the anti‐PCPE‐1 antibody. The precursor form (*) was 55 kDa and mature form (**) was 36 kDa. The signal intensities of the precursor and mature PCPE‐1 and α‐tubulin in (E) were quantified using ImageJ. Total PCPE‐1 was calculated using the following formula: Precursor + mature PCPE‐1/α‐tubulin. Data are the means ± S.D. (n = 3), *p < 0.05, **p < 0.01. (B and E) Cropped blotting data are displayed, and original data are shown in Figures S7 and S8, respectively.

2.5. BMP‐1 Knockdown in Early PDLs Caused the Production of Collagen Fibrils That Are Similar to Those Produced in Late PDLs

To investigate the cause of the heterogeneous orientation of extracellular fibrils in late PDLs, we performed a knockdown experiment of BMP‐1 in cells of early PDLs. We confirmed no morphological alteration and no difference in cell number between cells with siBMP‐1 and control siRNA (siControl, Figure S4). Biochemical analyses showed that mRNA and protein of BMP‐1 were significantly decreased by siBMP‐1 treatment in cells of early PDLs (Figure 6A,B and Figure S4). However, since PCPE‐1 remained, which activates BMP‐1, it could not be ruled out that residual BMP‐1 was activated due to trace amounts of BMP‐1 with PCPE‐1. We therefore performed an in vitro assay to measure BMP‐1 activity, using cell lysates of early PDLs treated with siBMP‐1. This confirmed a significant reduction in BMP‐1 activity following siBMP‐1 treatment (Figure 6C). We found that cleaved C‐pp was significantly decreased in the cells of early PDLs treated with siBMP‐1, reflecting the decrease in BMP‐1 activity with siBMP‐1 treatment (Figure 6D,E). We confirmed that the amount of secreted collagen decreased after the siBMP‐1 treatment in early PDLs cells (Figure 6F). We measured the signal intensities of collagen and procollagen in the western blot analyses and calculated the ratio of collagen to procollagen (Figure 6G). This result indicated that cells with siControl secrete similar amounts of collagen and procollagen, whereas cells with siBMP‐1 predominantly secrete procollagen. These results showed that BMP‐1 knockdown caused suppression of C‐pp processing in early PDLs.

FIGURE 6.

FIGURE 6

Open in a new tab

BMP‐1 knockdown blocked the intracellular C‐pp cleavage. siRNA was treated with each PDL cell group every 3 days for 1 week, then analyzed by biochemical analysis. (A) Relative gene expression level of BMP‐1. (B) Western blot analysis of cell lysates using the anti‐BMP‐1 antibody. (C) Intracellular BMP‐1 activity. (D) Western blot of cell lysate using the anti‐C‐pp antibody. (E) Quantification of C‐pp signal intensities for (D) normalized by those of α‐tubulin. The values of siControl‐treated groups are defined as 100%. Data are the means ± S.D. (n = 3), p < 0.01. (F) Secreted collagen α1 and procollagen α1 were immunodetected using the anti‐COL1A1 antibody. Upper bands show Pro‐α1 (I) and lower bands show α1 (I). (G) Quantification of secreted Pro‐α1 (I) and α1 (I) in (F). The values of siControl‐treated groups are defined as 100%. Data are the means ± S.D. (n = 3), p < 0.05. (B, D, and F) Cropped blotting data are displayed, and original data are shown in Figures S9–S11, respectively.

To examine extracellular collagen fibrils formed by the cells of early PDLs treated with siBMP‐1, we performed immunostaining analyses using the anti‐COL1A1 antibody. Cells of early PDLs treated with siControl formed highly oriented fibrils; however, siBMP‐1 treatment disorganized the orientation of collagen fibrils (Figure 7A). We confirmed this result by examining the 2D‐FFT power spectrum of collagen fibril images showing that the direction of fibrils formed by cells of early PDLs treated with siControl has an obliquely repeating pattern, whereas that formed by cells of early PDLs treated with siBMP‐1 is dispersed randomly (Figure 7B). Immunofluorescent analysis using the anti‐C‐pp antibody without permeabilization revealed that C‐pp signals increased in early PDLs treated with siBMP‐1 (Figure 7C). Therefore, a decrease in C‐pp processing by the downregulation of BMP‐1 resulted in the formation of collagen fibrils including procollagen, whose orientations are disturbed.

FIGURE 7.

