Telomere length associates with regenerative capacity in Brassica napus L.

Abstract

Plant cells exhibit strong pluripotency, enabling them to form dedifferentiated tissues such as callus. The formation of callus involves sustained cell division, resulting in significant consumption of telomere length. However, the involvement of telomeres and the mechanisms responsible for maintaining chromosome end integrity during callus formation remain poorly understood. In this study, we observed an accumulation of telomere length during the dedifferentiation stage, which peaked at approximately 18 days of cultivation. Subsequently, telomere length rapidly decreased concurrently with accelerated cell division and callus swelling. A comparison of materials with longer initial telomeres lengths and greater Telomerase Reverse Transcriptase (TERT) activity (e.g. J9707), and those with shorter telomeres (e.g. ZS11), revealed that longer telomere ends accumulated after 18 days of cultivation, leading to greater regeneration capacity. The difficulty in callus swelling observed in ZS11 may be attributed to insufficient telomere length accumulation in the early stages, resulting in an inability to withstand rapid cell division later on. These findings suggest a correlation between telomere length and regeneration activity. Additionally, we assessed telomere length and regenerative capacity in 14 independent B. napus lines, revealing an association between regeneration capacity and original telomere length. Our study revealed intricate dynamic changes in telomeres during callus formation, suggesting their potential role in regulating regenerative capacity. This study contributes to our understanding of telomere functions in plant regeneration and suggests a promising molecular marker for assessing rapeseed regenerative ability.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-026-08215-4.

Introduction

Transgenic technology stands as a cornerstone in molecular biology research, offering profound insights and practical applications in various fields. With the advancement of industry, its role in crop improvement, particularly in nonstaple crops, has garnered increasing attention [1–4]. In crops such as rice and maize, well-established transgenic technology systems have paved the way for genetic modifications. However, these systems, while robust, are not without limitations. One significant challenge lies in achieving efficient individual regeneration, given that most crops can only achieve transgenic operations via regeneration from callus within a given genetic background [5, 6]. This bottleneck hampers the full potential of transgenic operations in crop improvement endeavors.

The process of individual regeneration involves the dedifferentiation of somatic cells into stem cells, which subsequently redifferentiate into somatic cells [7, 8]. The molecular mechanism underlying plant regeneration has been extensively investigated, leading to the cloning of numerous related genes [7, 8]. Among these, genes associated with hormone synthesis, metabolism, and signal transduction, such as AUXIN RESPONSE FACTORs (ARFs) and LATERAL ORGAN BOUNDARIES DOMAINs (LBDs) in the auxin pathway, play pivotal roles [9–12]. These genes respond to the key roles of hormones like auxin and cytokinin in altering cell fate during regeneration [13]. Another class of crucial genes includes transcription factors that initiate regeneration, such as WUSCHEL (WUS) and WUSCHEL-RELATED HOMEOBOX 5 (WOX5). These genes are instrumental in altering cell fate, with WUS and WOX5 determining whether the regenerated tissue becomes a bud or a root, respectively [14–16]. They primarily function to initiate downstream regeneration programs, serving as primary executors in shaping cell fate. Furthermore, genes related to processes like epigenetic modification (VRN2, DDM2) and cell wall structure modification (XTH) have also been implicated in plant regeneration [17–19]. These factors reflect essential biological processes during plant regeneration. However, some critical processes, such as cell division, are usually overlooked.

Cell division underpins the processes of dedifferentiation and redifferentiation crucial for regeneration. Several key genes involved in the cell cycle, including CyclinD3;1/3;2/3;3 (CYCD3;1/3;2/3;3), have been identified as playing pivotal roles in regeneration [20]. Signals for cell division and damage converge on genes like CYCD3;1, initiating the cell division process [20, 21]. Dysfunction in CYCD3;1 results in the inability to form callus tissue [21]. While this study provides partial insights into the initiation of cell division during callus formation, how cell division is maintained during callus formation remains inadequately explored. A critical issue in this context is the protection of chromosome ends, or telomeres, which are known to undergo partial consumption during mitosis. How explants respond to telomere attrition during callus formation, and whether telomere attrition impacts plant regeneration, are questions with limited understanding.

