Summary
Cellular senescence’s role in clear cell renal carcinoma (ccRCC) remains unclear. We identify CCT3 as a driver of ccRCC progression by enhancing XPO1 stability via correct folding, confirmed by Co-IP and GST pull-down. This promotes nuclear export of tumor suppressors such as RB1 and p21, suppressing cellular senescence. Indeed, experimental evidence showed significantly reduced senescence-associated β-galactosidase (SA-β-gal) activity and altered expression patterns of senescence markers (e.g., p21, CDK4, and cyclin D) in the presence of increased CCT3. Functionally, CCT3 depletion induced robust G1 phase arrest, promoted cellular senescence, and markedly diminished ccRCC cell proliferation, migration, and invasion in vitro. Crucially, in vivo studies demonstrated that the combined therapeutic intervention of CCT3 knockdown and the XPO1 inhibitor Selinexor significantly suppressed tumor growth in ccRCC xenograft models, validating the therapeutic potential of targeting the CCT3-XPO1 axis. In summary, our findings unveil a novel CCT3-XPO1-RB1 axis that orchestrates ccRCC progression by impairing cellular senescence, offering a promising therapeutic avenue for ccRCC treatment.
Subject areas: Molecular biology
Graphical abstract
Highlights
-
•
CCT3 promotes ccRCC progression by suppressing cellular senescence
-
•
CCT3 stabilizes XPO1 through direct binding
-
•
CCT3/XPO1 axis drives tumor growth via RB1 nuclear export
-
•
Targeting CCT3-XPO1 with Selinexor inhibits tumor growth in vivo
Molecular biology
Introduction
Clear cell renal carcinoma (ccRCC) is the most common subtype of renal cancer, accounting for 70–80% of cases.1,2,3 Despite advances in targeted therapies and immunotherapies, the prognosis for patients with ccRCC remains poor, with a five-year survival rate of only 12–30% for advanced-stage disease.4,5 The high heterogeneity and resistance to conventional treatments underscore the need for novel therapeutic targets and strategies.
Chaperonin containing TCP1 subunit 3 (CCT3) is a key component of the CCT/TRiC complex, which facilitates protein folding and quality control.6,7,8 Dysregulation of CCT3 has been implicated in various cancers, including breast, liver, and prostate cancer, where it promotes tumor progression by regulating cell cycle, apoptosis, and proliferation.9,10,11,12 However, the role of CCT3 in ccRCC remains poorly understood.
Exportin 1 (XPO1), also known as CRM1, is a nuclear export protein that regulates the transport of tumor suppressors such as p53, p21, and RB1.13,14,15,16 Overexpression of XPO1 is associated with poor prognosis in multiple cancers, as it promotes the nuclear export of tumor suppressors, thereby inhibiting their function.17,18 XPO1 inhibitors, such as Selinexor, have shown promise in hematologic malignancies,19,20,21,22,23 but their efficacy in ccRCC remains unexplored.
Cellular senescence is a tumor-suppressive mechanism characterized by irreversible cell-cycle arrest.24,25,26 It is regulated by key pathways, including the p53-p21-RB1 axis, and is often dysregulated in cancer.27,28,29,30 The Senescence-Associated Secretory Phenotype (SASP) is a defining characteristic of cellular senescence. On one hand, SASP factors contribute to maintaining cell-cycle arrest. On the other hand, they can exert anti-tumor effects by modulating the surrounding tissue microenvironment, effectively recruiting immune cells to eliminate tumor cells.31 Understanding the molecular mechanisms underlying senescence in ccRCC is critical for developing effective therapies.
We hypothesized that CCT3 promotes ccRCC progression by stabilizing XPO1 and suppressing RB1-mediated senescence. This study aims to: (1) investigate the role of CCT3 in ccRCC progression, (2) elucidate the mechanism by which CCT3 regulates XPO1 and RB1, and (3) evaluate the therapeutic potential of targeting the CCT3-XPO1 axis in ccRCC.
Results
Chaperonin containing TCP1 subunit 3 is linked to unfavorable outcomes in clear cell renal carcinoma
First, we utilized the online database UALCAN to investigate the expression levels of CCT3 protein across various cancers.32 The results revealed that CCT3 is overexpressed in the majority of cancer types (Figure 1A). Subsequently, to investigate the potential relationship between CCT3 and ccRCC, we analyzed data from the CPTAC database, which included 84 normal kidney tissues and 110 ccRCC tissues. The findings indicated that CCT3 expression was markedly elevated in ccRCC tissues in contrast to adjacent non-tumor tissues (p < 0.005, Figure 1B).
Figure 1.
CCT3 expression is associated with unfavorable clinical outcomes in clear cell renal carcinoma (ccRCC)
(A) Bar graph depicts the protein expression levels of CCT3 in selected cancer types and their respective normal tissues. Data were obtained from the Clinical Proteomic Tumor Analysis Consortium (CPTAC) unpaired sample analysis.
(B) Upregulated expression of CCT3 in clear cell renal carcinoma (ccRCC) compared to normal kidney tissues, as determined by the UALCAN online database analysis.
(C) Analysis of the impact of CCT3 expression on the p53/Rb pathway in ccRCC, derived from the CPTAC database.
(D) Correlation analysis between CCT3 mRNA expression levels and the mRNA expression levels of key genes involved in the p53/Rb pathway (TP53, Rb1, CDK4, and E2F3) using Spearman correlation, as analyzed by GEPIA.
(E and F) Kaplan-Meier survival curves illustrating the association between CCT3 expression and overall survival (OS) and progression-free survival (PFS) in patients with ccRCC. Patients were stratified into low and high CCT3 expression groups. Statistical significance is indicated as ∗p < 0.05, ∗∗p < 0.01, ∗p < 0.001, and ns for non-significant differences. Data in A are presented as mean ± standard deviation (SD). Two-tailed Student’s t test.
In addition, within the context of ccRCC, we further explored the relationship between CCT3 and various signaling pathways. Using the online database UALCAN, we systematically assessed pathway-level somatic alterations (by small mutation or copy number alteration) in ccRCC with combined proteomic, whole-exome, and CNA data in CPTAC. Our findings revealed a significant correlation between CCT3 and the p53/Rb signaling pathway (pathway annotations from Zhang et al.33) (Figure 1C). To further clarify the correlation between CCT3 and key genes within the p53/RB1 pathway, we performed Spearman correlation analysis using the GEPIA database. This analysis revealed strong correlations between CCT3 and TP53 (R = 0.35, p < 0.05), Rb1 (R = 0.41, p < 0.05), CDK4 (R = 0.46, p < 0.05), and E2F3 (R = 0.35, p < 0.05) (Figure 1D).
Finally, we utilized the UALCAN and GSCA databases to investigate the relationship between CCT3 expression and prognosis in renal clear cell carcinoma (RCC). The findings revealed that elevated CCT3 expression was associated with reduced overall survival (OS) and progression-free survival (PFS) in patients (Figures 1E and 1F). These findings further support the potential role of CCT3 in ccRCC and its viability as a prognostic biomarker.
