A multiplex TaqMan real-time PCR assay for differential identification of wild-type and vaccine strains of Mycoplasma gallisepticum

Abstract

Mycoplasma gallisepticum (MG) is a major avian respiratory pathogen responsible for chronic respiratory disease and substantial economic losses in the poultry industry worldwide. Live attenuated vaccines, including strains F, ts-11, and 6/85, are widely used for MG control; however, current diagnostic methods are unable to reliably differentiate wild-type MG infections from vaccine strain persistence or replication, complicating surveillance and control programs in vaccinated flocks. In this study, a rapid and discriminatory multiplex TaqMan real-time quantitative PCR (qPCR) assay was developed to simultaneously detect MG and differentiate wild-type strains from the three major commercial live vaccine strains (F, ts-11, and 6/85) in a single reaction. Strain- and species-specific target regions were identified through comparative genomic analysis of 19 MG genomes, and corresponding primers and probes were designed and optimized. Under optimal conditions, the assay exhibited excellent linearity (R² = 0.995-0.998), amplification efficiencies ranging from 85.16% to 96.40%, and a limit of detection of 1 × 10² copies/μL for all targets, demonstrating a 10-fold higher sensitivity than conventional PCR. No cross-reactivity was observed with other common avian pathogens, including NDV, AIV, IBV, FAdV, ILTV, and MS. Application of the assay to clinical poultry samples demonstrated its ability to reliably distinguish vaccine strains from wild-type MG. Using this method, the prevalence of wild-type MG was investigated in 2,564 poultry samples collected in the Guangxi region. The results showed that vaccination was associated with inhibition of wild-type MG infection within flocks, whereas unvaccinated flocks exhibited a wild-type MG infection rate of 58.5% (416/711). In conclusion, this multiplex qPCR assay provides a sensitive and specific tool for differentiating wild-type MG from vaccine strains and may support routine diagnosis and improved control of MG in poultry production systems.

Introduction

Mycoplasma gallisepticum (MG) is one of the most significant pathogens globally, posing a major threat to avian health and poultry productivity. This bacterium primarily colonizes the respiratory mucosa and trachea of chickens, utilizing specific adhesins such as GapA and CrmA. These adhesins impair mucociliary clearance, induce epithelial damage, and cause inflammatory lesions (Limsatanun et al., 2022; Marouf et al., 2022). These pathological changes ultimately result in chronic respiratory disease (CRD) and compromised respiratory function. The substantial economic burden caused by MG infection has established it as a critical constraint on the development of the poultry industry (Kachabi et al., 2023).

Epidemiologically, MG is highly contagious and can spread through both horizontal and vertical transmission (Ishfaq et al., 2020). Infected chicken flocks often remain lifelong carriers of the pathogen, which contributes to the persistent occurrence of local outbreaks (Ishfaq et al., 2020). Concurrently, MG infection significantly reduces production performance, with documented reductions of 10-20% in egg yield in layers and similar declines (10-20%) in weight gain in broilers, collectively undermining operational profitability (Stipkovits and Kempf, 1996). Given these impacts, live attenuated vaccines have become a cornerstone strategy for controlling MG infections in multi-age commercial layer and broiler breeder flocks across many countries, including China (Emam et al., 2020; Galluzzo et al., 2022; Ishfaq et al., 2020; Noormohammadi and Whithear, 2019). Among the commercially available options, the F (Yebio® F36), ts-11 (Vaxsafe® MG ts-11), and 6/85 (Nobilis® MG 6/85) strains are the most widely used MG live vaccines globally. However, both field observations and research indicate that vaccination alone does not guarantee complete protection or eliminate the pathogen from flocks (Abd-el-Motelib and Kleven, 1993; Ferguson et al., 2004). Vaccine limitations can arise from various factors, including improper application, immunosuppression, concurrent infections, or insufficient cross-protection against heterologous field strains (Mugunthan et al., 2023). Consequently, despite vaccination programs, MG outbreaks can still occur in some regions. Therefore, relying solely on live vaccines for MG control is insufficient. Effective management of MG requires a comprehensive approach, combining vaccination with rigorous biosecurity, regular monitoring, and crucially, the culling of MG-positive breeders to achieve the establishment of MG free flock (Gong et al., 2020).