Telomeres serve as protective cap structures at the linear ends of chromosomes, crucial for maintaining genome stability and integrity [22]. In animal studies, the well-established relationship between telomeres and cell division highlights their pivotal roles in organismal aging, tumor growth, and various other processes [23]. Similarly, in plants, telomeres safeguard chromosome ends and have been associated with lifespan [24], underscoring the conservation of telomeric biological functions across species. Plant callus tissue exhibits tumor-like, unlimited proliferation capability, suggesting a potential role for telomeres in this process. However, research findings revealing no significant difference, or rapid changes in telomere length between callus tissue and donor materials (such as leaves) in plants seem to challenge the notion of telomeres’ significant involvement in callus tissue formation [25, 26].

Given the well-documented relationship between telomeres and cell division, it is plausible to postulate a link between telomere length regulation and callus tissue formation. In this study, we investigated the dynamics of telomere length changes during callus tissue formation in B. napus. Our results unveil a distinct pattern in telomere length dynamics, characterized by an initial increase followed by a subsequent decrease during callus tissue formation. Particularly, during the initial dedifferentiation phase, telomere length gradually increased until reaching a critical threshold. Subsequently, as dedifferentiation concluded, callus tissue underwent rapid proliferation, leading to a swift reduction in telomere length. Moreover, materials with longer initial telomere lengths demonstrated accelerated rates of callus tissue growth. These findings collectively imply that the accumulation of sufficient telomere length in the early stages is vital for sustaining callus tissue growth, thus influencing the vigor of canola regeneration.

Materials and methods

Plant materials and growth conditions

ZS11 and J9707 are independent inbred lines of B. napus. Uniform and fully developed seeds were selected for callus inducation. After sterilization, they were germinated in M0 medium (Murashige & Skoog 2.2 g L^− 1, agar powder 7.5 g L^− 1, pH = 6.0) and incubated in the dark at 22 ± 2 ℃ with a relative humidity of 65 ± 5% for 7 days. The regenerated seedling materials were taken out and the hypocotyls were cut into segments approximately 0.8 cm long in sterilized culture dishes. These segments were then transferred to callus-inducing media (CIM; MS 4.4 g L^− 1, sucrose 30 g L^− 1, mannitol 18 g L^− 1, 2,4-D 1 g L^− 1, kinetin 0.3 g L^− 1, agarose 7 g L^− 1, kanamycin 25 mg L^− 1, silver nitrate 0.51 g L^− 1, sodium thiosulfate 1.896 g L^− 1, timentin 300 mg L^− 1, pH = 6.0), labeled as day 0 (D0), and incubated at 22 ± 2 ℃ with a photoperiod of 16/8 h (day/night). At D21, the plants were transferred to shoot-inducing medium (SIM; MS powder 4.4 g L^− 1, glucose 10 g L^− 1, xylose 0.25 g L^− 1, MES 0.6 g L^− 1, agarose 7 g L^− 1, kanamycin 25 mg L^− 1, timentin 300 mg L^− 1, zeatin 2 mg L^− 1 and indole-3-acetic acid 0.1 mg L^− 1, pH = 6.0). Samples were taken at specific time points throughout the entire cycle (see Fig. 2A for detailed sampling times), frozen at -80 ℃, and used for subsequent DNA and RNA extraction.

Fig. 2.

Dynamics of telomere length and TERT expression during callus formation. A Telomere lengths were assessed at the time points indicated on the horizontal axis, with hypocotyls sampled after cultivation on CIM for the corresponding durations. Hypocotyls were transferred to SIM after 21 days of cultivation on CIM. Hypocotyls were segmented after 7 days of dark cultivation of ZS11 and J9707 seeds. B TERT expression in hypocotyls from the same culture condition in panel A. Expression levels were normalized to that of ZS11 hypocotyls on day 0 (D0). Bars represent the mean ± standard error (SE) of 3 independent biological replicates (two-way ANOVA and Šidák's multiple comparisons test, **p < 0.01; ****p < 0.0001)

YL125, YL124, YL74, YL132, YL126, YL178, YL169, YL179, YL153, YL75, YL99, YL185, YL172 and YL184 are independent inbred lines of B. napus provided by the Crop Research Institute of Hunan Academy of Agricultural Sciences. Using the same method described above, samples were taken at D0, D18, and D42 for subsequent DNA and RNA extraction. Additionally, seeds of these 14 lines were germinated on filter paper soaked in liquid Hoagland medium and cultured under the same conditions as ZS11 and J9707 for 10 days to measure root and hypocotyl lengths.