The depletion of chaperonin containing TCP1 subunit 3 impairs the abilities of proliferation, migration, and invasion in clear cell renal carcinoma cells
CCT3 expression levels were first predicted in several renal cancer cell lines, and a selection of these cell lines was subsequently validated. We ultimately chose to conduct subsequent experiments using the 786-O and 769-P cell lines (Figures S1A–S1C). To determine the expression level of CCT3 in renal cancer tissues, we selected four pairs of clinical samples. The results revealed that the CCT3 protein level was significantly elevated in clear cell renal carcinoma compared to adjacent non-cancerous tissues (Figure 2A). We also queried the HPA (Human Protein Atlas) database, and the results were consistent, showing that CCT3 expression was significantly elevated in clear cell renal carcinoma tissues (Figure 2B).
Figure 2.
The depletion of CCT3 impairs the abilities of proliferation, migration, and invasion in ccRCC cells
(A) Western blot analysis was performed to assess the protein expression of CCT3 in four pairs of clear cell renal cell carcinoma tissues (T) and their corresponding adjacent normal tissues (N). (n = 4).
(B) The immunohistochemical results of CCT3 in ccRCC and normal renal tissue in the HPA database.
(C) Western blot was used to assess the effects of two distinct CCT3 knockdown sequences in 786-O and 769-P cells.
(D and E) Wound-healing assay indicates that CCT3 knockdown suppresses the viability of 786-O and 769-P cells.
(F and G) Transwell assay indicates impaired abilities of migration and invasion of 769-P and 786-O cells.
(H and I) The proliferative abilities of stably CCT3-depleted 769-P and 786-O cells were measured with an EdU staining assay. (Scale bars, 100 μm. Data in C-I are presented as the means ± SDs (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001). Two-tailed Student’s t test for A, Student’s t test for C-I.
To further elucidate the role of CCT3 in renal cancer, we performed CCT3 knockdown in two distinct cell lines (Figure 2C). Results from the wound healing assay revealed a significant reduction in the migratory capacity of both 786-O and 769-P cells post-CCT3 knockdown (Figures 2D and 2E). To further assess the influence of CCT3 on the migration and invasion of renal cancer cells, we conducted transwell assays, which corroborated that CCT3 knockdown resulted in diminished migratory and invasive capabilities of the renal cancer cells (Figures 2F and 2G). Finally, to evaluate the effect of CCT3 on the proliferation of renal cancer cells, we executed EdU staining experiments, which unequivocally demonstrated that CCT3 knockdown also led to a marked decrease in the proliferative capacity of the renal cancer cells (Figures 2H and 2I). These findings collectively indicate that CCT3 plays a promotive role in the proliferation, migration, and invasion of clear cell renal carcinoma cells.
The reduction of chaperonin containing TCP1 subunit 3 induces cellular senescence in clear cell renal carcinoma cells
Previous analyses have indicated that CCT3 is associated with the p53/Rb pathway, which plays a crucial role in regulating the cell cycle. One of the hallmarks of cellular senescence is cell-cycle arrest. Moreover, cellular senescence is closely linked to the onset and progression of tumors. Therefore, we hypothesize that CCT3 may influence the invasiveness and migratory abilities of renal cancer cells by affecting cellular senescence.
CCT3 was knocked down in the 786-O and 769-P cell lines, and Western blot analysis was conducted to assess the expression levels of CDK4, Cyclin D, P21, and phosphorylated Rb (p-Rb (Ser807/811)). The results showed that with the knockdown of CCT3, the levels of CDK4, Cyclin D, and p-Rb (Ser807/811) decreased, while P21 expression increased. This suggests that the cell cycle may have experienced a blockade (Figure 3A). Subsequently, we performed qRT-PCR to measure the mRNA levels of senescence-associated secretory factors IL-1A, TNF, as well as CDK2, CDK4, and CDK6 following CCT3 knockdown. The results indicated that the expression of senescence-associated secretory factors significantly increased after CCT3 knockdown, while the levels of cyclin-dependent kinases CDK2, CDK4, and CDK6 decreased (Figure 3B). To clarify the state of cellular senescence, we conducted senescence-associated β-galactosidase staining in CCT3-knockdown cell lines. The results showed a significant increase in β-galactosidase staining following CCT3 knockdown, indicating an elevation in the level of cellular senescence (Figure 3C).
Figure 3.
The reduction of CCT3 induces cellular senescence in ccRCC cells
(A) Western blot analysis was performed to assess the protein expression of CDK4, CyclinD, p-Rb (Ser807/811), and p21 in CCT3 knockdown cells.
(B) The mRNA expression levels of senescence-associated genes, including interleukin 1 A, TNF, CDK2, CDK4, and CDK6 in CCT3-depleted cells were examined by qRT-PCR.
(C) Changes of SA-β-gal activity in CCT3-knockdown cells. Data represent the percentage of cells staining positive for SA-β-gal ±SD.
(D) Cell cycle analysis calculated the distribution of the cells in G1, S, and G2/M phases.
(E) Representative immunofluorescent staining of p21 and p-Rb (Ser807/811) in each cell.
(F) Western blot analysis was performed to assess the protein expression of CDK4, CyclinD, p-Rb (Ser807/811), and p21 in CCT3 overexpressed cells.
(G) Wound-healing assay indicates that the overexpression of CCT3 enhances the proliferation capacity of A498 cells.
(H) The Transwell assay demonstrated that the overexpression of CCT3 enhances the migratory and invasive capabilities of A498 cells. (Scale bars, 100 μm, all data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001). Student’s t test.
As cellular senescence is characterized by cell-cycle arrest, we assessed the cell cycle status using a cell cycle assay kit. The analysis revealed that following CCT3 knockdown, there was an increase in the proportion of cells in the G1 phase and a decrease in the S phase, indicating that the cell cycle was indeed arrested (Figure 3D). Finally, we performed immunofluorescence experiments and found that the fluorescence intensity of P21 and p-Rb (Ser807/811) changed with the knockdown of CCT3 (Figure 3E). We also overexpressed CCT3 in the A498 cell line. Western blot analysis showed that after CCT3 overexpression, the levels of p-Rb (Ser807/811), Cyclin D, and CDK4 proteins all increased, whereas the expression of p21 decreased (Figure 3F). The scratch assay indicated that CCT3 overexpression enhances cell proliferation (Figure 3G), while the transwell assay demonstrated that the overexpression of CCT3 can promote both cell migration and proliferation capacity (Figure 3H). The evidence presented above clearly indicates that the reduction of CCT3 induces cellular senescence in ccRCC cells.
Knockdown of exportin 1 inhibited the invasion and migration abilities of clear cell renal carcinoma cells
Based on previous studies, a correlation between CCT3 and RB1 has been established. To investigate how CCT3 regulates the p53/RB1 signaling pathway, we utilized R programming to identify genes associated with both CCT3 and RB1. The selection criteria were based on differential expression in renal clear cell carcinoma (RCC) and their significance for patient prognosis. We then intersected the CCT3-related genes with the RB1-related genes, ultimately identifying six common genes (Figure 4A). Among these, we focused on the gene XPO1, which is known to regulate the nuclear export of RB1, thereby influencing the cell cycle.
Figure 4.
Knockdown of XPO1 inhibited the invasion and migration abilities of ccRCC cells
(A) The Venn diagram obtained by taking the intersection of the relevant gene sets of CCT3 and RB1 after screening.
(B) Expression level of XPO1 in clear cell RCC from the TCGA database.
(C) The immunohistochemical results of XPO1 in ccRCC and normal renal tissue in the HPA database.