FIGURE 7

Open in a new tab

BMP‐1 knockdown disturbed the formation and orientation of extracellular collagen fibril. siRNA was treated with each PDL cell group every 3 days for 1 week, then extracellular collagen fibrils were detected by α‐COL1A1 and C‐pp antibody. (A) Extracellular collagen fibril of siControl and siBMP‐1 treated cells immunolabeled using the anti‐COL1A1 antibody without the permeability step after 1 week of culture. Bar: 50 μm. Nuclei were stained using Hoechst33342. (B) The 2D‐FFT power spectrum of the images in (A). (C) Extracellular procollagen α1 was immunodetected using the anti‐C‐pp antibody. Nuclei were stained using Hoechst33342. Bar: 50 μm.

3. Discussion

C‐pp processing is an essential step for the fibril formation of collagen in the extracellular space (Hulmes 2019; Kadler et al. 2007). Our data first shed light on alterations in the C‐pp processing of type I collagen and PCPs with the progression of fibroblast cell senescence. The visualized type I procollagen first showed a decrease in intracellular C‐pp cleavage of procollagen in the cells of late PDLs (Figure 2A,B). Biochemical analyses confirmed that C‐pp cleavage was decreased in late PDLs (Figure 3A–C) through the downregulation of intracellular BMP‐1 and PCPE‐1 (Figure 5). The cells of late PDLs eventually secreted more procollagen than collagen into the extracellular space (Figure 4A–C), resulting in the heterogeneous orientation of collagen fibrils that contain more procollagen than fibrils formed with cells in early PDLs (Figures 4D and 8).

FIGURE 8.

FIGURE 8

Open in a new tab

Scheme of type I procollagen processing, secretion, and fibril formation induced by cellular senescence.

The removal of C‐pp from procollagen decreases the critical concentration for fibril formation (Canty and Kadler 2005), and thus C‐pp processing is essential for fibril formation (Kadler et al. 1987; Miyahara et al. 1982). However, procollagen is able to form stable fibers together with collagen in the extracellular spaces, because type I procollagen α1 with mutations at C‐propeptide, in which C‐pp cleavage is defective, is able to form fibrils with a normal D‐period banding pattern (Barnes et al. 2019). Also, procollagen can construct functional fibrils by itself, because the embryonic skin of Bmp1 −/−/Tll −/− double knockout mouse, which cannot cleave C‐pp of procollagen, constructs fibrils with “barbed‐wire”‐like collagen (Pappano et al. 2003), and this phenomenon seems to be supported by previous reports, in which procollagen constructs filamentous bundles of aggregates called “segment‐long‐spacing (SLS)‐like aggregates” (Bruns et al. 1979; Hulmes et al. 1983). Because a high concentration of procollagen was shown to form SLS‐like aggregates (Hulmes et al. 1983), the disorganized orientation of collagen fibrils formed with cells in late PDLs may appear depending on the local accumulation of procollagen (Figure 4C). In early PDLs, secreted collagen preferentially forms proper fibrils in a self‐assembly process, and thus procollagen, for which the amount is sufficiently low, is difficult to incorporate into the fibrils; however, in the late PDLs, the increasing ratio of procollagen to collagen may cause more frequent incorporation of procollagen into the fibrils, resulting in the disturbed fibril orientation (Figures 4C and 8).

We showed that the amount of C‐pp decreased along with the PDL progression (Figure 3A,C), consistent with the alteration in the biosynthetic process of collagen in the cell. We also found a decrease of BMP‐1 and PCPE‐1 with the progression of PDLs (Figure 5A–F and Figure S3). PCPE‐1 recognizes the processing site of type I procollagen and then recruits BMP‐1 to the site (Bourhis et al. 2013). Pcolce‐1 (encoding the PCPE‐1) deficient mice were normally developed, and Pcolce‐1 deficient MEF did not contain uncleaved C‐pp (Sansilvestri‐Morel et al. 2021; Steiglitz et al. 2006). Thus, PCPE‐1 plays an enhancer role in PCP activities. Because PCPE‐1 accelerates C‐pp processing through BMP‐1 (Bourhis et al. 2013), the activity of BMP‐1 mainly appeared to affect the C‐pp processing step. BMP‐1 recognizes the amino acid sequence of the type I collagen α1 chain [aa1218–aa1219] and directly cleaves C‐pp in procollagen (Kessler et al. 1996; Li et al. 1996). BMP‐1 deficiency leads to the perinatal lethal and abnormal extracellular collagen fibril formation in mouse embryonic fibroblasts (Suzuki et al. 1996). Additionally, Bmp‐1 null embryos produced abnormal “barbed” collagen fibrils (Suzuki et al. 1996). Therefore, we performed a knockdown experiment of BMP‐1 in early passages, which resulted in disorganized orientation of collagen fibrils (Figure 7A,B). Cell numbers and density did not affect the orientation of collagen fibrils as shown in Figure S4. Figure 6D shows that BMP‐1 knockdown decreased the amount of procollagen. This phenomenon appears to align with the activation of protein quality control in the ER because of an increasing defect in the C‐pp processing of procollagen. However, this experiment showed that the procollagen secreted to the extracellular space was included in the fibrils (Figure 7C), similar to the fibrils obtained in late PDLs (Figure 4D). The amounts of extracellular collagen fibril were not decreased (Figure 7A), showing that the disorganized fibril orientation in late PDLs is not caused by low fiber concentrations. Rather, our data indicated that the incorporation of procollagen causes disorganized fibril orientation in late PDLs. Moreover, we note that BMP‐1 knockdown decreased intracellular C‐pp cleavage (Figure 6E). Previous reports showed that BMP‐1 acts as an extracellular cleavage enzyme for several matrices, including type I collagen (Amano et al. 2000; N'Diaye et al. 2021); however, our data suggested that BMP‐1 acts as its intracellular cleavage enzyme. According to the mouse aging proteomic atlas, it is worth noting that PCOLCE1 is downregulated in many tissues, including the skin of an aged mouse, and BMP‐1 tends to decrease with aging in mRNA (Takasugi et al. 2024). These data would imply that our current findings reflect in vivo events during aging.