To implement regular monitoring and culling of MG-positive breeding poultry, effective pathogen detection technologies are essential. Current diagnostic methods for MG detection include serological assays (e.g., serum plate agglutination (SPA), enzyme-linked immunosorbent assay (ELISA), bacteriological culture, and molecular techniques such as polymerase chain reaction (PCR) and real-time quantitative PCR (qPCR) (Alqhtani et al., 2023; Kahya et al., 2010; Raviv and Kleven, 2009; Raviv et al., 2008). While these methods are valuable for detecting MG infections, a critical diagnostic challenge remains: they generally lack the discriminatory ability to differentiate between infections caused by wild-type MG strains and those resulting from the replication or persistence of live attenuated vaccine strains (e.g., F, ts-11, 6/85) (Hong et al., 2005). This inability to distinguish between vaccine and wild-type strains poses a significant challenge for infection control, particularly in vaccinated flocks. During suspected MG outbreaks in vaccinated populations, the inability to rapidly identify birds infected with wild-type strains hinders targeted interventions. Faced with diagnostic ambiguity and the need to contain the potential spread of infection, producers may resort to wholesale depopulation of affected units, which imposes severe economic penalties on the operation (Khalifa et al., 2014).

Therefore, the aim of this study was to develop a rapid, specific, and discriminatory multiplex qPCR assay capable of simultaneously differentiating wild-type MG strains from the three predominant live attenuated vaccine strains in a single-tube reaction.

Materiers and methods

Bacterial Strains

This study utilized a total of nine reference strains: Infectious bronchitis virus (IBV, H120), Newcastle disease virus (NDV, Lasota), Avian influenza virus (AIV, H9-SS), Fowl adenovirus (FAdV, AV127), Infectious laryngotracheitis virus (ILTV, K317), Salmonella gallinarum (SG, ATCC54003), Mycoplasma synoviae Str.H (MS, MS-H), Mycoplasma gallisepticum Str.R (MG, MG-R), F (Yebio® F36; Qingdao, China), ts-11 (Vaxsafe® MG; Boehringer Ingelheim, Shanghai, China), and 6/85 (Nobilis® MG 6/85; MSD Animal Health, USA). All reference strains were preserved by Guangxi Center for Animal Disease Control and Prevention.

Primer and Probe Design

To identify genetic regions specific to MG at the species level and to distinguish the three vaccine strains (F, ts-11, 6/85 strain), complete genome sequences of 18 MG strains were retrieved from the NCBI GenBank database. These genomes also strong virulence strains (R and S6 strains). The accession numbers included NZ_CP044225 (ts-11), NZ_CP044224 (6/85), AE015450 (R_low). NC_017503 (F), NZ_CP028146, NZ_CP028147, NZ_CP044226, NC_023030 (S6), NC_017502 (R_High), NC_004829, NC_018406, NC_018407, NC_018408, NC_018409, NC_018410, NC_018411, NC_018412, NC_018413, and NZ_LS991952.

Comparative genomic analyses were performed using MEGA version 11 software to identify candidate genomic regions that were conserved within the MG species but unique to each vaccine strain. The specificity of the selected candidate regions was further evaluated by homology analysis using the BLAST tool available on the NCBI website to exclude potential cross-reactivity with non-target organisms. Only regions showing no significant similarity (identity <70%, coverage <60%) to non-target organisms were considered strain-specific.

Based on the validated strain- and species-specific regions, TaqMan real-time PCR primers and probes were designed using the GenScript online real-time PCR primer design tool (https://www.genscript.com/tools/real-time-pcr-taqman-primer-design-tool). All primers and probes were synthesized by TaKaRa Bio, Inc. (Dalian, China). The sequences of the primers and probes used in this study are listed in Table 1.

Table 1.

Primers and probes designed.

D	Sequence (5′−3′)		Region
MG Universal NZ_LS991952	Forward	GAAGGTGAAACTAAYTCC	218132∼218306
	Reverse	CTTGGATCATCATTCTTTC
	Probe	HEX-AATCCCAATCCCTAAACCCAAGAGT-BHQ
MG F CP001873.1	Forward	GCTCCATCTAGTAGTTATCA	598305∼598403
	Reverse	TGCACTTAAGAAATCTACAAA
	Probe	FAM-CATCCATTCCACCTAATTGACTAGCA-BHQ1
MG TS-11 NZ_CP044225	Forward	AGCACTGTACAATACTTG	879213∼886977
	Reverse	CGACATCAATAGCTACAC
	Probe	CY5-ACACACCCTAAATATCAAACTCGAACA-BHQ3
MG 6/85 NZ_LS991952	Forward	GCTGAGTGATTGTTTTAATC	526057∼526140
	Reverse	ACCTGATTATGTGAATCCTA
	Probe	ROX-AAACACCCGCTCCATTGCTTT-BHQ2

Nucleic Acid Extraction and Preparation of Recombinant Plasmids

Total nucleic acids from IBV, NDV, AIV, FAdV, ILTV, FTV, MS, and all clinical swab samples were extracted using a DNA/RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions.