(D) A Kaplan-Meier curve illustrates OS in patients with ccRCC from low and high XPO1 expression groups.
(E) The promoter methylation level of XPO1 in KIRC from the TCGA database.
(F) Western blot analysis was performed to assess the protein expression of XPO1 in CCT3-depleted cells. (G) Using Spearman correlation analysis, the correlation between Gene CCT3 and XPO1 expression, and the correlation between XPO1 and RB1 expression.
(H) Wound-healing assay indicates that XPO1 knockdown suppresses the viability of 786-O and 769-P cells.
(I) Transwell assay indicates impaired abilities of migration and invasion of 769-P and 786-O cells. (Scale bars, 100 μm, all data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001). Two-tailed Student’s t test for B and E. Student’s t test for F, H, and I.
First, we analyzed data from the TCGA database, which revealed that XPO1 is upregulated in ccRCC and related to tumor grade and nodal metastasis status (Figures S1D and S1E), a finding further validated by the HPA database (Figures 4B and 4C). Additionally, we predicted that XPO1 is associated with poor prognosis in patients with RCC (Figures 4D and 4E). Similarly, we also found that XPO1 expression is elevated in cancer tissues compared to adjacent non-cancerous tissues in our four pairs of clinical samples (Figure S1G). To further confirm whether XPO1 can be regulated by CCT3, we conducted Western blot experiments, which demonstrated that the expression of XPO1 decreased in tandem with the downregulation of CCT3 (Figure 4F). We also investigated the correlation among Gene CCT3, XPO1, and RB1. Using Spearman correlation analysis, the results indicated that the correlation coefficient between CCT3 and XPO1 was 0.32 (p < 0.001), while the correlation coefficient between XPO1 and RB1 was 0.62 (p < 0.001) (Figure 4G). Additionally, the analysis revealed that, such as CCT3, XPO1 is also associated with the p53/Rb signaling pathway (Figure S1F).
To investigate the role of XPO1 in renal clear cell carcinoma, we performed scratch assays and found that knockdown of XPO1 significantly reduced the migratory capacity of both 786-O and 769-P cells (Figure 4H). Additionally, we conducted transwell assays, which revealed that the knockdown of XPO1 inhibited the invasion and migration abilities of the cells (Figure 4I). These findings suggest that XPO1 may be a downstream target of CCT3, thereby regulating RB1 and influencing the cell cycle.
The reduction of exportin 1 induces cellular senescence in clear cell renal carcinoma cells
To investigate whether XPO1 affects the senescence of clear cell renal carcinoma, we first performed Western blot analysis to measure the expression levels of CDK4, Cyclin D, and p-Rb (Ser807/811) after knockdown of XPO1 in two cell lines. The results indicated that, similar to CCT3, knockdown of XPO1 also led to cell-cycle arrest (Figure 5A). Subsequently, we validated the changes in the senescence-associated secretory phenotype (SASP) using qRT-PCR, which revealed that IL-1A and TNF levels increased following XPO1 knockdown (Figure 5B). Additionally, using an aging detection kit, we found an increase in cellular senescence after XPO1 knockdown (Figure 5C). To further assess the state of the cell cycle, we employed a cell cycle assay kit, which showed an increase in the G1 phase and a decrease in the S phase, confirming cell-cycle arrest (Figure 5D). Finally, we evaluated cell proliferation using the EdU assay and found that treatment with the XPO1 inhibitor Selinexor significantly suppressed cell proliferation (Figure 5E). These results collectively indicate that XPO1 can inhibit the senescence of renal cancer cells.
Figure 5.
The reduction of XPO1 induces cellular senescence in ccRCC cells
(A) Western blot analysis was performed to assess the protein expression of CDK4, CyclinD, p-Rb (Ser807/811) in XPO1 knockdown cells.
(B) The mRNA expression levels of senescence-associated genes, including interleukin 1 A, TNF, CDK2, CDK4, and CDK6 in XPO1-depleted cells were examined by qRT-PCR.
(C) Changes of SA-β-gal activity in XPO1-knockdown cells. Data represent the percentage of cells staining positive for SA-β-gal ±SD.
(D) Cell cycle analysis calculated the distribution of the cells in G1, S, and G2/M phases.
(E) The proliferative abilities of 769-P and 786-O cells, which were treated with the XPO1 inhibitor Selinexor, were measured with an EdU staining assay. (Scale bars, 100 μm, all data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001). Student’s t test.
Chaperonin containing TCP1 subunit 3 regulates RB1 activity by influencing the stability of the exportin 1 protein
Due to the well-established role of CCT3 in protein folding, we hypothesized that CCT3 regulates RB1 activity by influencing the correct folding and stability of the XPO1 protein. XPO1, in turn, can affect the nuclear export of cell cycle-related proteins such as RB, ultimately modulating the cell cycle and impacting cellular senescence. To test this hypothesis, we first conducted a co-immunoprecipitation (Co-IP) experiment to confirm the interaction between CCT3 and XPO1, and the results indicated that XPO1 indeed interacts with CCT3 (Figure 6A). Since CCT3 exerts its function through direct binding to downstream targets, we also performed a pull-down assay using a GST tag on CCT3. The results showed that GST alone did not bind to XPO1, but the GST-CCT3 fusion successfully interacted with XPO1, confirming that XPO1 can directly associate with CCT3 (Figure 6B).
Figure 6.
CCT3 regulates RB1 activity by influencing the stability of the XPO1 protein
(A) The Co-IP was performed to analyze the endogenous interaction between CCT3 and XPO1 in ccRCC cells. protein pellets were analyzed by Western blot with anti-CCT3 and anti-XPO1 antibodies.
(B) Pull-down of CCT3, XPO1, and CCT3 with GST-tagged was analyzed by Western Blot.
(C) Western blot analysis of XPO1 in control or CCT3–knockdown cells treated with CHX for the times indicated.
(D) Western blot analysis of XPO1 in control or CCT3–knockdown cells treated with BafA1.
(E) Western blot analysis of XPO1 in control or CCT3–knockdown cells treated with MG132.
(F) Visualization results of the CCT3 and XPO1 molecular docking. (All data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001). One-way ANOVA for C, Student’s t test for D and E.
Next, to determine whether CCT3 affects the stability of XPO1, we treated both control and CCT3 knockdown groups with cycloheximide (CHX) for 0, 1, 2, and 4 h, followed by Western blot analysis. The results revealed that knocking down CCT3 accelerated the degradation of XPO1 in the presence of CHX, indicating that CCT3 promotes the stability of XPO1 (Figure 6C). To further validate this finding, cells were treated with BafA1 and MG132. While XPO1 degradation was unaffected by CCT3 knockdown in the presence of MG132, its degradation was significantly accelerated upon CCT3 knockdown in the presence of BafA1. This suggests that the reduced stability of XPO1 following CCT3 knockdown is mediated by a BafA1-dependent pathway (Figures 6D and 6E). This suggests that CCT3 influences XPO1 stability through the lysosome rather than the proteasome. To comprehensively evaluate the binding potential between CCT3 and XPO1, we further performed protein-protein molecular docking simulations using the HADDOCK2.4 platform. The simulation results revealed that the most favorable binding pose between CCT3 and XPO1 exhibited a binding energy of −15.3 kcal/mol, strongly indicating a significant binding affinity. In-depth analysis of this docking model unveiled diverse interaction patterns at the binding interface, for example, the residue GLU-207 of CCT3 forms a specific hydrogen bond with the residue THR-885 of XPO1. Collectively, these results corroborate the potential for a robust interaction between CCT3 and XPO1 (Figure 6F). To further elucidate, we performed co-localization analysis of XPO1 and LC3. The results showed that both XPO1 and LC3 could be localized to the cytoplasm (Figure S2F).