Other mechanisms may also explain how decrease of BMP‐1 in late PDL disturbs the orientation of collagen fibrils. BMP‐1 was reported to play a role in the maturation of small leucine‐rich proteoglycans (SLRPs), such as decorin and biglycan through their cleavages (Scott et al. 2000; von Marschall and Fisher 2010). Because SLRPs regulate the fibrillogenesis of collagen by direct interaction with collagen monomers (Ge et al. 2004), decreased activity of BMP‐1 in late PDLs may induce immaturation of SLRPs, thus disturbing the orientation of extracellular collagen fibrils. Furthermore, BMP‐1 acts as an activator for lysyl oxidase (LOX) and lysyl oxidase‐like protein (LOXL) (Maruhashi et al. 2010; Rosell‐Garcia and Rodriguez‐Pascual 2018; Uzel et al. 2001). Active forms of these enzymes have a role in the final step of the collagen fibril formation, especially cross‐linking in the extracellular region. Therefore, decreased activity of BMP‐1 in late PDLs may affect the final step of collagen fibril formation. Moreover, other PCPs may affect the abnormal fibril formation of collagen in late PDL. Bmp‐1/mTld double null MEF lacks the activity of C‐pp cleavage and constructs abnormal collagen fibrils (Pappano et al. 2003), and Bmp‐1/mTld double null embryos produce the abnormal “barbed” collagen fibril, whereas Tll1 (another C‐pp cleavage enzyme) null embryos produce the normal collagen fibrils (Clark et al. 1999). Effects of enzymes other than BMP‐1 on disorganized orientation of collagen fibrils in late PDLs still need to be studied. Our data in this paper suggested a link between the alteration of collagen fibril associated with cell senescence to that associated with individual aging. C‐pp cleavage enzymes, such as BMP‐1, are potential targets for improving the alteration of collagen fibril associated with aging.

4. Experimental Procedures

4.1. Cell Culture and Transfection

Normal human dermal fibroblast cells (Chinese, male, Age 17, back skin) were purchased from Cell Research Corporation. Cells were grown in α‐MEM (Invitrogen, Carlsbad, CA, USA) containing 10% heating inactivated fetal bovine serum at 37°C in a humidified incubator with 5% CO2. 250 μM of sodium ascorbate or its stabilized form, AA2G, was supplied as required; however, the culture medium included a sufficient amount of ascorbate to facilitate collagen biosynthesis in our experimental conditions. To prepare the several cell senescent stages, the cells were continuously sub‐cultured, and the numbers of the PDLs were counted. In this study, the stages of cell senescence were defined as follows: early = PDL10–14, middle = PDL21–26, late = PDL35–41. Cell proliferation was evaluated every other day by cell counting. Each cell senescent cell was seeded at a density of 2.0 × 105 cells/well in six‐well plates for 24 h. Then, the cells were transfected with a visualized type I procollagen vector using TransfeX (ATCC, USA). siRNA was purchased from Integrated DNA Technologies. siRNA transfection was performed using Lipofectamine RNAiMAX transfection reagents (Thermo Fisher Scientific, Waltham, MA, USA).