Recombinant plasmids, pMD18-MS-U, pMD18-F, pMD18-TS-11, and pMD18-6/85, were constructed by cloning specific target gene fragments corresponding to Mycoplasma gallisepticum field strain and vaccine strains (F, ts-11, and 6/85), respectively. All cloning procedures were performed by TaKaRa Bio, Inc. (Dalian, China), and the plasmids were confirmed by Sanger sequencing prior to use as quantitative standards in downstream qPCR assays.

Optimization of multiple reaction systems

Real-time PCR was performed in a total volume of 20 μL according to the manufacturer’s instructions, containing 10 μL of 2 × Premix Ex Taq™ (Probe qPCR), 0.5 μL each of forward and reverse primers (10 μM), 0.1–0.8 μL of TaqMan probe (10 μM), and nuclease-free water to volume.

Annealing temperatures were optimized based on the melting temperatures (Tm) of the primers and were evaluated at 46°C, 48°C, 50°C, and 52°C. The denaturation temperature and duration were set in accordance with the manufacturer’s recommendations. The amplification program consisted of 40 cycles, and fluorescence signals were collected during the extension phase.

To optimize the real-time PCR reaction conditions, the total reaction volume was set to 20 μL according to the manufacturer’s instructions. Each reaction mixture contained 10 μL of 2 × Premix Ex Taq™ (Probe qPCR) (TaKaRa, Dalian, China), 0.5 μL each of forward and reverse primers (5 μM), and varying volumes of TaqMan probe (10 μM) ranging from 0.1 to 1.0 μL. Nuclease-free water was added to adjust the final reaction volume to 20 μL.

Establishment of the standard curve

The concentrations of recombinant plasmids (pMD18-MG-U, pMD18-F, pMD18-TS-11, and pMD18-6/85) were determined using a NanoDrop One spectrophotometer (Thermo Fisher Scientific, USA). Plasmid copy numbers were calculated based on the measured DNA concentrations and molecular weights. Each plasmid was then diluted with nuclease-free water to a final concentration of 1 × 10⁸ copies/μL and subsequently subjected to 10-fold serial dilutions to generate standard solutions ranging from 10⁸ to 10¹ copies/μL.

Each plasmid dilution was used as a template for qPCR amplification, and all reactions were performed in triplicate to construct standard curves. The qPCR assays were conducted under the optimized reaction system and cycling conditions described above. Standard curve parameters, including amplification efficiency, slope, and correlation coefficient (R²), were automatically calculated using the instrument’s dedicated analysis software.

Specificity evaluation

The specificity of the multiplex qPCR assay was evaluated using genomic nucleic acids extracted from IBV, NDV, AIV, FAdV, ILTV, FTV, and MS as templates for qPCR amplification. Recombinant plasmids pMD18-MG-U, pMD18-F, pMD18-TS-11, and pMD18-6/85 at a concentration of 1 × 10⁴ copies/μL were included as positive controls, while nuclease-free water was used as a negative control.

Sensitivity analysis

To assess the analytical sensitivity of the established multiplex qPCR assay, recombinant plasmids with concentrations ranging from 10⁸ to 10¹ copies/μL were mixed at equal concentrations and used as templates for qPCR amplification. In parallel, plasmids at corresponding concentrations were individually used as templates for PCR to allow comparison of detection limits between the two methods.

Repeatability and reproducibility assessment

The repeatability and reproducibility of the qPCR assay were evaluated using recombinant plasmids pMD18-MG-U, pMD18-F, pMD18-TS-11, and pMD18-6/85 at concentrations of 10⁴, 10⁵, and 10⁶ copies/μL. Each concentration was tested in triplicate in both intra-assay and inter-assay experiments, with nuclease-free water included as a negative control in each run. Inter-assay tests were performed at one-week intervals. The coefficient of variation (CV) was calculated using the following formula:

$$\text{CV}(\%)=\left(\text{standard}\text{deviation}\text{of}\text{Ct}\frac{\text{values}}{\text{mean}}\text{Ct}\text{value}\right)\times 100\%.$$

Evaluation Using Clinical Samples

A total of 2,854 tracheal tissue or tracheal swab samples were collected from laying hens, broilers, and breeder hens across multiple regions of Guangxi Zhuang Autonomous Region, China. All clinical samples were tested using the established multiplex qPCR assay to evaluate its applicability under field conditions.