Regeneration ability assessment and plant performance determination

Regeneration ability assessment: The callus induced from 14 inbred lines (YL125, YL124 et al., mentioned above, and Fig. 4) were photographed on D42, and the maximum diameter was measured via ImageJ Version 1.53 software to assess the regeneration ability of the material. Seedlings cultured on Hoagland liquid medium were manually measured for the length of the hypocotyl and root on the 10th day and photographed.

Fig. 4.

Correlation between telomere length and regenerative capacity of B. napus. A Telomere length (represented by dark blue bars) and callus formation (represented by the red curve) of 14 B. napus inbred lines. Telomere length was measured in segmented hypocotyls on D0 and is shown as the dark blue bars. Callus formation was evaluated based on the maximum diameter of the callus tissue, measured on D42. Expression levels, as shown in panel A, were normalized to the telomere length of D0 hypocotyls of YL185. Bars represent the mean ± standard error (SE). Sample sizes were n = 3 for telomere length and n = 18-44 for callus width. Statistical significance was determined by one-way ANOVA with Tukey's test (telomere length) and Welch's ANOVA with Games-Howell test (callus width). B Representative photographs of callus derived from materials with the three longest (YL125, YL124, and YL74) and three shortest (YL185, YL172, and YL184) telomeres, respectively. Images were captured after 42 days of cultivation. Scale bars = 1 cm. C TERT activities in D0 hypocotyls of the six materials shown in panel B. Expression levels in panel C were normalized to the telomerase activity of D0 hypocotyls of YL185. Bars represent the mean ± standard error (SE) of three independent replicates (one-way ANOVA and Tukey's multiple comparisons test). D Expression of WOX5 and PLT1 in D18 hypocotyls of the same materials described in panel B and C. Expression levels presented in panel D were normalized to that of YL185. Bars represent the mean ± standard error (SE) of three independent replicates (one-way ANOVA and Tukey's multiple comparisons test)

Microscopic examination: Hypocotyls of ZS11 and J9707 at D18 were observed using a ×10 objective.

Telomere length measurement and gene expression quantification

Telomere length measurement: DNA extraction was performed using the cetyltrimethylammonium bromide (CTAB) method, with 700 µl of CTAB + 20 µl of DL-Dithiothreitol (DTT) added. The mixture was incubated at 65 ℃ in a water bath for 30 min, followed by centrifugation at 4 ℃ for 15 min. An equal volume of phenol-chloroform mixture was added to each tube, gently mixed, and centrifuged at 12,000 rpm for 15 min at 4 ℃. The supernatant was transferred to another centrifuge tube, an equal volume of precooled isopropanol was added, and the mixture was left overnight at -20 ℃. After centrifugation at 12,000 rpm for 5 min, the DNA was washed 2–3 times with 70% ethanol and air-dried at room temperature. Each tube was then added with 100 µl of TE and stored at -20 ℃for later use. The design of telomere length measurement primers TelA and TelB (Table 1) was based on the characteristics of B. napus telomere sequences (TTTAGGG/CCCTAAA), used to amplify telomere sequences, with the single-copy gene ZHD10 (BnaA04G0110100ZS) serving as a reference gene. Real-time qPCR analysis was conducted using the SYBR Premix Ex TaqTM Fluorescent Quantitative Kit (TaKaRa) on an ABI PRISM 7500 Real-Time System. Each reaction included 10 µl of 2×SYBR Premix Ex Taq, 2 µl of gDNA template, and 0.5 µmol L^− 1 of each gene-specific primer pairs, with a total volume of 20 µl. The PCR conditions were as follows: Stage (1) 3 min at 95 ℃; Stage (2) 39 cycles of 10 s at 95 ℃, 30 s at 60 ℃; Stage (3) 15 s at 95 ℃, 1 min at 65 ℃. The results were analyzed using the Bio-Rad iQ5 2.1 Standard Edition Optical System Software, with data subsequently processed in Microsoft Excel software, and the ratios of telomeric versus ZHD10 amplification products (T/S ratios) were determined using standard curves. Relative T/S ratios were calculated as indicated in the legend of the figures and used for graphic representations. The statistical significance was calculated using the appropriate tests as indicated in the figure legends.