4.2. Preparation of Cell Extracts and Immunoblotting

The extracts of cells were prepared with RIPA buffer as previously described (Shirako et al. 2008). Equal amounts of protein in the precleared cell extracts (6–50 μg of total protein) were separated by 10% or 12% SDS–PAGE after heat denaturation. Immunoblotting was performed following standard procedures as previously described (Li et al. 2013). The following antibodies were used for immunoblotting: anti‐p16 (JC8 clone), anti‐p21 (F‐5 clone), anti‐PCPE‐1 (10D9 clone) (Santa Cruz), anti‐ColI (Boster Bio), anti‐C‐pp (LF‐42 clone), anti‐COL1A1 (LF‐68 clone) (Kerafast), anti‐BMP‐1 antibody (R&D systems), and anti‐α‐tubulin (Proteintech).

4.3. Total RNA Extraction and Quantitative Real‐Time Polymerase Chain Reaction (qPCR)

Total RNA was prepared from each cell as previously described (Ushio et al. 2009). Complementary DNAs (cDNAs) were synthesized from total RNA using the ReverTra Ace qPCR Master Mix (TOYOBO) or PrimeScript RT Reagent Kit (TaKaRa Bio Inc.). The gene expression levels were analyzed using a Thermal Cycler Dice Real Time System (Takara) or a LightCycler 96 System (Roche). 18S ribosomal RNA was used as an internal control. Relative gene expression levels were calculated using the ΔΔCt method. The primer sequences are as follows: bone morphogenetic protein‐1 (BMP‐1) (F: 5′‐ccagtcctttgagattgagc‐3′, R: 5′‐tcatcaggcttctcatagcc‐3′), procollagen C‐endopeptidase enhancer‐1 (PCPE‐1) (F: 5′‐taaaactggaggactggacc‐3′, R: 5′‐tgactcctttcttcatgggg‐3′), tolloid like 1 (TLL1) (F: 5′‐cataccacaggtggacttgg‐3′, R: 5′‐tccgttcttgatgtagcggc‐3′), 18S ribosomal RNA (18S rRNA) (F: 5′‐cggacaggattgacagattgatagc‐3′, R: 5′‐tgccagagtctcgttcgttatcg‐3′).

4.4. Senescence‐Associated‐β‐Galactosidase (SA‐β‐Gal) Statin

Cells were washed with phosphate‐buffered saline (PBS) and fixed with 2% formaldehyde/0.2% glutaraldehyde/PBS for 15 min at room temperature. The fixed cells were incubated with SA‐β‐gal solution (1 mg/mL 5‐bromo‐4‐chloro‐3‐indolyl‐h‐D‐galactoside/40 mM citric acid‐phosphate buffer (pH 6.0)/150 mM NaCl/2 mM MgCl2/5 mM potassium hexacyanoferrate (III)/5 mM potassium hexacyanoferrate (II)) for 16 h, then washed using distilled water.

4.5. Picro Sirius Red Stain

Picro Sirius Red Stain Kit was purchased from Scy Tek Laboratories Inc. (Utah, U.S.A.).

Cells were washed with PBS and fixed with 4% paraformaldehyde (PFA)/PBS for 10 min at room temperature. The fixed cells were stained with Picro Sirius Red Stain Kit, according to the manufacturer's instructions.

4.6. Immunofluorescent Analysis

Cells were washed with PBS three times and fixed with 4% PFA/PBS for 10 min at room temperature without the permeabilization step. The following antibodies were used for immunofluorescence: rabbit polyclonal anti‐C‐telopeptide antibody, and rabbit polyclonal anti‐C‐propeptide antibody (Kerafast). The nucleus was stained using 1 μg/mL of Hoechst33342 in the incubation of the second antibody.

4.7. Transmission Electron Microscopy (TEM) Analysis

After 1 month of culture, the cells were washed with PBS and fixed with 2% formaldehyde/0.2% glutaraldehyde/PBS for 15 min at room temperature. The extracellular collagen fibril structures were observed by TEM as previously described (Tanaka et al. 2022).

4.8. 2D‐Fast Fourier Transform (2D‐FFT) Spectrum Analysis

The fluorescent images obtained by LSM780 confocal microscopy were converted to 8‐bit grayscale images using ImageJ software (ver. 1.53e). The grayscale images were transformed to provide the 2D‐FFT spectrum. The wave amplitude component in the FFT of immunofluorescent images exhibits the frequency of spacing among collagen fibrils.

4.9. Type I Procollagen C‐Propeptide Cleavage Activity Assay

Activities of C‐pp cleavage in whole cell lysate were measured by quantifying the intensities of fluorescent substrate Mca‐YVADAPK(Dnp)‐OH (R&D systems). Cells were washed with PBS three times and lysed (25 mM HEPES/0.1% Briji, pH 7.5). Then, the cell lysate was centrifuged at 15,000 rpm for 10 min at 4°C. The supernatants were collected in a microtube, and total proteins were estimated by BCA assay (Pierce BCA, Thermo Fisher, USA). Next, 5 μg of total proteins or several concentrations of standard BMP‐1 proteins were transferred to 96‐well black assay plates, and the fluorescent intensity was read using an EnSpire multiplate reader (Perkin Elmer).