Results

Optimization results of reaction conditions

Through orthogonal experimental design, the primer and probe concentrations as well as the annealing temperature of the multiplex qPCR assay were systematically optimized. The optimal annealing temperature was determined to be 50°C (Fig. 1).

Fig. 1.

Optimization of TaqMan reaction conditions for multiple Mycoplasma gallisepticum (MG) strains. Annealing temperatures were tested at 46 °C, 48 °C, 50 °C, and 53 °C, based on the primer Tm values. Amplification curves are shown from left to right for MG-6/85 (vaccine strain), MG-F (vaccine strain), MG-Ts-11 (vaccine strain), and MG-Universal (universal detection).

Under the optimized conditions, the final reaction system for each target was determined based on the optimization results (Table 2). For the MG-6/85 target, the final concentrations of the forward primer, reverse primer, and TaqMan probe were 0.25 μM, 0.25 μM, and 0.15 μM, respectively. For the MG-F target, the corresponding concentrations were also 0.25 μM, 0.25 μM, and 0.15 μM, respectively. For the MG-TS-11 target, the final concentrations of the forward primer, reverse primer, and probe were 0.25 μM, 0.25 μM, and 0.05 μM, respectively. Similarly, the MG-universal target employed forward primer, reverse primer, and probe concentrations of 0.25 μM, 0.25 μM, and 0.25 μM, respectively.

Table 2.

Annealing temperature and probe concentration optimization.

Type	Probe (μM)	46°C			48°C			50°C			52°C
		1 × 105	1 × 104	1 × 103	1 × 105	1 × 104	1 × 103	1 × 105	1 × 104	1 × 103	1 × 105	1 × 104	1 × 103
6/85	0.05	20.054	24.933	28.356	20.033	25.573	29.311	19.863	25.221	28.777	21.751	26.86	30.648
TS-11		18.663	23.669	27.006	18.267	23.718	27.441	18.225	24.411	27.585	21.362	26.612	30.041
F		19.019	24.1	27.694	18.734	24.131	27.713	18.91	24.566	27.801	20.844	25.901	29.594
U		20.148	24.502	28.738	19.942	25.901	29.428	21.168	26.503	30.208	21.961	27.08	30.812
6/85	0.1	19.846	25.102	28.414	19.74	25.179	28.793	19.354	24.83	28.184	21.116	26.314	30.095
TS-11		18.342	24.359	26.653	17.67	24.315	26.958	18.875	24.834	27.165	20.602	26.257	29.653
F		19.086	24.25	27.324	18.584	23.912	27.468	18.578	23.787	27.084	20.498	25.556	29.317
U		19.541	25.054	28.223	19.644	25.592	29.015	20.679	25.977	29.63	20.864	26.189	29.894
6/85	0.15	19.694	25.151	28.608	19.619	25.064	28.688	19.291	24.551	28.125	21.072	26.046	29.905
TS-11		17.462	23.924	27.489	19.108	23.961	27.945	18.552	24.315	28.257	20.701	25.604	29.505
F		18.979	24.198	27.386	18.737	24.045	27.379	18.702	23.792	27.739	20.494	25.467	29.291
U		19.442	24.677	28.284	19.923	25.423	28.683	20.647	25.838	29.725	20.754	26.038	29.59
6/85	0.2	19.925	25.270	28.417	19.65	25.063	28.586	19.118	24.681	28.2	20,967	26.278	29.962
TS-11		19.323	24.587	26.783	19.169	24.653	27.656	19.38	24.824	28.147	20.47	26.026	29.538
F		19.017	24.363	27.466	18.665	23.835	27.555	18.799	24.218	27.666	20.454	25.705	29.274
U		19.845	25.067	28.089	19.913	25.251	28.212	20.613	25.902	29.548	20.727	26.197	29.914
6/85	0.25	19.823	24.083	28.512	19.599	25.767	28.313	19.107	24.723	28.277	20.99	26.3	30.037
TS-11		19.542	24.161	27.692	19.244	24.321	28.016	19.584	24.835	28.191	20.786	26.169	29.868
F		19.143	24,378	27.779	18.665	24.249	27.282	18.774	24.209	27.545	20.662	26.127	29.773
U		19.389	24.136	28.662	19.647	25.071	28.007	20.741	25.769	29.324	20.877	26.094	29.999
6/85	0.3	19.809	25.129	28.395	19.625	24.956	28.327	19.13	24.928	28.321	20.955	26.214	30.659
TS-11		19.101	24.128	27.385	19.767	24.816	28.19	18.928	25.246	28.568	20.898	26.23	30.164
F		19.171	24.322	27.602	18.839	24.04	27.389	18.797	24.414	27.768	20.628	25.902	29.524
U		19.500	24.642	28.078	20.347	25.504	28.276	20.56	26.284	29.539	21.102	26.388	30.482
6/85	0.35	19.818	25.03	28.427	20.094	24.918	28.425	19.22	24.904	28.37	20.823	25.993	29.984
TS-11		19.566	23.461	27.545	19.753	24.925	27.753	20.035	24.919	28.3	20.707	25.715	29.949
F		19.07	24.008	27.769	18.687	24.11	27.62	18.939	24.451	27.609	20.629	25.663	29.583
U		19.636	24.218	27,978	20.52	25.319	28.532	20.662	26.338	29.241	20.972	25.93	30.158
6/85	0.4	19.91	25.125	28.485	19.718	24.649	28.63	19.323	24.58	28.188	21.113	26.092	30.152
TS-11		19.636	24.563	27.837	19.784	25.334	28.456	19.531	24.831	28.499	21.118	26.189	29.953
F		19.257	24.303	25.579	18.855	24.178	27.707	19.221	24.382	27.833	20.959	25.768	29.708
U		10.043	24.788	28.36	10.163	25.442	28.694	20.666	25.681	29.857	21.201	26.168	30.014