Table 1.

The primers used in our study

qRT-PCR primers
Gene Name	Gene ID	Primer Name	Sequence (5’to3’)
telomeric sequence		TelA	CCCCGGTTTTGGGTTTTGGGTTTTGGGTTTTGGGT
		TelB	GGGGCCCTAATCCCTAATCCCTAATCCCTAATCCCT
ZHD10	BnaA04G0110100ZS	ZHD10-F	GTTACACAAGATGCCGTGAGAAC
		ZHD10-R	ATCGTTGCAGTAGTCGCATAAGC
PLT1	BnaA01G0310800ZS	PLT1-F1	GCCTAGCGTCCAATCAAA
		PLT1-R1	GCTGCGGCGTTATTACCA
WOX5	BnaC02G0021700ZS	WOX5-F	CGGTGGAGCAGTTGAAGATA
		WOX5-R	TTTGGTCAGTGGTCGGAGTT
CYCB1	BnaC01G0016400ZS	CYCB1-F	CTATCTGGCTGAGTTAGGAGTAATG
		CYCB1-R	AACGGGAACTTGGTGAAGAG
TRET	BnaA10G0198500ZS	TRET-F	GAGAGCCTGGAACCATCAAA
		TRET-R	CCTCTCTATGCTCGCCTACTA
ACTIN7	BnaC02G0037200ZS	ACTIN7-F	GTTACACAAGATGCCGTGAGAAC
		ACTIN7-R	ATCGTTGCAGTAGTCGCATAAGC

Gene expression quantification for regenerative capacity assessment: Total RNA was isolated from each sample via the RNAprep Pure Plant Plus Kit (rich in polysaccharides and polyphenols) purchased from TIANGEN (TianGen, China) according to the manufacturer’s instructions. After assessing sample quality was assessed by agarose gel electrophoresis and UV spectrophotometry, 1 µg of total RNA was reverse transcribed into cDNA via a reverse transcription kit from Applied Biological Materials (Canada) following the manufacturer’s instructions. The primers for genes WOX5 (BnaC02G0021700ZS), PLT1 (BnaA01G0310800ZS), CYCB1;1 (BnaC01G0016400ZS), and telomerase gene TERT (BnaA10G0198500ZS) were designed with the online tool INTEGRATED DNA TECHNOLOGIES (https://eu.idtdna.com/pages) to assess regenerative capacity. ACTIN7 (BnaC02G0037200ZS) was used as the internal reference gene for this quantification. The primers used for RT-qPCR are listed in Table 1. Real-time RT-qPCR analysis was conducted using the same method as described above. For each biological sample, RT-qPCR was performed in three technical replicates. ΔCt values were calculated individually for each technical replicate, and the mean ΔCt value was used to represent each biological replicate for subsequent ΔΔCt analysis and statistical evaluation.

Results

No significant difference in telomere length between hypocotyls and callus

We hypothesized that telomere length might undergo specific alterations during callus formation via dedifferentiation. To explore this hypothesis, we employed qPCR to evaluate telomere length in the hypocotyls (the origin tissue for callus formation) and callus tissues of two commonly used rapeseed varieties, ZS11 and J9707 [25]. Consistent with prior research [26], we did not detect significant differences in telomere length between the hypocotyls and callus of these varieties (Fig. 1A). However, we noted that the initial telomere length (i.e., in the hypocotyl segments) of J9707 exceeded that of ZS11, with J9707 exhibiting approximately 1.5 times the telomere length of the same tissue in ZS11 (Fig. 1A). This finding prompted us to link the enhanced regeneration potential of J9707 with its telomere length, as our empirical observations suggest that, compared with J9707, ZS11 has a comparatively limited regeneration capacity (Fig. S1).

Fig. 1.

