Abstract
Coccidiosis caused by Eimeria species poses a significant threat to the global poultry industry. Gametocyte antigens essential for oocyst wall biogenesis represent promising targets for transmission-blocking vaccine development. In this study, the E. necatrix gam82 gene (1650 bp) was cloned, encoding a 549-amino acid protein. A truncated fragment (amino acids 258-464) enriched in tyrosine‑serine-rich regions (amino acids 258-442) was expressed in Escherichia coli, yielding the recombinant protein rEnGAM82-T. Western blot analysis demonstrated that rEnGAM82-T exhibited strong immunoreactivity and cross-reacted with convalescent sera from E. necatrix, E. maxima, and E. acervulina infections. Immunofluorescence assay confirmed that EnGAM82 is specifically localized to wall-forming body type II (WFBII) during gametogony and subsequently incorporated into the developing oocyst wall. To evaluate protective efficacy, chickens were immunized with rEnGAM82-T or a fusion protein rEnGAM82-T-22 combining WFBII- and WFBI-derived antigens. Immunization with rEnGAM82-T significantly alleviated clinical symptoms, reduced intestinal lesions and oocyst shedding, and improved growth performance, with the medium-dose group (100 μg/bird) achieving moderate protection (ACI = 160.82). Notably, the fusion protein rEnGAM82-T-22 conferred superior protection at a lower dose (50 μg/bird; ACI = 161.21), demonstrating synergistic effects by simultaneously targeting both inner and outer oocyst wall components. In conclusion, EnGAM82 is an immunogenic WFBII-localized gametocyte antigen potentially involved in oocyst wall formation. The enhanced protection achieved by the multi-component fusion protein provides valuable insights for the rational design of next-generation transmission-blocking vaccines against avian coccidiosis.
Keywords: Eimeria necatrix, Gametocyte antigen, Oocyst wall, Subunit vaccine, Transmission-blocking
Introduction
Coccidiosis, caused by multiple Eimeria species, is a highly destructive parasitic disease in poultry and remains one of the major constraints on modern intensive farming systems (Attree et al., 2021). The global economic burden of avian coccidiosis was estimated to be approximately £12.9 billion in 2022, an estimate substantially influenced by the combined impacts of the COVID-19 pandemic and regional conflicts (Blake, 2025). Among the pathogenic species, Eimeria necatrix poses a serious threat to chickens aged 8-18 weeks, frequently causing acute intestinal infections and large-scale mortality (Zhu et al., 2025). Current control measures primarily depend on chemotherapeutic agents and vaccination; however, the extensive and prolonged use of anticoccidial drugs has led to the widespread emergence of drug-resistant strains, diminished therapeutic efficacy, and growing concerns regarding drug residues in poultry products (Mathis et al., 2025). Consequently, developing novel, safe, and effective subunit vaccines based on well-defined immunogenic antigens has emerged as a crucial and promising strategy for coccidiosis control (Venkatas and Adeleke, 2019).
The sexual development of Eimeria species culminates in oocyst formation, a process dependent on specialized organelles known as wall-forming bodies (WFBs). The type I (WFBI) and type II (WFBII) compartments contribute distinct protein components to the oocyst wall, with WFBI-derived proteins forming the outer layer and WFBII-derived proteins constituting the inner layer (Ferguson et al., 2003; Mai et al., 2009). Studies on E. maxima identified two major tyrosine‑serine-rich gametocyte proteins, EmGAM56 and EmGAM82, which localize to WFBII and undergo proteolytic processing prior to incorporation into the oocyst wall through dityrosine cross-linking (Belli et al., 2002, 2003a; b). Similarly, the WFBI-localized protein GAM22 contributes to outer wall formation (Wang et al., 2023b). Based on these findings, it has been hypothesized that antibodies targeting gametocyte antigens could interfere with oocyst wall assembly, thereby reducing oocyst output and blocking parasite transmission.