Establishment of the Standard Curve

Standard curves were generated for the MG-U target and the three vaccine strains (F, TS-11, and 6/85) to analytically characterize the performance of the multiplex qPCR assay. As shown in Fig. 2, the slopes of the standard curves were −3.603, −3.411, −3.379, and −3.738 for MG-U, F, TS-11, and 6/85, respectively. The R² ranged from 0.995 to 0.998, and the amplification efficiencies ranged from 85.163% to 96.401%.

Fig. 2.

Standard curves for the four MG types.

Sensitivity determination of qPCR

The analytical sensitivity of the multiplex qPCR assay was evaluated based on plasmid copy numbers using 10-fold serial dilutions. The limit of detection (LOD) was defined according to a Ct value ≤ 35. As shown in Fig. 3, the multiplex qPCR assay was able to detect the MG-universal target and all three MG vaccine strains at a minimum concentration of 1 × 10² copies/μL. In contrast, the detection limit of the conventional PCR assay was 1 × 10³ copies/μL for all targets (Fig. 4D). Therefore, the established multiplex qPCR assay demonstrated at least a 10-fold higher sensitivity than the conventional PCR method.

Fig. 3.

Sensitivity comparison between TaqMan and conventional PCR assays for the four MG types.

Fig. 4.

Specificity analysis of the multiplex real-time PCR assay. Lanes: A. nfectious bronchitis virus (IBV, H120); B. Newcastle disease virus (NDV, Lasota); C. Avian influenza virus (AIV, H9-SS); D. Fowl adenovirus (FAdV, AV127); E. Infectious laryngotracheitis virus (ILTV, K317); F. Salmonella gallinarum (SG, ATCC54003); G. Mycoplasma synoviae Str.H (MS, MS-H); N: ddH₂O (negative control).

Specificity determination of qPCR

To evaluate the analytical specificity of the established multiplex qPCR assay, recombinant plasmids pMD18-MG-U, pMD18-F, pMD18-TS-11, and pMD18-6/85 (1 × 10⁴ copies) were mixed and used as positive templates. In addition, a panel of common avian pathogens, including NDV, AIV, FAdV, ILTV, and FTV, was included as an interference group, with nuclease-free water serving as the negative control.

As shown in Fig. 4, no amplification signals were detected from the nucleic acids of the interference pathogens or from the negative control, whereas all recombinant plasmid targets were specifically amplified by the multiplex qPCR assay. These results demonstrate that the established assay exhibits high analytical specificity and does not cross-react with other major avian respiratory or systemic pathogens.

Repeatability and stability determination of qPCR

To assess the repeatability and stability of the multiplex qPCR assay, both intra-assay and inter-assay variability were evaluated. All samples were tested in triplicate, and the mean Ct values and coefficients of variation (CVs) were calculated.

The intra-assay CVs for each qPCR target were as follows: MG-U (0.625–1.107%), F (0.067–0.322%), TS-11 (0.098–0.188%), and 6-85 (0.119–0.308%). The inter-assay CVs were as follows: MG-U (0.487–2.508%), F (0.337–1.865%), TS-11 (0.646–1.096%), and 6-85 (0.619–1.306%). Detailed results are shown in Table 3.