Telomere length of callus and hypocotyl derived from ZS11 and J9707. The hypocotyls of ZS11 and J9707 were segmented following 7 days of dark cultivation, and callus was subsequently regenerated from these hypocotyls (after ~ 42 days of cultivation). The expression levels were normalized to that of the J9707 callus. The bars represent the mean ± standard error (SE) of 3 independent biological replicates. Statistical analysis was performed using two-way ANOVA followed by Šidák’s multiple comparisons test, with significance denoted as **p < 0.01

Telomere length dynamically changes during callus formation

The failure to detect a significant difference in telomere length at the callus versus hypocotyl level suggests that a finer time-scale analysis may be necessary. Therefore, we meticulously monitored the dynamics of telomere length during callus formation in J9707 and ZS11 hypocotyls (Fig. 2A). Our findings indicate that over a span of 42 days, telomere length alterations in both materials followed similar patterns. Specifically, telomere length in ZS11 and J9707 steadily increased after cultivation on CIM for 21 days (denoted as D21), peaking at D18 and subsequently followed by a decline (Fig. 2A). Remarkably, the upward trend in J9707 was particularly pronounced compared to ZS11. Although ZS11 also exhibited an upward trend during the first 18 days, it was comparatively more gradual. This observation was consistent with the higher TERT activity detected in J9707 hypocotyls prior to dedifferentiation (Fig. 2B). Upon transfer to SIM, telomere length begans to decrease gradually, likely owing to the consumption of telomeres caused by cell division. The especially significant decrease in J9707 was probably due to its higher swelling rate of callus (Fig. 3D). In summary, telomere length gradually increased on CIM and decrease on SIM. This dynamic trend may explain why previous studies failed to detect significant changes in telomere length in callus.

Fig. 3.

Expression levels of regeneration and cell division related genes and microscopic examination of callus formation. A Expression levels of WOX5 in hypocotyls at D0 or D18, and in callus. D0 and D18 represent hypocotyls cultured for 0 or 18 days, respectively, following the procedures described in Fig. 2A. Callus refers to hypocotyls cultured for 20 days on CIM followed by 22 days on SIM, resulting in well-formed callus tissue. B Expression levels of PLT1 in hypocotyls at D0 or D18, and in callus. C Microscopic examination of hypocotyls after 18 days of cultivation. D Photographs of hypocotyls from ZS11 and J9707 after 18 days of cultivation. Scale bar = 1 mm. E Expression levels of CYCB1;1 in hypocotyls at D0, D15, or D22, and in callus. D0, D15, and D22 represent hypocotyls and callus samples following the same cultivation procedures. Expression levels presented in panels A, B, and E were normalized to that of D0 hypocotyls from ZS11. Lowercase letters in panels A and B indicate significant differences. Error bars represent the mean ± SE of 3 independent biological replicates (two-way ANOVA and Šidák's multiple comparisons test, ****p < 0.0001)

The observations discussed above led us to formulate the following hypothesis: during the dedifferentiation process, whereby somatic cells undergo a transformation into stem cells, it is imperative to pre-establish telomeres of sufficient length to facilitate subsequent proliferation during callus formation. In line with this hypothesis, we anticipated that by day 18 of cultivation (D18), both J9707 and ZS11 would have completed the transition from somatic cells to stem cells. To test this hypothesis, we assessed the expression levels of stem cell marker genes in J9707 and ZS11 on D18. Wuschel-related 5 (WOX5) and Plethora 1 (PLT1) are recognized as markers for stem cells in callus tissues, exhibiting significantly higher expression levels in callus compared with normal tissues. Although slightly lower, their expression levels at D18 were comparable to those observed in callus tissues (Fig. 3A, B), indicating that by D18, the hypocotyl cells had indeed acquired stem cell or callus identities. Despite the fact that the morphology of D18 hypocotyl still resembles that at D0, irregular swelling had become evident (Fig. 3C), as observed under microscopy. This phenomenon presaged the formation of callus. Interestingly, despite the sustained high TERT activity (Fig. 2B), telomere length began to decrease rapidly after D18 (Fig. 2A). Simultaneously, callus swelling became apparent (Fig. 3D), indicative of the initiation of cell division (Fig. 3E). However, frequent division progressively depleted the telomere length accumulated during the initial 18 days, rendering even elevated telomerase activity insufficient to maintain telomere length (Fig. 2). This conclusion was further supported by the increased expression of the cell division marker gene CYCB1;1. Additionally, the cell division rate significantly increased upon transfer to SIM (D22; Fig. 3E), which corresponded to the rapid depletion of telomere length observed on SIM medium (Fig. 2A).