4.10. Imaging Acquisition by Confocal Laser Microscopy

Images were obtained using a Zeiss 780 laser confocal scanning microscope (Carl Zeiss) with 20×/0.8 and 63×/1.4 NA objective lenses. All fluorescent probes were excited using 405 and 561 nm lasers. The amounts of GFP and mCherry signals were quantified using the ImageJ software.

4.11. Statistics

Experimental data were analyzed by a two‐way analysis of variance followed by Tukey–Kramer's test for multiple groups and expressed as means ± standard deviation (S.D.). Differences were considered significant for p < 0.05.

4.12. Equipment and Settings

The immunoblotting images were detected using the ImageQuant LAS 4000 mini chemiluminescence detection system (GE Healthcare). Multiple pictures were taken in manual mode with different exposure times for each shot, and appropriate pictures that were not overexposed were selected. Where necessary, adjustments to brightness and contrast were applied equally across the entire image and to the controls using the linear algorithm in Adobe Photoshop Elements software. The signal intensities on the blots were quantitated by ImageJ software.

Author Contributions

Conceptualization: T.T. and K.M. Data curation: T.T. Formal analysis: K.M. Funding acquisition: T.T. and K.M. Investigation: K.M. and Y.S. Methodology: T.T. and K.M. Project administration: T.T. and K.S. Supervision: T.T. Validation: all authors. Visualization: K.M. and T.T. Writing – original draft preparation: K.M. and T.T. Writing – review and editing: T.T. All authors reviewed the manuscript and approved it to be submitted.

Funding

This study was funded by AMED under Grants JP21lm0203004, JP22ym0126806, JP24ym0126813, and JP25ym0126819 (T.T.), JSPS KAKENHI (Grant 21K18051; K.M.), and JSPS KAKENHI (Grants 18K06013, 23K05749, and 23H02987; T.T.).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Data S1: gtc70093‐sup‐0001‐Supinfo.docx.

GTC-31-0-s001.docx (3.4MB, docx)

Acknowledgments

We thank Ms. Kyoko Dodo and Mr. Mamoru Sugihara in ALBION Co. Ltd. for technical support. This study was technically supported by the Open Research Facilities for Life Science and Technology, Biomaterials Analysis Division in the Open Facility Center, Tokyo Institute of Technology, and the NIMS Molecule & Material Synthesis Platform in the “Nanotechnology Platform Project” operated by the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (No. JPMXP09 S20NM0013).

Moriya, K. , Shibaike Y., Sano K., and Tanaka T.. 2026. “Senescence in Normal Human Dermal Fibroblasts Induces Heterogeneous Fibril Orientation of Type I Collagen Through Downregulation of BMP‐1.” Genes to Cells 31, no. 2: e70093. 10.1111/gtc.70093.

Transmitting Editor: Hiroshi Kimura

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supporting Information files.