Table 3.

qPCR repeatability analysis.

Method	Plasmid concentration (copies/μL)	Intra-group			Inter-group
		Mean Ct	SD	CV/%	Mean CT	SD	CV/%
MG-6/85	1 × 107	12.267	0.288	2.348	12.097	0.158	1.306
	1 × 106	15.077	0.119	0.789	15.15	0.17	1.124
	1 × 105	18.595	0.308	1.657	18.725	0.116	0.619
MG-F36	1 × 107	12.763	0.067	0.525	12.495	0.233	1.865
	1 × 106	12.763	0.066	0.518	12.495	0.042	0.337
	1 × 105	18.677	0.322	1.722	18.718	0.075	0.401
MG-TS-11	1 × 107	11.799	0.146	1.239	11.692	0.128	1.096
	1 × 106	14.644	0.098	0.672	14.675	0.095	0.646
	1 × 105	18.019	0.188	1.043	18.235	0.188	1.032
MG-U	1 × 107	13.201	0.146	1.107	12.848	0.322	2.508
	1 × 106	15.735	0.098	0.626	15.830	0.108	0.681
	1 × 105	19.318	0.188	0.973	19.399	0.094	0.487

Clinical application determination

To evaluate the practical applicability of the method developed in this study, throat swab samples were collected under field conditions. Thirty throat swabs were obtained from chickens vaccinated with the F, ts-11, or 6/85 vaccines, repectively, with each vaccine group sampled separately. In addition, 200 throat swabs were collected from chickens vaccinated with different MG strains as well as from non-vaccinated flocks. All samples were tested using the qPCR assay established in this study and were also examined by conventional PCR for comparison. The results showed that the qPCR findings were fully consistent with the known vaccination and infection status of the samples, as summarized in Table 4.

Table 4.

Sample determination information.

Sample	Number	HEX(MG-U)	FAM(MG-F)	CY5(MG-TS11)	ROX(MG-6/85)	PCR
MG-F36	30	26	26	0	0	26
TS-11	30	23	0	23	0	23
6/85	30	24	0	0	24	24
Unknown	200	142	32	67	25	142

Investigation on MG infection in Guangxi province

Furthermore, we applied this method to detect a total of 2,564 throat swab samples collected from chicken flocks in different regions of Guangxi Province, in 2025. Of these, 1,493 samples were collected from broiler breeding farms, 669 from laying hen farms, and 402 from broiler farms. Detailed information on the samples is provided in Table 5. In chicken flocks vaccinated with MG attenuated vaccines, positive signals detected using the MG-U primers were consistent with those obtained using MG-TS11 or F primers. MG-U was frequently detected in flocks that had not received any MG vaccine. In this group, 58.5% of the samples were MG positive, corresponding to 416 positive samples out of 711 tested. A low detection rate was also observed in flocks vaccinated only with the inactivated CR strain. In these samples, MG-U was detected in 105 out of 300 samples, giving a detection rate of 35%.

Table 5.

Sample information and test results.

Category	Region	No. Tested	MG-U	F	TS-11	6/85	Immunization
Broiler breeding farm	Long’an County, Nanning City	471	206	0	206	0	MG live attenuated vaccine (TS-11)
	Xixiangtang District, Nanning City	510	254	0	254	0	MG live attenuated vaccine (TS-11)/MG inactivated vaccine (CR strain)
	Lingshan County, Qinzhou City	192	77	77	0	0	MG live attenuated vaccine (F36 strain)
	Hepu County, Beihai City	320	176	0	176	0	MG live attenuated vaccine (TS-11)
Laying hen farm	Tiandong County, Baise City	200	64	0	0	0	MG inactivated vaccine (CR strain)
	Tianyang District, Baise City	100	41	0	0	0	MG inactivated vaccine (CR strain)
	Guanyang County, Guilin City	80	40	0	0	0	Not vaccinated
	Lingchuan County, Guilin City	97	21	0	0	0	Not vaccinated
	Rong County, Yulin City	192	123	0	0	0	Not vaccinated
Broiler farm	Xixiangtang District, Nanning City	60	17	0	17	0	MG live attenuated vaccine (TS-11)
	Long’an County, Nanning City	150	111	0	0	0	Not vaccinated
	Lingchuan County, Guilin City	192	121	0	0	0	Not vaccinated