In summary, our hypothesis suggests that during the initial phases of callus induction, somatic cells undergo dedifferentiation into stem cells, which is accompanied by an increase in telomere length. As this transition is completed, cells exhibit heightened division rates to promote rapid callus swelling. Adequate telomere length is essential for the subsequent robust growth of callus tissue. Insufficient accumulation of telomere length impedes sustained enlargement of subsequent callus tissue, ultimately compromising regeneration capacity.

Telomere length is correlated with regeneration ability

In our investigation involving ZS11 and J9707, we observed that J9707 exhibited a notably longer initial telomere length compared with ZS11. Correspondingly, J9707 displayed more robust TERT activity. Based on these findings, we hypothesize that the accumulation of longer telomeres during the dedifferentiation phase may counterbalance telomere loss during subsequent callus growth and redifferentiation. Longer telomere length is associated with higher TERT activity. Consequently, initial telomere length is likely to contribute to an enhanced regeneration capacity.

To validate the aforementioned hypothesis, we conducted analyses of regeneration capacity and telomere length in a random selection of 14 rapeseed materials. Regeneration capacity was assessed by measuring the maximum diameter of individual calluses on D42. Our findings revealed notable diversity in regeneration capacities among the 14 rapeseed materials subjected to identical culture conditions. Particularly, YL125, which exhibited the longest telomeres, displayed nearly complete callus growth on the hypocotyls by D42, with a maximum callus diameter of approximately 4 mm (Fig. 4). Conversely, YL184, which possessed the shortest telomeres, demonstrated minimal callus formation at D42, with only slight hypocotyl swelling observed (Fig. 4). Furthermore, the three materials with the shortest telomere lengths exhibited conspicuous browning of the hypocotyls, indicating inferior vigor of these tissues. Through RT-qPCR analysis, we observed significantly lower TERT activity in these materials (YL184, YL172, and YL185) at D0 compared to those (YL74, YL124, and YL125) with stronger regeneration capacities (Fig. 4C). Interestingly, despite its weaker regeneration capacity, YL185 exhibited relatively high expression levels of the WOX5 and PLT1 genes (Fig. 4D), suggesting that this material successfully underwent dedifferentiation. Thus, the limited callus growth of YL185 is more likely attributable to its shorter telomere length, which may have constrained subsequent rapid cell division, ultimately resulting in weaker regeneration capacity.

It is crucial to note that materials possessing similar telomere lengths do not necessarily exhibit comparable regeneration capacities. For instance, despite YL169 displaying a shorter telomere length than YL126, it exhibited greater callus formation (Fig. 4A). This observation suggests that telomere length alone may not fully reflect the regeneration vigor, indicating additional factors likely contribute to regeneration strength. Furthermore, analysis of morphological traits revealed substantial variation among the materials, including differences in hypocotyl length and root length (Fig. 5). However, these measured morphological traits did not exhibit a strong correlation with regeneration capacity (Fig. 5).

Fig. 5.

The morphological indicators are not correlated with the regenerative ability of B. napus. A Representative photographs of 14 inbred lines (as described in Fig. 4A) following 10 days of cultivation in liquid Hoagland medium. Scale bar = 2.5 cm. B Hypocotyl lengths of 14 inbred lines. C Root lengths of 14 inbred lines. Each point in panel B and C represent the mean ± SE of 3 independent replicates (Kruskal-Wallis test and Dunn's multiple comparisons test)

Nevertheless, a correlation between telomere length and rapeseed regeneration capacity is still evident. Although this relationship does not follow a strict linear relationship, it remains biologically meaningful given the inherent complexity of regeneration processes.