References

  1. Adar, R. , Kessler E., and Goldberg B.. 1986. “Evidence for a Protein That Enhances the Activity of Type I Procollagen C‐Proteinase.” Collagen and Related Research 6: 267–277. [DOI] [PubMed] [Google Scholar]
  2. Amano, S. , Scott I. C., Takahara K., et al. 2000. “Bone Morphogenetic Protein 1 Is an Extracellular Processing Enzyme of the Laminin 5 Gamma 2 Chain.” Journal of Biological Chemistry 275: 22728–22735. [DOI] [PubMed] [Google Scholar]
  3. Barnes, M. A. , Ashok A., Makareeva E. N., et al. 2019. “ COL1A1 C‐Propeptide Mutations Cause ER Mislocalization of Procollagen and Impair C‐Terminal Procollagen Processing.” Biochimica et Biophysica Acta 1865: 2210–2223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bella, J. , Brodsky B., and Berman H. M.. 1995. “Hydration Structure of a Collagen Peptide.” Structure 3: 893–906. [DOI] [PubMed] [Google Scholar]
  5. Bijakowski, C. , Vadon‐le Goff S., Delolme F., et al. 2012. “Sizzled Is Unique Among Secreted Frizzled‐Related Proteins for Its Ability to Specifically Inhibit Bone Morphogenetic Protein‐1 (BMP‐1)/Tolloid‐Like Proteinases.” Journal of Biological Chemistry 287: 33581–33593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bourhis, J.‐M. , Vadon‐le Goff S., Afrache H., et al. 2013. “Procollagen C‐Proteinase Enhancer Grasps the Stalk of the C‐Propeptide Trimer to Boost Collagen Precursor Maturation.” Proceedings of the National Academy of Sciences 110: 6394–6399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bruns, R. R. , Hulmes D. J., Therrien S. F., and Gross J.. 1979. “Procollagen Segment‐Long‐Spacing Crystallites: Their Role in Collagen Fibrillogenesis.” Proceedings of the National Academy of Sciences 76: 313–317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Canty, E. G. , and Kadler K. E.. 2005. “Procollagen Trafficking, Processing and Fibrillogenesis.” Journal of Cell Science 118: 1341–1353. [DOI] [PubMed] [Google Scholar]
  9. Chambers, E. S. , and Vukmanovic‐Stejic M.. 2020. “Skin Barrier Immunity and Ageing.” Immunology 160: 116–125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Clark, T. G. , Conway S. J., Scott I. C., et al. 1999. “The Mammalian Tolloid‐Like 1 Gene, Tll1, Is Necessary for Normal Septation and Positioning of the Heart.” Development 126: 2631–2642. [DOI] [PubMed] [Google Scholar]
  11. Dimri, G. P. , Lee X., Basile G., et al. 1995. “A Biomarker That Identifies Senescent Human Cells in Culture and in Aging Skin In Vivo.” Proceedings of the National Academy of Sciences 92: 9363–9367. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Eklouh‐Molinier, C. , Happillon T., Bouland N., et al. 2015. “Investigating the Relationship Between Changes in Collagen Fiber Orientation During Skin Aging and Collagen/Water Interactions by Polarized‐FTIR Microimaging.” Analyst 140: 6260–6268. [DOI] [PubMed] [Google Scholar]
  13. Escoffier, C. , de Rigal J., Rochefort A., Vasselet R., Lévêque J. L., and Agache P. G.. 1989. “Age‐Related Mechanical Properties of Human Skin: An In Vivo Study.” Journal of Investigative Dermatology 93: 353–357. [PubMed] [Google Scholar]
  14. Fields, G. B. 2013. “Interstitial Collagen Catabolism.” Journal of Biological Chemistry 288: 8785–8793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ge, G. , Seo N. S., Liang X., Hopkins D. R., Höök M., and Greenspan D. S.. 2004. “Bone Morphogenetic Protein‐1/Tolloid‐Related Metalloproteinases Process Osteoglycin and Enhance Its Ability to Regulate Collagen Fibrillogenesis.” Journal of Biological Chemistry 279: 41626–41633. [DOI] [PubMed] [Google Scholar]
  16. Gobeaux, F. , Mosser G., Anglo A., et al. 2008. “Fibrillogenesis in Dense Collagen Solutions: A Physicochemical Study.” Journal of Molecular Biology 376: 1509–1522. [DOI] [PubMed] [Google Scholar]
  17. Hulmes, D. J. , Bruns R. R., and Gross J.. 1983. “On the State of Aggregation of Newly Secreted Procollagen.” Proceedings of the National Academy of Sciences 80: 388–392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hulmes, D. J. S. 2019. “Roles of the Procollagen C‐Propeptides in Health and Disease.” Essays in Biochemistry 63: 313–323. [DOI] [PubMed] [Google Scholar]
  19. Imayama, S. , and Braverman I. M.. 1989. “A Hypothetical Explanation for the Aging of Skin. Chronologic Alteration of the Three‐Dimensional Arrangement of Collagen and Elastic Fibers in Connective Tissue.” American Journal of Pathology 134: 1019–1025. [PMC free article] [PubMed] [Google Scholar]