Discussion

MG continues to represent a major challenge for the global poultry industry because of its high transmissibility, its ability to persist within flocks, and its negative effects on production performance. Once MG is introduced into a farm, particularly in multi-age production systems or operations with limited biosecurity, eradication becomes difficult and long-term carrier birds are commonly observed (Feberwee et al., 2022; Yadav et al., 2022). Moreover, intensive use of antimicrobials for the control of Mycoplasma gallisepticum on farms has been linked to the emergence and dissemination of antimicrobial resistance, reflecting an increasing dependence on antibiotic interventions in contemporary poultry production systems (Kamal et al., 2025). Under these circumstances, live attenuated vaccines, including F, ts-11 and 6/85 strains, are widely applied and have been used in Europe, Asia, Australia, and Latin America (Feberwee et al., 2022; Fraga et al., 2013; Petrone-Garcia et al., 2020; Ter Veen et al., 2021; World Organisation for Animal Health, 2022). However, these vaccines do not induce sterile immunity. Vaccinated chickens in breeder flocks may still harbor MG, enabling field strains to persist and circulate within the flock (Khalifa et al., 2014). In routine management, antimicrobials are often used to control secondary infections or respiratory disease complexes, and this practice may interfere with the replication and persistence of vaccine strains. Such interference can reduce the detectability of vaccine strains or obscure the presence of field strains, making epidemiological interpretation more difficult. For these reasons, rapid and reliable differentiation between vaccine strains and wild-type MG is essential for effective flock health management.

At present, MG surveillance mainly relies on bacteriological, serological, and molecular methods. Serological assays such as SPA and ELISA are suitable for large-scale screening, but they cannot distinguish antibodies induced by vaccination from those resulting from natural infection in vaccinated flocks. Bacteriological isolation remains the reference method, yet it is slow, technically demanding, and highly susceptible to contamination, which may lead to false-negative results. Molecular typing methods, including gene-targeted sequencing and multilocus sequence typing, provide accurate discrimination between vaccine strains and field strains. However, their high cost, labor requirements, and long turnaround times limit their routine use in rapid or large-scale diagnostics (Ball et al., 2018; Limsatanun et al., 2022; Matucci et al., 2020). Conventional PCR and real-time PCR are therefore widely used because of their speed and sensitivity. Most existing assays focus on species-level identification or the simultaneous detection of MG and MS, but they do not allow differentiation between vaccine strains and wild-type MG (Kahya et al., 2010, 2022; Yadav et al., 2022). A multiplex PCR assay targeting ts-11, 6/85, and F strains has been reported (Kang et al., 2023), but it requires post-amplification gel electrophoresis. This additional step increases the risk of contamination, reduces analytical sensitivity, and does not support quantitative analysis, which limits its application in routine surveillance.

In this study, we developed a single-tube, quadruple TaqMan real-time PCR assay that enables simultaneous detection of three commonly used MG live vaccine strains, F, ts-11 and 6/85, together with the wild-type MG R_High strain. Some previously reported methods have also achieved differentiation between MG vaccine strains and wild strains, such as the dual-labeled real-time fluorescent PCR assay based on the mgc2, MGA_0319, and pvpA gene sequences (Raviv et al., 2008). However, this method cannot perform multi-target detection within a single reaction, as each reaction can only distinguish one vaccine strain from one wild-type strain. Consequently, its practical use is limited in poultry farms where multiple MG vaccines may be applied for disease control.

Although the method developed in this study integrates four targets into a single TaqMan real-time PCR reaction, its analytical performance remained reliable. The standard curves showed good linearity, with slopes ranging from −3.379 to −3.738 and R² values between 0.995 and 0.998. The amplification efficiencies ranged from 85.2% to 96.4%, which meet commonly accepted qPCR performance criteria (de Gonzalo-Calvo et al., 2022). Sensitivity testing using tenfold serial plasmid dilutions demonstrated that the detection limit for each target was 1 × 10² copies/μL, with Ct values of 35 or lower. This sensitivity is at least tenfold higher than that of conventional PCR and is comparable to previously reported dual-labeled MG detection methods (Callison et al., 2006; Raviv et al., 2008). Importantly, combining species-level detection with vaccine strain differentiation did not compromise analytical sensitivity, an issue that is often encountered in multiplex assays (Kang et al., 2023). The coefficients of variation within runs ranged from 0.067% to 1.107%, while those between runs ranged from 0.337% to 2.508%, indicating good repeatability and reproducibility. These values were superior to those reported for several published multiplex TaqMan assays. For example, a TaqMan assay targeting five porcine pathogens reported intra-assay CVs of 0.341%−2.076% and inter-assay CVs of 0.175%−2.232% (Yin et al., 2025). Another multiplex assay for frog virus 3, Trapan herpesvirus 1, box turtle Mycoplasma sp., and Trapan adenovirus showed intra-assay CVs of 0.05%−1.826% and inter-assay CVs of 0.031%−4.569% (Daleo and Allender, 2025).