Discussion

In the realm of telomere research, the understanding of plant and animal telomeres varies among biologists. While it is acknowledged that telomeres in plants fulfill the same fundamental role as in animals, namely, to safeguard chromosome ends during DNA replication, our comprehension of the physiological processes involving telomeres remains limited. Nonetheless, researchers have unearthed functions in plants analogous to those in animals. For instance, a significant positive correlation between flowering time and telomere length in plants has been identified [27]. Flowering time, particularly in annual plants, mirrors the length of the life cycle, as annual plants mature and produce seeds shortly after flowering to complete the next life generation. These fundings suggest that telomere length also influences the lifespan of plants. However, further research has indicated that the impact of telomeres on plant life activities differs from that on animals [28]. In animals, cells with persistently elongated and non-depleting telomeres are often cancerous. While plant stem cells also maintain long telomeres, they are not as uncontrollable as cancer cells. The fate of cells in response to changes in telomere length may not be identical between animals and plants. In fact, this perspective may somewhat exaggerate the disparities between animal and plant cells. Currently, ample evidence suggests that telomere length in plants is indeed associated with aging [29, 30]. Although plant stem cells can maintain their original state without telomere length depletion, cell fate is not solely dictated by telomere length. Despite the lack of a complex communication system akin to the nervous system in animals, the fate of plant cells is significantly influenced by the surrounding environment. Various stem cells in the root apical stem cell niche exhibit distinct fates largely based on their spatial position [31, 32]. Mechanical pressure can even restore the division ability of mature somatic cells [33, 34]. Additionally, stem cells may be influenced and restricted by the surrounding microenvironment, preventing them from losing control similar to cancer cells. Hence, the substantial physiological differences between plant and animal cells may account for disparities in the biological functions of telomeres between the two groups rather than their consequence. Since telomere length depletion is an integral aspect of cell mitosis, we believe that telomeres likely play a role in rapidly dividing tissues. As indicated by our results, telomeres likely play crucial roles in the formation of callus tissue. Naturally, we acknowledge the limitations of this study, such as the need for further genetic evidence to support the observed mutant phenotypes. Nevertheless, we advocate for further investigation into telomeres within the framework of callus tissue formation.

We conducted an analysis using 14 rapeseed materials to validate the association between telomere length and regenerative capacity (Fig. 4A, B). This finding not only confirms the involvement of telomere length in the formation of rapeseed callus tissue but also underscores the potential application value of telomere length. Regenerative capacity, a challenging biological indicator for direct observation, can be relatively easily detected through telomere length analysis. Regenerative capacity holds significant importance in rapeseed agricultural production [35]. For instance, vegetable rapeseed often requires greater regenerative capacity to yield more rapeseed greens. Likewise, the genetic transformation of rapeseed relies on callus tissue. A robust regenerative capacity enhances the success rate of genetic transformation. We acknowledge that telomere length, as a regenerative indicator, is not flawless, as demonstrated by the YL126 material. Nonetheless, it exhibits excellent indicative ability, particularly in scenarios with considerable differences in telomere length. These results are not surprising, given that studies in tobacco have shown significantly greater TERT activity in young buds than in leaves [36]. Young tissue typically possesses stronger regenerative capacity, which is a well-established fact in the field of regeneration. Nevertheless, our findings facilitate the rapid assessment of regenerative capacity in rapeseed materials.

Conclusions

Our study reveals a dynamic “increase-then-decrease” pattern of telomere length during callus formation in B. napus. Telomeres undergo significant elongation during the early dedifferentiation stage, thereby providing a critical foundation for subsequent rapid cell proliferation. Materials with longer initial telomere lengths (e.g., J9707) exhibited stronger regenerative capacity. Analysis of 14 independent rapeseed lines further confirmed the association between telomere length and regeneration ability. These findings not only elucidate a crucial role for telomere dynamics in plant regeneration but also suggest telomere length as a potential biomarker for assessing regenerative vigor in rapeseed, offering significant implications for crop genetic improvement and the optimization of transgenic technologies.

Authors’ contributions

D.Y. Rong and Q.J. Xie conceived the project; D.Y. Rong, Q.J. Xie and H.H. Du designed research; H.H. Du, Y. Fang and B.Y. Zhang performed research; Y. Fang and B.Y. Zhang analyzed data; H.H. Du and Q.J. Xie wrote the paper; all authors reviewed and approved the manuscript for publication.

Funding

This work was supported by the Natural Science Foundation of Hunan Province (2024JJ4018 to D.R.) and the Science and Technology Innovation Program of Hunan Province (2024RC3221 to D.R.) and by the Natural Science Foundation of Hunan Province (2023JJ30211).

Data availability

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.