Our research group has previously cloned several gametocyte antigen genes of E. necatrix, including Engam22, Engam56, Engam59, and Engpx, thus providing a foundation for subunit vaccine development (Liu et al., 2014; Wang et al., 2025a, 2017; Wang et al., 2025b). More recently, comparative proteomic analyses confirmed that EnGAM82 and EnGAM22 are localized to WFBs and are directly involved in oocyst wall biosynthesis (Wang et al., 2023c). Given that EnGAM82 (WFBII) and EnGAM22 (WFBI) target distinct wall layers, we hypothesized that combining these antigens could elicit synergistic protection by simultaneously disrupting both inner and outer wall formation. In the present study, we cloned the Engam82 gene, expressed its immunodominant tyrosine‑serine-rich fragment, and constructed both a single-antigen expression vector (pET-28a(+)-Engam82-T/BL21) and a fusion expression vector (pET-28a(+)-Engam82-T-22/BL21). The recombinant proteins rEnGAM82-T and rEnGAM82-T-22 were purified and evaluated for their immunogenicity and protective efficacy against E. necatrix challenge in chickens. This study aims to evaluate the potential of multi-component transmission-blocking vaccines targeting oocyst wall biogenesis for coccidiosis control.
Materials and methods
Protein, animals and parasites
The recombinant gametocyte protein of E. necatrix, rEnGAM22, was expressed in our laboratory using a prokaryotic expression system (Liu et al., 2014).
The E. necatrix Yangzhou strain was originally isolated and confirmed based on microscopic morphological criteria combined with molecular identification targeting the internal transcribed spacer (ITS) region of genomic DNA, as previously described (Liu et al., 2014). The strain has been continuously propagated and preserved in the Parasitology Research Laboratory of Yangzhou University, China. Day-old yellow-feathered broiler chicks were obtained from the Jiangsu Institute of Poultry Science and reared in raised-wire cages under coccidia-free conditions, with free access to anticoccidial drug-free feed and fresh water. Six-week-old male BALB/c mice were procured from the Comparative Medicine Center of Yangzhou University and maintained under specific pathogen-free conditions for the duration of the experiments. All animal procedures were performed in accordance with the guidelines and regulations of the Animal Experiment Ethics Committee of Yangzhou University, under License No. SYXK (SU) 2022-0044 for mice and SYXK (SU) 2021-0027 for chickens.
Twenty-day-old chickens were orally inoculated with 2 × 10⁴ E. necatrix sporulated oocysts. Fecal samples obtained at 7-12 days post-infection were processed for oocyst recovery using the saturated sodium chloride flotation method (Liu et al., 2014). For sporulated oocyst preparation, the isolated oocysts were placed in 2.5 % (w/v) potassium dichromate solution and maintained at 28 °C for approximately 72 h to achieve complete sporulation. For unsporulated oocyst (UO) collection, fecal samples were collected at 12-h intervals between 7-10 days post-infection. Immediately after collection, samples were processed, and oocysts were isolated using a standard flotation method. The isolated oocysts were resuspended in 2.5 % (w/v) potassium dichromate solution and maintained at 4 °C until further use.
Preparation of E. necatrix developmental stages
Ten 15-day-old chickens were orally inoculated with 2.0 × 10⁴ sporulated Eimeria necatrix oocysts. Mid-intestinal segments corresponding to the site of second-generation merozoite (MZ-2) development were collected at 132 h post-infection (hpi), while the anterior one-third of the cecum, the primary site for third-generation merozoite (MZ-3) development, was harvested at 144 hpi (Su et al., 2017). Cecal segments corresponding to the region of gametocytes (GAM) development were collected at 158 hpi (Wang et al., 2023c). The oocyst walls (OW) were isolated and purified from unsporulated oocysts (Wang et al., 2023c).