One notable strength of this study is the application of the assay to field samples collected from multiple poultry farms in Guangxi Province. Many previous MG detection studies were conducted under laboratory conditions or were based on relatively small sample sizes (Raviv et al., 2008). In contrast, the use of diverse field samples in this study provides a more realistic assessment of MG circulation under routine farming conditions. The results showed that MG infection was common in unvaccinated chicken flocks, with infection rates exceeding 50%. This finding is consistent with earlier reports indicating that MG infection remains widespread in chicken populations in China (Wei et al., 2023; Yu et al., 2023). In this study, no wild-type MG strains were detected in flocks vaccinated with attenuated MG vaccines. In contrast, wild-type MG was identified in flocks that had received only inactivated MG vaccines. These findings suggest that attenuated vaccines may provide better protection at the flock level, and that the TS-11 and F vaccine strains are effective in limiting the spread of MG within chicken flocks in the Guangxi region. The protective effect of attenuated vaccines against wild-type MG infections has been reported previously. For example, wild-type MG was not detected in chickens from the time of TS-11 vaccination until market age (Turner and Kleven, 1998). Furthermore, vaccination of laying hens with attenuated MG vaccines has been shown to reduce lesions such as airsacculitis, peribronchial inflammation, and interstitial pneumonia following challenge with highly virulent MG R strains (Bíró et al., 2005).

Nevertheless, the absence of detectable wild-type MG in vaccinated flocks should be interpreted cautiously. It does not necessarily indicate complete elimination of field strains from vaccinated populations. Similar observations have been reported in other regions. In commercial chicken farms in Egypt, several wild MG strains, including RabE1-08, RabE2-09, and RabE3-09, were still detected in diseased flocks despite the implementation of vaccination programs (Khalifa et al., 2014). Consistent with these findings, our data suggest that neither attenuated nor inactivated MG vaccines provided complete flock-level protection, as only about half of the chickens showed evidence of immunity. These results agree with previous studies indicating that MG vaccination primarily reduces clinical signs and bacterial load rather than fully preventing infection or transmission (Mugunthan et al., 2023). Partial immunity may result from multiple factors, including antigenic variation among MG strains, suboptimal vaccination schedules, interference from maternal antibodies, and stress related to farm management practices (Liu et al., 2024; Miller et al., 2024).

Conclusion

The multiplex TaqMan qPCR assay developed in this study offers a practical alternative to sequencing-based approaches for the differentiation of MG strains. The assay combines a short turnaround time with high sensitivity and reliable discriminatory performance, which makes it well suited for large-scale surveillance and routine field application. By improving the accuracy of MG diagnosis, this method can help inform management decisions and support more effective control of MG in vaccinated poultry populations.

Declaration of funding

This research was supported by the Guangxi Science and Technology Major Project "Research and Application of Key Technologies for Elimination of Major Diseases in High-Quality Chicken Breeding" (Grant No. Guike AA23062050), Guangxi “Bagui light” Academic Visit and Training Program.

Conflict of Interest Statement

The authors declare that there is no conflict of interest regarding the publication of this article. No financial support or relationships with commercial entities, products, or services have influenced the study design, data collection, analysis, or interpretation of the results. The authors have no personal, professional, or financial affiliations that could be perceived as influencing the objectivity of this research.

CRediT authorship contribution statement

Jialiang Xin: Writing – review & editing, Writing – original draft, Visualization, Methodology, Data curation. Jiangtao Zhang: Methodology, Investigation, Formal analysis. Sulian Liang: Methodology, Investigation. Jingshan Bi: Methodology, Investigation. Jianhao Wu: Data curation. Zhengji Wei: Methodology, Formal analysis, Data curation. Rong Yang: Validation, Software. Zhongyi Zhao: Software, Methodology. Jing Huang: Validation, Methodology. Wenjing Li: Visualization, Data curation, Conceptualization. Mengjia Yang: Methodology. Haotian Xue: Supervision, Software. Hao Huang: Methodology, Investigation. Jing Mu: Visualization. Jiafeng Ding: Supervision. Lei Lei: Visualization, Validation. Min Zheng: Writing – review & editing, Writing – original draft.

Disclosures

The authors declare that they have no conflict of interest.