  20. Ito, S. , and Nagata K.. 2019. “Roles of the Endoplasmic Reticulum‐Resident, Collagen‐Specific Molecular Chaperone Hsp47 in Vertebrate Cells and Human Disease.” Journal of Biological Chemistry 294: 2133–2141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kadler, K. E. , Baldock C., Bella J., and Boot‐Handford R. P.. 2007. “Collagens at a Glance.” Journal of Cell Science 120: 1955–1958. [DOI] [PubMed] [Google Scholar]
  22. Kadler, K. E. , Hojima Y., and Prockop D. J.. 1987. “Assembly of Collagen Fibrils De Novo by Cleavage of the Type I pC‐Collagen With Procollagen C‐Proteinase. Assay of Critical Concentration Demonstrates That Collagen Self‐Assembly Is a Classical Example of an Entropy‐Driven Process.” Journal of Biological Chemistry 262: 15696–15701. [PubMed] [Google Scholar]
  23. Kessler, E. 2013. “Procollagen C‐Endopeptidase.” In Handbook of Proteolytic Enzymes, edited by Kessler E., 916–932. Elsevier. [Google Scholar]
  24. Kessler, E. , Takahara K., Biniaminov L., Brusel M., and Greenspan D. S.. 1996. “Bone Morphogenetic Protein‐1: The Type I Procollagen C‐Proteinase.” Science 271: 360–362. [DOI] [PubMed] [Google Scholar]
  25. Lagoutte, P. , Bettler E., Vadon‐Le Goff S., and Moali C.. 2021. “Procollagen C‐Proteinase Enhancer‐1 (PCPE‐1), a Potential Biomarker and Therapeutic Target for Fibrosis.” Matrix Biology Plus 11: 100062. 10.1016/j.mbplus.2021.100062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li, S. W. , Sieron A. L., Fertala A., Hojima Y., Arnold W. V., and Prockop D. J.. 1996. “The C‐Proteinase That Processes Procollagens to Fibrillar Collagens Is Identical to the Protein Previously Identified as Bone Morphogenic Protein‐1.” Proceedings of the National Academy of Sciences 93: 5127–5130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Li, X. , Bian Y., Takizawa Y., et al. 2013. “ERK‐Dependent Downregulation of Skp2 Reduces Myc Activity With HGF, Leading to Inhibition of Cell Proliferation Through a Decrease in Id1 Expression.” Molecular Cancer Research 11: 1437–1447. [DOI] [PubMed] [Google Scholar]
  28. Maruhashi, T. , Kii I., Saito M., and Kudo A.. 2010. “Interaction Between Periostin and BMP‐1 Promotes Proteolytic Activation of Lysyl Oxidase.” Journal of Biological Chemistry 285: 13294–13303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Miyahara, M. , Njieha F. K., and Prockop D. J.. 1982. “Formation of Collagen Fibrils In Vitro by Cleavage of Procollagen With Procollagen Proteinases.” Journal of Biological Chemistry 257: 8442–8448. [PubMed] [Google Scholar]
  30. N'Diaye, E.‐N. , Cook R., Wang H., et al. 2021. “Extracellular BMP1 Is the Major Proteinase for COOH‐Terminal Proteolysis of Type I Procollagen in Lung Fibroblasts.” American Journal of Physiology. Cell Physiology 320: C162–C174. [DOI] [PubMed] [Google Scholar]
  31. Pappano, W. N. , Steiglitz B. M., Scott I. C., Keene D. R., and Greenspan D. S.. 2003. “Use of Bmp1/Tll1 Doubly Homozygous Null Mice and Proteomics to Identify and Validate In Vivo Substrates of Bone Morphogenetic Protein 1/Tolloid‐Like Metalloproteinases.” Molecular and Cellular Biology 23: 4428–4438. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Ressler, S. , Bartkova J., Niederegger H., et al. 2006. “p16INK4A Is a Robust In Vivo Biomarker of Cellular Aging in Human Skin.” Aging Cell 5: 379–389. [DOI] [PubMed] [Google Scholar]
  33. Rittié, L. , and Fisher G. J.. 2002. “UV‐Light‐Induced Signal Cascades and Skin Aging.” Ageing Research Reviews 1: 705–720. [DOI] [PubMed] [Google Scholar]
  34. Rittié, L. , and Fisher G. J.. 2015. “Natural and Sun‐Induced Aging of Human Skin.” Cold Spring Harbor Perspectives in Medicine 5: a015370. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Rosell‐Garcia, T. , and Rodriguez‐Pascual F.. 2018. “Enhancement of Collagen Deposition and Cross‐Linking by Coupling Lysyl Oxidase With Bone Morphogenetic Protein‐1 and Its Application in Tissue Engineering.” Scientific Reports 8: 10780. 10.1038/s41598-018-29236-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Sansilvestri‐Morel, P. , Harouki‐Crochemore N., Bertin F., et al. 2021. “Deficiency of Procollagen C‐Proteinase Enhancer 1 in Mice Has No Major Impact on Cardiac Collagen and Function Under Basal Conditions.” Journal of Cardiovascular Pharmacology 78: e703–e713. [DOI] [PubMed] [Google Scholar]