Previous studies have established that RB1 is a downstream target of XPO1. To determine whether CCT3 regulates RB1 through XPO1, we conducted rescue experiments. Western blot analysis reveals that knockdown of both CCT3 and XPO1 increases the nuclear localization of RB1 (Figure 7A). This suggests that CCT3 may regulate the nucleocytoplasmic shuttling of RB1 through XPO1. Given that RB1 plays a crucial role in cell cycle regulation, these findings indicate that CCT3 and XPO1 could influence cell cycle progression. Overexpression of CCT3 in A498 cells led to elevated levels of p-Rb (Ser807/811) and Cyclin D, indicating a promotion of cell cycle progression. Notably, subsequent knockdown of XPO1 significantly reversed these changes, mitigating the cell cycle-promoting effects of CCT3 overexpression (Figure 7B). In senescence staining experiments, to robustly induce cellular senescence, we first treated the cells with 500 μM hydrogen peroxide (H2O2) for 24 h. Following this established induction protocol, we then proceeded with further experiments. Our results demonstrated that the overexpression of CCT3 significantly inhibited H2O2-induced cellular senescence. Conversely, knockdown of XPO1 partially abrogated this inhibitory effect observed with CCT3 overexpression (Figures 7C and S2A–S2C). In the scratch assay, overexpression of CCT3 promoted cell migration and wound healing. However, knockdown of XPO1 significantly attenuated this effect, delaying the wound healing process (Figure 7D). Transwell assays further confirmed that knockdown of XPO1 could reverse the enhanced cell migration and invasion capacities induced by CCT3 overexpression (Figure 7E). Collectively, these experiments demonstrated that CCT3, by regulating the nucleocytoplasmic distribution of RB1 via XPO1, affects cell cycle progression and ultimately inhibits cellular senescence.
Figure 7.
Rescue experiments demonstrate the effects of CCT3 overexpression and XPO1 knockdown on cell function
(A) Western blot was used to detect the expression of RB1 and Cyclin D in nuclear and cytoplasmic fractions of cells.
(B) Western blot analysis was performed to assess the protein expression of Cyclin D, p-Rb (Ser807/811) in the rescue assay.
(C) Senescence β-Galactosidase Staining in rescue assay.
(D) A healing assay was performed in the rescue assay.
(E) Transwell assay was performed in the rescue assay. (Scale bars, 100 μm, all data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001). One-way ANOVA for D, E.
Knockdown of chaperonin containing TCP1 subunit 3 combined with a selective exportin 1 inhibitor can promote cellular senescence to suppress tumor progression in vivo
To further validate the roles of CCT3 and XPO1 in vivo, we inoculated the 769-P cell line subcutaneously into nude mice. The selective XPO1 inhibitor Selinexor was administered orally at a dose of 15 mg/kg, twice a week for three weeks. Tumor size was monitored every five days (Figure 8A). The final results showed that both CCT3 knockdown and treatment with the XPO1 inhibitor significantly suppressed tumor size compared to the control group. Notably, the most pronounced tumor inhibition occurred when CCT3 was knocked down in conjunction with continued drug treatment (Figures 8B and 8C). We also collected tumor tissues and extracted proteins for Western blot analysis, which corroborated the in vitro findings. Both CCT3 knockdown and Selinexor treatment led to the diminished expression of CDK4, Cyclin D, and PCNA while increasing p53 levels (Figure 8D). This indicates a subsequent cell-cycle arrest and inhibition of tumor proliferation. Furthermore, we used immunohistochemistry and immunofluorescence assays to further confirm that both CCT3 knockdown and Selinexor treatment reduced tumor proliferation capacity, with the combination of CCT3 knockdown and the selective XPO1 inhibitor demonstrating the most significant suppressive effect (Figures 8E and 8F). These findings highlight the critical roles of CCT3 and XPO1 in inducing senescence and inhibiting tumor growth in xenograft models.
Figure 8.
Knockdown of CCT3 combined with a selective XPO1 inhibitor can promote cellular senescence to suppress tumor progression in vivo
(A) Nude mice were used to establish a tumor xenograft model utilizing CCT3 knockdown cell lines and the selective XPO1 inhibitor, Selinexor.
(B and C) The tumor volumes and tumor weight of each group.
(D) Western blot analysis was performed to assess the protein expression of p53, Cyclin D, CDK4, and PCNA in tissue.
(E and F) The immunohistochemistry and immunofluorescence assays of Ki67. (Scale bars, 100 μm. All data were shown as the mean ± SD (n = 3 per group), ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001). Repeated measures ANOVA for B and C. One-way ANOVA for D and E.
Discussion
Our study demonstrates that CCT3 is significantly overexpressed in ccRCC and correlates with poor prognosis. Mechanistically, CCT3 stabilizes XPO1, leading to increased nuclear export of RB1 and suppression of cellular senescence. Knockdown of CCT3 or inhibition of XPO1 with Selinexor induces senescence and inhibits tumor growth in vitro and in vivo.
CCT3, as a molecular chaperone, enhances the stability of XPO1 by facilitating its proper folding. XPO1, in turn, promotes the nuclear export of RB1, reducing its tumor-suppressive functions in the nucleus. RB1 in its unphosphorylated state inhibits the entry of cells into the S phase (cell-cycle arrest), while its phosphorylated form (p-Rb (Ser807/811)) relieves this inhibition, promoting the progression of cells toward DNA replication and division.34 This mechanism highlights the critical role of the CCT3-XPO1-RB1 axis in ccRCC progression and provides a potential therapeutic target.
Our findings align with previous studies showing that XPO1 overexpression promotes tumor progression by exporting tumor suppressors such as p53 and RB1.29 However, this is the first study to link CCT3 to XPO1 stability and RB1-mediated senescence in ccRCC. The dual regulation of RB1 and p53 by the CCT3-XPO1 axis underscores its broad impact on cellular senescence and tumor suppression.
Among nuclear export proteins, only XPO1 is responsible for transporting nuclear proteins containing nuclear export signals (NES), such as p53, RB1, and p27, playing a regulatory role in various solid tumors and serving as a potential target for cancer therapy.18,29 Selective inhibitors of XPO1 include KPT-185, KPT-251, KPT-276, selinexor, eltanexor, and verdinexor, with selinexor being the most well-known.14,16,18,35 The safety and efficacy of selinexor have been assessed in multiple clinical trials, and it has been approved by the FDA for the treatment of certain types of hematological cancers, such as multiple myeloma.20,21,23,35,36 Additionally, studies have shown that combining selinexor with cell cycle inhibitors can synergistically induce senescence in liver cancer cells both in vitro and in vivo.37 The CCT3-XPO1-RB1 axis represents a promising therapeutic target for ccRCC. Selinexor, an XPO1 inhibitor, has shown efficacy in hematologic malignancies and may have potential in ccRCC, particularly in combination with other therapies such as immune checkpoint inhibitors.37,38 Future studies should explore the synergistic effects of Selinexor with existing treatments to improve patient outcomes.