Gene cloning and vector construction
Cloning of Engam82 and construction of the expression vector
Total RNA of GAM was extracted and transcribed into cDNA using a FastPure Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China) and Reverse Transcriptase kit™ (TaKaRa, Dalian, China) respectively, according to the manufacturer’s instructions. The target cDNA was amplified using RNA LA PCR KitTM (TakaRa) and specific primers were designed based on the gam82 sequences (XM_013585548.1) (Table 1). The PCR amplification conditions were as follows: initial denaturation at 98 °C for 4 min; denaturation at 98 °C for 10 s; annealing at 55 °C for 15 s; extension at 72 °C for 1 min, repeated for 30 cycles; and a final extension at 72 °C for 5 min. The RT-PCR products were analyzed by 1.50 % agarose gel electrophoresis, followed by purification and subcloning into the pMD18-T vector (TaKaRa). The positive clones were sequenced by Beijing Liuhe Huada Gene Technology Co., Ltd. (Beijing, China).
Table 1.
Primer sequence.
| Primer name | Range of amplification (bp) | Primer sequence 5′→3′ | Amplicon length (bp) |
|---|---|---|---|
| Engam82-1a | 1-621 | F: 5′-ATGGCGCGCGCAGCGGCAATAG-3′ | 621 |
| R: 5′-CATGCGCTCCAGAAAGCCCT-3′ | |||
| Engam82-2a | 566-943 | F: 5′-AGCAGGCGCTGCACGTG-3′ | 378 |
| R: 5′-GCCGGTGCTTGCCCCTG-3′ | |||
| Engam82-3a | 858-1191 | F: 5′-CAGCAGCAGCTGCGGCTAC-3′ | 334 |
| R: 5′-GCTGCTGCTGTAGCTGTACG-3′ | |||
| Engam82-4a | 1105-1692 | F: 5′-CGCAGCCTCTTCAGCAGCAG-3′ | 588 |
| R: 5′-TCAGTTGTAAGAAGTGTCCCAG-3′ | |||
| Engam82-GCa | 927-1124 | F: 5′-CAGGGGCAAGCACCGGC-3′ | 198 |
| R: 5′-CTGCTGCTGAAGAGGCTGCG-3′ | |||
| Engam82b | / | F: AGTTCCTGGATGGGAGACGA | / |
| R: GGGAAGACCAGTGGTGTCAG | |||
| 5.8S rRNA | / | F: TTCATACTGCGTCTAATGCACC | / |
| R: CGAGTCCTACCGCAGTACTA | |||
| Engam82c | / | F: CAGCAAATGGGTCGCGGATCCCCATCATATGGATATCCCCTATACTATC | / |
| R: CACCAGAACCGCCACCGCCAGAACCACCACCACCGGTGGATTGCTGGCTCGG | |||
| Engam22c | / | F: TTCTGGCGGTGGCGGTTCTGGTGGTGGTGGTAGCGACGAAGCACCTGAGTAT | / |
| R: GTGGTGGTGGTGGTGCTCGAGTTAGTTGATGTCGGTAAGCTGCTC |
Note: a, primers for complete Engam82 gene; b, primers for qPCR; c, primers for tandem Engam82-T-22 gene. Restriction sites are solid underlines, and the connecting peptide sequences are indicated by dashed underlines.
The region from 258 to 464 aa of the Engam82 gene (Engam82-T) sequence obtained from sequencing was submitted to GenScript Biotech Corporation (Nanjing, China) for codon optimization and synthesis. The optimized gene was cloned into the prokaryotic expression vector pET-28a(+), and the resulting recombinant plasmid was transformed into Escherichia coli competent cells BL21(DE3), thereby generating the truncated recombinant expression strain pET-28a(+)-Engam82-T/BL21.