  37. Scott, I. C. , Imamura Y., Pappano W. N., et al. 2000. “Bone Morphogenetic Protein‐1 Processes Probiglycan.” Journal of Biological Chemistry 275: 30504–30511. [DOI] [PubMed] [Google Scholar]
  38. Shirako, E. , Hirayama N., Tsukada Y., Tanaka T., and Kitamura N.. 2008. “Up‐Regulation of p21CIP1 Expression Mediated by ERK‐Dependent and ‐Independent Pathways Contributes to Hepatocyte Growth Factor‐Induced Inhibition of HepG2 Hepatoma Cell Proliferation.” Journal of Cellular Biochemistry 104: 176–188. [DOI] [PubMed] [Google Scholar]
  39. Silver, F. H. , Freeman J. W., and Seehra G. P.. 2003. “Collagen Self‐Assembly and the Development of Tendon Mechanical Properties.” Journal of Biomechanics 36: 1529–1553. [DOI] [PubMed] [Google Scholar]
  40. Steiglitz, B. M. , Keene D. R., and Greenspan D. S.. 2002. “PCOLCE2 Encodes a Functional Procollagen C‐Proteinase Enhancer (PCPE2) That Is a Collagen‐Binding Protein Differing in Distribution of Expression and Post‐Translational Modification From the Previously Described PCPE1.” Journal of Biological Chemistry 277: 49820–49830. [DOI] [PubMed] [Google Scholar]
  41. Steiglitz, B. M. , Kreider J. M., Frankenburg E. P., et al. 2006. “Procollagen C Proteinase Enhancer 1 Genes Are Important Determinants of the Mechanical Properties and Geometry of Bone and the Ultrastructure of Connective Tissues.” Molecular and Cellular Biology 26: 238–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Stevenson, N. L. , Bergen D. J. M., Lu Y., et al. 2021. “Giantin Is Required for Intracellular N‐Terminal Processing of Type I Procollagen.” Journal of Cell Biology 220: e202005166. 10.1083/jcb.202005166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Suzuki, N. , Labosky P. A., Furuta Y., et al. 1996. “Failure of Ventral Body Wall Closure in Mouse Embryos Lacking a Procollagen C‐Proteinase Encoded by Bmp1, a Mammalian Gene Related to Drosophila Tolloid.” Development 122: 3587–3595. [DOI] [PubMed] [Google Scholar]
  44. Takahara, K. , Kessler E., Biniaminov L., et al. 1994. “Type I Procollagen COOH‐Terminal Proteinase Enhancer Protein: Identification, Primary Structure, and Chromosomal Localization of the Cognate Human Gene (PCOLCE).” Journal of Biological Chemistry 269: 26280–26285. [PubMed] [Google Scholar]
  45. Takasugi, M. , Nonaka Y., Takemura K., et al. 2024. “An Atlas of the Aging Mouse Proteome Reveals the Features of Age‐Related Post‐Transcriptional Dysregulation.” Nature Communications 15: 8520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tanaka, T. , Moriya K., Tsunenaga M., et al. 2022. “Visualized Procollagen Iα1 Demonstrates the Intracellular Processing of Propeptides.” Life Science Alliance 5: e202101060. 10.26508/lsa.202101060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Ushio, K. , Hashimoto T., Kitamura N., and Tanaka T.. 2009. “Id1 Is Down‐Regulated by Hepatocyte Growth Factor via ERK‐Dependent and ERK‐Independent Signaling Pathways, Leading to Increased Expression of p16INK4a in Hepatoma Cells.” Molecular Cancer Research 7: 1179–1188. [DOI] [PubMed] [Google Scholar]
  48. Uzel, M. I. , Scott I. C., Babakhanlou‐Chase H., et al. 2001. “Multiple Bone Morphogenetic Protein 1‐Related Mammalian Metalloproteinases Process Pro‐Lysyl Oxidase at the Correct Physiological Site and Control Lysyl Oxidase Activation in Mouse Embryo Fibroblast Cultures.” Journal of Biological Chemistry 276: 22537–22543. [DOI] [PubMed] [Google Scholar]
  49. Van Doren, S. R. 2015. “Matrix Metalloproteinase Interactions With Collagen and Elastin.” Matrix Biology 44: 224–231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. von Marschall, Z. , and Fisher L. W.. 2010. “Decorin Is Processed by Three Isoforms of Bone Morphogenetic Protein‐1 (BMP1).” Biochemical and Biophysical Research Communications 391: 1374–1378. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhang, Q. , Andrew Chan K. L., Zhang G., et al. 2011. “Raman Microspectroscopic and Dynamic Vapor Sorption Characterization of Hydration in Collagen and Dermal Tissue.” Biopolymers 95: 607–615. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1: gtc70093‐sup‐0001‐Supinfo.docx.

GTC-31-0-s001.docx (3.4MB, docx)

Data Availability Statement

All data generated or analyzed during this study are included in this published article and its Supporting Information files.

Articles from Genes to Cells are provided here courtesy of Wiley

RESOURCES