The role of cellular senescence in cancer treatment is receiving increasing attention. The most direct tumor suppressive mechanism of cellular senescence is that senescent cells cease proliferating, thereby preventing the uncontrolled proliferation of cancer cells. Additionally, some components of the Senescence-Associated Secretory Phenotype (SASP) can enhance cell-cell adhesion, thereby reducing the invasiveness and metastatic potential of tumor cells.31,39
In summary, our findings highlight the critical role of CCT3 in regulating XPO1 stability and its impact on the p53/RB1 pathway in ccRCC. The CCT3-XPO1-RB1 axis suggests a promising avenue for future research, potentially leading to new therapeutic strategies aimed at inducing cancer cell senescence. Future research should investigate the broader role of the CCT3-XPO1 axis in ccRCC, including its impact on other tumor suppressors and signaling pathways. Additionally, the development of more specific XPO1 inhibitors and their combination with other therapeutic modalities warrants further exploration to enhance treatment efficacy.
Limitations of the study
This study has several limitations. First, while our study observed key phenotypes indicative of cellular senescence, namely G1 cell-cycle arrest and SA-β-gal positivity upon CCT3 silencing, we acknowledge limitations in the current dataset that may prevent definitive exclusion of apoptosis or quiescence. Although G1 arrest is a hallmark of cellular senescence, cells can also enter a quiescent state (G0) due to factors such as DNA damage or nutrient limitation, or exhibit cell-cycle arrest in the early stages of apoptosis. Therefore, to unequivocally confirm the precise cellular state induced by CCT3 silencing, further investigation using more specific markers is warranted in future studies. Second, we focused on the p53/RB1 pathway and did not explore other senescence mechanisms, such as DNA damage or telomerase activity. Third, although the interaction between CCT3 and XPO1 has been demonstrated, further investigations are necessary to determine their specific binding sites and affinities. Future studies will also involve co-localization analysis of XPO1 with LAMP1 and other endosomal markers by confocal microscopy to assess its localization and potential role in the endocytic pathway. Finally, the clinical applicability of Selinexor in ccRCC requires validation in larger cohorts and clinical trials.
Resource availability
Lead contact
Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Junfei Gu (junfei_gu2020@hebmu.edu.cn).
Materials availability
All unique/stable reagents generated in this study are available from the lead contact with a completed materials transfer agreement.
Data and code availability
The data underlying this article are available in the article and in its online supplemental information. All original code is available in this article’s supplemental information. Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.
Acknowledgments
This work was supported by the National Natural Science Foundation of China (grant number 82072842), the Natural Science Foundation of Hebei Province (grant number H2022206199), the Yanzhao Golden Talent Program of Hebei Province for 2024 (Returnee Platform, grant number B2024027), and the Post-graduate’s Innovation Fund Project of Hebei Province (grant number CXZZBS2024122).
Author contributions
J.F. Gu provided data curation. Y.L. Cao, C. Xu, and Y.P Liu provided writing – original draft and review and editing. B. Shi and X.L. Li provided the visualization and methodology. J.H. Li and B.W. Zhang provided Formal analysis. Z.Y. Zhang, S.T. Dai, and Q.Y. Sun provided project administration. All authors have reviewed and approved the final article.
Declaration of interests
The authors declare no competing interests.
STAR★Methods
Key resources table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| ACTIN | Proteintech | Cat#20536-1-AP; RRID: AB_10700003 |
| GAPDH | Proteintech | Cat#60004-1-Ig; RRID: AB_2107436 |
| Tublin | Proteintech | Cat#14555-1-AP; RRID: AB_2212258 |
| Lamin B | Proteintech | Cat#12987-1-AP; RRID: AB_2136290 |
| CCT3 | Proteintech | Cat#10571-1-AP; RRID: AB_2073658 |
| CDK4 | Proteintech | Cat#11026-1-AP; RRID: AB_2078702 |
| Cyclin D | Proteintech | Cat#26939-1-AP; RRID: AB_2880691 |
| Rb1 | Proteintech | Cat#10048-2-Ig; RRID: AB_2177320 |
| Phospho-RB1 (Ser807/811) | Proteintech | Cat#30376-1-AP; RRID: AB_3085351 |
| p21 | Proteintech | Cat#10355-1-AP; RRID: AB_2077682 |
| CRM1 | Santa | Cat#sc-374124; RRID: AB_10917075 |
| XPO1 | Proteintech | Cat#27917-1-AP; RRID: AB_2881009 |
| Biological samples | ||
| BALB/c nude | Beijing Biotechnology Co., Ltd. | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| RPMI 1640 medium | Gibco | Cat#11875119 |
| Fetal bovine serum | Gibco | Cat#10270107 |
| Trypsin-EDTA | Gibco | Cat#3043768 |
| Cycloheximide | MCE | CAS 66-81-9 |
| BafA1 | MCE | CAS 88899-55-2 |
| MG132 | MCE | CAS 133407-82-6 |
| Critical commercial assays | ||
| Senescence β-Galactosidase Staining Kit | Beyotime | C0602 |
| PE/7-AAD Apoptosis Detection Kit | Vazyme | A213-01/02 |
| EdU Cell Proliferation Kit | Beyotime | C0071S |
| Experimental models: Cell lines | ||
| Human: 786-O | Procell LifeScience & Technology Co., Ltd | - |
| Human: 769-P | Procell LifeScience & Technology Co., Ltd | - |
| Human: A498 | Procell LifeScience & Technology Co., Ltd | - |
| Human: ORSC2 | Procell LifeScience & Technology Co., Ltd | - |
| Oligonucleotides | ||
| CCT3-F | sangon | AAGTCCATGATCGAAATTAGCCG |
| CCT3-R | Sangon | TGCTCAGCTACAGACAGCATT |
| IL-1A-F | Sangon | GGTTGAGTTTAAGCCAATCCA |
| IL-1A-R | Sangon | TGCTGACCTAGGCTTGATGA |
| TNF-F | Sangon | TCCAGGCGGTGCTTGTTC |
| TNF-R | Sangon | GGCTACAGGCTTGTCACTCG |
| CDK4-F | Sangon | TCAGCACAGTTCGTGAGGTG |
| CDK4-R | sangon | GTCCATCAGCCGGACAACAT |
| XPO1-F | Sangon | AGCAAAGAATGGCTCAAGAAG |
| XPO1-R | Sangon | TATTCCTTCGCACTGGTTCCT |
| Recombinant DNA | ||
| shCCT3-1# and constructs | This paper. | N/A |
| shCCT3-2# and constructs | This paper. | N/A |
| shXPO1 and constructs | This paper. | N/A |
| Deposited data | ||
| Code for analysis | This paper | N/A |
| Software and algorithms | ||
| Rstdio | Rstdio | Version 4.1.3 |
| GraphPad Prism | GraphPad | Version 8.0 |
Experimental model and study participation details
Cell lines and cell culture
The cell lines 786-O, 769-P, A498 and OSRC2 were provided by Procell (Procell LifeScience & Technology Co., Ltd). A498 cells were grown in minimum essential medium (Gibco, USA) with the addition of 10% fetal bovine serum (Gibco, USA) and 1% streptomycin (Solarbio, China). Meanwhile, the 786-O, 769-P and OSRC2 cells were maintained in RPMI-1640 medium (Gibco, USA) with the same concentrations of fetal bovine serum and streptomycin. All cell lines were kept in a humidified incubator at 37°C with 5% CO2.
Clinical samples
Clear cell renal carcinoma (ccRCC) tissues and matched adjacent normal tissues (n=4 pairs) were obtained from patients diagnosed at The Second Hospital of Hebei Medical University between 2023 and 2025. This study was approved by the Ethics Committee of the Second Hospital of Hebei Medical University, and informed consent was obtained from all patients (approval number: 2024-R243).
Tumor xenografts in nude mice
All procedures involving mice were approved by the University Committee on Use and Care of Animals at Hebei Medical University (approval number:2024-R243). Male nude mice (3 weeks old) were purchased from SPF (Beijing) Biotechnology Co., Ltd. and held under specific pathogen-free conditions. Mice were housed in a temperature- (22 ± 1°C).
Method details
Online databases
The UALCAN (http://ualcan.path.uab.edu) online database was utilized to determine the protein expression levels of CCT3 across various cancers and to explore its relationship with signaling pathways. The GEPIA (http://gepia.cancer-pku.cn) database was employed to analyze the correlation between CCT3 and RB1. Additionally, the GSCA (http://gsca.life) database was used to predict the prognostic implications of CCT3 in KIRC. The Human Protein Atlas (HPA) (https://www.proteinatlas.org) database was utilized to analyze the expression levels of CCT3 in renal clear cell carcinoma tissues.
Reagent
The XPO1 inhibitor Selinexor, CHX, BafA1, and MG132 were all purchased from MCE, American. CHX was used at a concentration of 100 μg/ml and treated for 0, 1, 2, and 4 hours. MG132 was used at a concentration of 100 μM for an 8-hour treatment, while BafA1 was used at 200 nM for a 24-hour treatment. Selinexor, a selective XPO1 inhibitor, was purchased from MCE. For in vitro experiments, Selinexor was dissolved in dimethyl sulfoxide (DMSO) at a stock concentration. For EdU staining, SA-β-gal staining, and migration assays, cells were treated with Selinexor at a concentration of 100 μM for 24 hours. For all in vitro experiments, it was applied such that the final concentration of DMSO in the cell culture medium was 0.1%.
Western blot assays
Cells were collected using cold 1X PBS and then centrifuged at 5000 rpm. The pellet was subsequently resuspended in RIPA buffer and incubated on ice for 30 minutes. After centrifugation at 13000 rpm for 10 minutes at 4°C, protein concentration was measured using the BCA method. Finally, samples were boiled for 10 minutes. Thirty micrograms (30 μg) of protein was quantified and loaded onto SDS-PAGE. After transfer to a PVDF membrane, the membrane was blocked with 5% non-fat milk for 2 hours. Subsequently, the samples were incubated overnight with primary antibodies at 4°C. On the following day, incubation with the corresponding secondary antibodies was performed for 2 hours. All antibody information is provided in Table S1.
mRNA isolation and qRT-PCR
RNA was extracted using the RNA Extraction Kit (SM130, SEVEN, China) and subsequently reverse-transcribed with Superscript III reverse transcriptase (Invitrogen). The mRNA expression levels of the target genes were quantified using the Bio-Rad CFX96 system with SYBR Green through fluorescent quantitative reverse transcription PCR (qRT–PCR). Gene expression was normalized to GAPDH levels. The qRT–PCR protocol consisted of the following steps: an initial denaturation at 50°C for 2 minutes, followed by a pre-denaturation step at 95°C for 8 minutes and 30 seconds, and then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The protocol concluded with a melt curve analysis consisting of a ramp from 95°C to 55°C over 1 minute and a final hold at 55°C for 10 seconds. The primer sequences are provided in Table S2.
Would healing assay
First, culture the 786-O and 769-P cells in an appropriate medium until they reach 80-90% confluence. Then, use a sterile pipette or scraper to gently make uniform scratches on the cell monolayer. Next, gently wash the cells with PBS to remove any detached cells, and add fresh medium, along with any drugs or treatments if necessary. After the scratches are made, immediately take photos to record the baseline, and continue to culture the cells under suitable temperature and CO2 conditions, after 12 hours, taking regular photos to observe the healing of the scratches. Finally analyze the migration and healing of the cells by comparing photos.
Migration and invasion assay
At the start of the experiment, 786-O and 769-P cells were cultured until they reached the logarithmic growth phase. Subsequently, the cell suspension was added to the upper chamber of the Transwell. For invasion assays, a matrix gel (Corning, diluted 1:5) was first added to the upper chamber and allowed to solidify. Meanwhile, culture medium was added to the lower chamber. The entire setup was then incubated in a 37°C, 5% CO2 environment for 24 hours. After incubation, non-migrated cells in the upper chamber were gently wiped away, and the number of cells that migrated to the lower chamber was assessed through cell counting. Finally, statistical analysis was performed on the experimental data, and the observations were recorded.
Edu staining
Edu staining was conducted following the instructions provided in the Edu Cell Proliferation Kit (Beyotime) manual. First, seed the cells into a six-well plate and incubate with EDU reagent for 2 hours. Fix the cells using a fixation solution and wash them with PBS. Next, stain the cells with a fluorescently labeled secondary antibody, followed by DAPI staining to visualize the nuclei. Finally, observe the cells under a fluorescence microscope and count the number of EDU-positive cells to analyze cell proliferation.
Senescence β-galactosidase staining and immunofluorescence assay
The Senescence β-galactosidase Staining Kit was gained from Beyotime, and the experiment was performed according to the manufacturer's instructions. First, an appropriate number of cells were seeded into a six-well plate. After fixation, the cells were washed with PBS and then treated with the working solution, which was incubated at 37°C overnight. The following day, the cells were observed and counted under the microscope.
For the IF assay, first, seed the cells of interest onto a coverslip and culture them to an appropriate density. Next, fix the cells using a 4% paraformaldehyde solution and wash with PBS to remove any excess fixative. Subsequently, treat the cells with Triton X-100, to facilitate antibody penetration. Afterward, apply a blocking solution to minimize nonspecific binding, followed by incubation with the primary antibody, typically performed overnight at 4°C. After washing, incubate the cells with a fluorophore-conjugated secondary antibody. Finally, wash the cells with PBS and observe the fluorescence signals using a fluorescence microscope for analysis.
Immunohistochemical
After fixing the tissue samples, they are dehydrated and embedded in paraffin, then sectioned into thin slices and mounted on glass slides. The slides are subsequently deparaffinized using xylene and gradually rehydrated through a series of ethanol solutions (100%, 95%, and 70%). Following heat-induced antigen retrieval, the sections are treated with a blocking solution, after which the corresponding primary antibody is added and incubated overnight at 4°C. The next day, a labeled secondary antibody is introduced and incubated for 2 hours. Finally, the sections undergo a DAB chromogenic reaction, followed by counterstaining with hematoxylin to enhance nuclear visualization, and are then coverslipped for observation under a microscope.
Molecular docking
Using HADDOCK 2.4, CCT3 and XPO1 were docked based on known interaction sites. The best models were selected and their binding energies were calculated with ProDIGY. Finally, PyMOL 3.1 was used to visualize the docked complex and analyze the interaction interface.
Animals
Twelve male BALB/c nude mice, aged between 3 to 5 weeks, were obtained from SPF (Beijing) Biotechnology Co., Ltd. For this study, the mice were randomly allocated into four experimental groups. All animal studies received approval from the Animal Care and Use Committee at the Second Hospital of Hebei Medical University and were carried out in line with ethical guidelines for the treatment of animals. To establish a subcutaneous renal cancer xenograft model, each nude mouse was injected with 1 × 10ˆ7 cells. The selective XPO1 inhibitor Selinexor was administered orally at a dose of 15 mg/kg, twice a week for three weeks. Three weeks later, the mice were euthanized using cervical dislocation, and tumor volume was calculated using the formula: Volume (mm3) = Width (mm) × Width (mm) × Length (mm) / 2. The allocation of animals to the control and experimental groups was performed using randomization and blinding techniques.
Lentiviral production and generation of stable cell lines
Short hairpins targeting CCT3 and XPO1 were subcloned into pLKO.1-puro vector. Lentivirus expressing shRNA was produced by transfecting shRNA vector and pMD2.G plasmids into 293 T cells. Cells were infected by lentivirus and then selected for stable expression with puromycin for seven days.
Quantification and statistical analysis
Statistical analyses were conducted using R Version 4.1.3, while data visualization was carried out with GraphPad Prism Version 8.0.0. Pearson and Spearman correlation coefficients were utilized to assess the associations between variables, considering a p-value of less than 0.05 as statistically significant. The data are expressed as the means ± SDs from three independent experiments. Differences between groups were analyzed by Student’s t test (two groups) or one-way ANOVA (≥3 groups) via GraphPad Prism 8.0. A two-tailed p-value of ∗p ≤ 0.05, ∗∗p ≤ 0.01, and ∗∗∗p ≤ 0.001 was considered statistically significant. The statistical details of experiments can be found in the figure legends.
Published: January 29, 2026
Footnotes
Supplemental information can be found online at https://doi.org/10.1016/j.isci.2026.114840.
Supplemental information
References
- 1.Capitanio U., Bensalah K., Bex A., Boorjian S.A., Bray F., Coleman J., Gore J.L., Sun M., Wood C., Russo P. Epidemiology of Renal Cell Carcinoma. Eur. Urol. 2019;75:74–84. doi: 10.1016/j.eururo.2018.08.036. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Li Y., Lih T.S.M., Dhanasekaran S.M., Mannan R., Chen L., Cieslik M., Wu Y., Lu R.J.H., Clark D.J., Kołodziejczak I., et al. Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness. Cancer Cell. 2023;41:139–163.e17. doi: 10.1016/j.ccell.2022.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Rose T.L., Kim W.Y. Renal Cell Carcinoma: A Review. JAMA. 2024;332:1001–1010. doi: 10.1001/jama.2024.12848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Moch H., Amin M.B., Berney D.M., Compérat E.M., Gill A.J., Hartmann A., Menon S., Raspollini M.R., Rubin M.A., Srigley J.R., et al. The 2022 World Health Organization Classification of Tumours of the Urinary System and Male Genital Organs-Part A: Renal, Penile, and Testicular Tumours. Eur. Urol. 2022;82:458–468. doi: 10.1016/j.eururo.2022.06.016. [DOI] [PubMed] [Google Scholar]
- 5.Rosellini M., Marchetti A., Mollica V., Rizzo A., Santoni M., Massari F. Prognostic and predictive biomarkers for immunotherapy in advanced renal cell carcinoma. Nat. Rev. Urol. 2023;20:133–157. doi: 10.1038/s41585-022-00676-0. [DOI] [PubMed] [Google Scholar]
- 6.Gestaut D., Limatola A., Joachimiak L., Frydman J. The ATP-powered gymnastics of TRiC/CCT: an asymmetric protein folding machine with a symmetric origin story. Curr. Opin. Struct. Biol. 2019;55:50–58. doi: 10.1016/j.sbi.2019.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Tahmaz I., Shahmoradi Ghahe S., Topf U. Prefoldin Function in Cellular Protein Homeostasis and Human Diseases. Front. Cell Dev. Biol. 2021;9 doi: 10.3389/fcell.2021.816214. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zeng C., Han S., Pan Y., Huang Z., Zhang B., Zhang B. Revisiting the chaperonin T-complex protein-1 ring complex in human health and disease: A proteostasis modulator and beyond. Clin. Transl. Med. 2024;14 doi: 10.1002/ctm2.1592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Temiz E., Koyuncu İ., Sahin E. CCT3 suppression prompts apoptotic machinery through oxidative stress and energy deprivation in breast and prostate cancers. Free Radic. Biol. Med. 2021;165:88–99. doi: 10.1016/j.freeradbiomed.2021.01.016. [DOI] [PubMed] [Google Scholar]
- 10.Zhu H., Liu Q., Meng Q., Zhang L., Ju S., Lang J., Zhu D., Chen Y., Aishan N., Ouyang X., et al. CCT3/ACTN4/TFRC axis protects hepatocellular carcinoma cells from ferroptosis by inhibiting iron endocytosis. J. Exp. Clin. Cancer Res. 2024;43:245. doi: 10.1186/s13046-024-03169-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Macario A.J.L., Conway de Macario E. Chaperonins in cancer: Expression, function, and migration in extracellular vesicles. Semin. Cancer Biol. 2022;86:26–35. doi: 10.1016/j.semcancer.2021.05.029. [DOI] [PubMed] [Google Scholar]
- 12.Liu Y., Zhang X., Lin J., Chen Y., Qiao Y., Guo S., Yang Y., Zhu G., Pan Q., Wang J., Sun F. Correction: CCT3 acts upstream of YAP and TFCP2 as a potential target and tumour biomarker in liver cancer. Cell Death Dis. 2022;13:598. doi: 10.1038/s41419-022-05012-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Martins F., Sousa J., Pereira C.D., da Cruz E Silva O.A.B., Rebelo S. Nuclear envelope dysfunction and its contribution to the aging process. Aging Cell. 2020;19 doi: 10.1111/acel.13143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Azmi A.S., Uddin M.H., Mohammad R.M. The nuclear export protein XPO1 - from biology to targeted therapy. Nat. Rev. Clin. Oncol. 2021;18:152–169. doi: 10.1038/s41571-020-00442-4. [DOI] [PubMed] [Google Scholar]
- 15.Yang Y., Guo L., Chen L., Gong B., Jia D., Sun Q. Nuclear transport proteins: structure, function, and disease relevance. Signal Transduct. Target. Ther. 2023;8:425. doi: 10.1038/s41392-023-01649-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chen Y.F., Adams D.J. Therapeutic targeting of exportin-1 beyond nuclear export. Trends Pharmacol. Sci. 2025;46:20–31. doi: 10.1016/j.tips.2024.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Lai C., Xu L., Dai S. The nuclear export protein exportin-1 in solid malignant tumours: From biology to clinical trials. Clin. Transl. Med. 2024;14 doi: 10.1002/ctm2.1684. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Azizian N.G., Li Y. XPO1-dependent nuclear export as a target for cancer therapy. J. Hematol. Oncol. 2020;13:61. doi: 10.1186/s13045-020-00903-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gasparetto C., Schiller G.J., Tuchman S.A., Callander N.S., Baljevic M., Lentzsch S., Rossi A.C., Kotb R., White D., Bahlis N.J., et al. Once weekly selinexor, carfilzomib and dexamethasone in carfilzomib non-refractory multiple myeloma patients. Br. J. Cancer. 2022;126:718–725. doi: 10.1038/s41416-021-01608-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Vergote I., Pérez-Fidalgo J.A., Hamilton E.P., Valabrega G., Van Gorp T., Sehouli J., Cibula D., Levy T., Welch S., Richardson D.L., et al. Oral Selinexor as Maintenance Therapy After First-Line Chemotherapy for Advanced or Recurrent Endometrial Cancer. J. Clin. Oncol. 2023;41:5400–5410. doi: 10.1200/JCO.22.02906. [DOI] [PubMed] [Google Scholar]
- 21.Chari A., Vogl D.T., Gavriatopoulou M., Nooka A.K., Yee A.J., Huff C.A., Moreau P., Dingli D., Cole C., Lonial S., et al. Oral Selinexor-Dexamethasone for Triple-Class Refractory Multiple Myeloma. N. Engl. J. Med. 2019;381:727–738. doi: 10.1056/NEJMoa1903455. [DOI] [PubMed] [Google Scholar]
- 22.Lin K.H., Rutter J.C., Xie A., Killarney S.T., Vaganay C., Benaksas C., Ling F., Sodaro G., Meslin P.A., Bassil C.F., et al. P2RY2-AKT activation is a therapeutically actionable consequence of XPO1 inhibition in acute myeloid leukemia. Nat. Cancer. 2022;3:837–851. doi: 10.1038/s43018-022-00394-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Kalakonda N., Maerevoet M., Cavallo F., Follows G., Goy A., Vermaat J.S.P., Casasnovas O., Hamad N., Zijlstra J.M., Bakhshi S., et al. Selinexor in patients with relapsed or refractory diffuse large B-cell lymphoma (SADAL): a single-arm, multinational, multicentre, open-label, phase 2 trial. Lancet Haematol. 2020;7:e511–e522. doi: 10.1016/S2352-3026(20)30120-4. [DOI] [PubMed] [Google Scholar]
- 24.Di Micco R., Krizhanovsky V., Baker D., d'Adda di Fagagna F. Cellular senescence in ageing: from mechanisms to therapeutic opportunities. Nat. Rev. Mol. Cell Biol. 2021;22:75–95. doi: 10.1038/s41580-020-00314-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Lucas V., Cavadas C., Aveleira C.A. Cellular Senescence: From Mechanisms to Current Biomarkers and Senotherapies. Pharmacol. Rev. 2023;75:675–713. doi: 10.1124/pharmrev.122.000622. [DOI] [PubMed] [Google Scholar]
- 26.Li X., Li C., Zhang W., Wang Y., Qian P., Huang H. Inflammation and aging: signaling pathways and intervention therapies. Signal Transduct. Target. Ther. 2023;8:239. doi: 10.1038/s41392-023-01502-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Salam R., Saliou A., Bielle F., Bertrand M., Antoniewski C., Carpentier C., Alentorn A., Capelle L., Sanson M., Huillard E., et al. Cellular senescence in malignant cells promotes tumor progression in mouse and patient Glioblastoma. Nat. Commun. 2023;14:441. doi: 10.1038/s41467-023-36124-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Schmitt C.A., Wang B., Demaria M. Senescence and cancer - role and therapeutic opportunities. Nat. Rev. Clin. Oncol. 2022;19:619–636. doi: 10.1038/s41571-022-00668-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Engeland K. Cell cycle regulation: p53-p21-RB signaling. Cell Death Differ. 2022;29:946–960. doi: 10.1038/s41418-022-00988-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Chaib S., Tchkonia T., Kirkland J.L. Cellular senescence and senolytics: the path to the clinic. Nat. Med. 2022;28:1556–1568. doi: 10.1038/s41591-022-01923-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Dong Z., Luo Y., Yuan Z., Tian Y., Jin T., Xu F. Cellular senescence and SASP in tumor progression and therapeutic opportunities. Mol. Cancer. 2024;23:181. doi: 10.1186/s12943-024-02096-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chandrashekar D.S., Karthikeyan S.K., Korla P.K., Patel H., Shovon A.R., Athar M., Netto G.J., Qin Z.S., Kumar S., Manne U., et al. UALCAN: An update to the integrated cancer data analysis platform. Neoplasia. 2022;25:18–27. doi: 10.1016/j.neo.2022.01.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Zhang Y., Chen F., Donehower L.A., Scheurer M.E., Creighton C.J. A pediatric brain tumor atlas of genes deregulated by somatic genomic rearrangement. Nat. Commun. 2021;12:937. doi: 10.1038/s41467-021-21081-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Zhou L., Ng D.S.C., Yam J.C., Chen L.J., Tham C.C., Pang C.P., Chu W.K. Post-translational modifications on the retinoblastoma protein. J. Biomed. Sci. 2022;29:33. doi: 10.1186/s12929-022-00818-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Gravina G.L., Tortoreto M., Mancini A., Addis A., Di Cesare E., Lenzi A., Landesman Y., McCauley D., Kauffman M., Shacham S., et al. XPO1/CRM1-selective inhibitors of nuclear export (SINE) reduce tumor spreading and improve overall survival in preclinical models of prostate cancer (PCa) J. Hematol. Oncol. 2014;7:46. doi: 10.1186/1756-8722-7-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Quintanal-Villalonga A., Durani V., Sabet A., Redin E., Kawasaki K., Shafer M., Karthaus W.R., Zaidi S., Zhan Y.A., Manoj P., et al. Exportin 1 inhibition prevents neuroendocrine transformation through SOX2 down-regulation in lung and prostate cancers. Sci. Transl. Med. 2023;15 doi: 10.1126/scitranslmed.adf7006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Wang H., Yuan S., Zheng Q., Zhang S., Zhang Q., Ji S., Wang W., Cao Y., Guo Y., Yang X., et al. Dual Inhibition of CDK4/6 and XPO1 Induces Senescence With Acquired Vulnerability to CRBN-Based PROTAC Drugs. Gastroenterology. 2024;166:1130–1144.e8. doi: 10.1053/j.gastro.2024.01.025. [DOI] [PubMed] [Google Scholar]
- 38.Arora M., Moser J., Hoffman T.E., Watts L.P., Min M., Musteanu M., Rong Y., Ill C.R., Nangia V., Schneider J., et al. Rapid adaptation to CDK2 inhibition exposes intrinsic cell-cycle plasticity. Cell. 2023;186:2628–2643.e21. doi: 10.1016/j.cell.2023.05.013. [DOI] [PubMed] [Google Scholar]
- 39.Maggiorani D., Le O., Lisi V., Landais S., Moquin-Beaudry G., Lavallée V.P., Decaluwe H., Beauséjour C. Senescence drives immunotherapy resistance by inducing an immunosuppressive tumor microenvironment. Nat. Commun. 2024;15:2435. doi: 10.1038/s41467-024-46769-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The data underlying this article are available in the article and in its online supplemental information. All original code is available in this article’s supplemental information. Any additional information required to reanalyze the data reported in this article is available from the lead contact upon request.