The sequencing results were analyzed with BLASTN, and the protein sequences were predicted using DNAStar software Lasergene 7.1. Signal peptides were predicted using the SignalP 5.0 server (https://services.healthtech.dtu.dk/services/SignalP-5.0/). Antigenic epitopes were predicted by using the method of Kolaskar and Tongaonkar (http://imed.med.ucm.es/Tools/antigenic.pl). Multiple sequence alignments were performed with the ClustalW algorithm in DNAMAN software (https://www.lynnon.com/).
Cloning of the Engam82-T-22 fusion gene and construction of the expression vector
The recombinant plasmid pMD18-T-Engam22, harboring a 498 bp Engam22 fragment corresponding to amino acids 20-186 of the Engam22 protein (EnGAM22), was stored in our laboratory (Liu et al., 2014). Specific primers were designed to introduce a flexible linker (Gly₄Ser)₃ between Engam82-T and Engam22 (Table 1).
PCR amplification was performed using pMD18-T-Engam82 and pMD18-T-Engam22 as templates with PrimeSTAR Max DNA Polymerase (TaKaRa) under the following conditions: initial denaturation at 98 °C for 4 min, followed by 30 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 15 s, and extension at 72 °C for 5 min. The PCR products were digested with Bam HⅠ and Xho Ⅰ, and subsequently ligated into the similarly digested pET-28a(+) vector using Solution I ligase at 16 °C for 10 h. The ligation mixtures were transformed into E. coli DH5α competent cells. Single colonies were screened by double digestion with Bam HⅠ and Xho Ⅰ, and positive clones were verified by DNA sequencing (BGI, China). The confirmed recombinant plasmid was then transformed into E. coli BL21(DE3) to establish the expression strain pET-28a(+)-Engam82-T-22/BL21.
Recombinant protein expression and antibody preparation
Expression of the recombinant protein
The recombinant bacteria were inoculated into Luria–Bertani (LB) medium supplemented with 100 μg/mL kanamycin and cultured at 37 °C with shaking at 200 rpm until the optical density at 600 nm (OD₆₀₀) reached 0.6. Protein expression was induced by the addition of isopropyl β-d-1-thiogalactopyranoside (IPTG) at a concentration of 1.0 mM. Induction was carried out under the same conditions for 4 h.
The rEnGAM82-T and rEnGAM82-T-22 proteins were purified using a Ni-NTA affinity chromatography column and renatured by stepwise dialysis against buffers containing decreasing urea concentrations (6, 4, 2, and 1 mol/L; pH 11.0), as described previously (Liu et al., 2014). Following affinity purification, residual endotoxins were removed from the recombinant protein using a commercial endotoxin removal kit (GenScript), according to the manufacturer’s instructions. The purified proteins were analyzed by 15 % SDS-PAGE and stained with Coomassie Brilliant Blue G-250 (Sigma-Aldrich, St. Louis, MO, USA).
Polyclonal antibody production
The mouse anti-rEnGAM82-T polyclonal antibody (pAb) was generated in accordance with the manufacturer's protocol for the QuickAntibody-Mouse3W adjuvant (Biodragon, Beijing, China). rEnGAM82-T protein was diluted in phosphate-buffered saline (PBS) to a final concentration of 2 μg/μL. Equal volumes (1:1, v/v) of the diluted antigen and QuickAntibody-Mouse3W adjuvant were emulsified and administered via intramuscular injection into six-week-old male BALB/c mice (5 mice), with each mouse receiving a total volume of 100 μL. Control mice were injected with a sterile PBS–adjuvant mixture lacking antigen.
Seven days after the second immunization, blood samples were collected. Serum was separated by centrifugation at 2,000 × g for 10 min and stored at –80 °C until further use. The antibody titer was determined using an enzyme-linked immunosorbent assay (ELISA) following the protocol described previously (Liu et al., 2014) (Supplementary Figure 3).
Western blot analysis
Protein samples were extracted from pET-28a(+)-Engam82-T/BL21 or pET-28a(+)-Engam82-T-22/BL21, together with the corresponding negative controls, were resolved by 12 % SDS-PAGE and subsequently transferred onto nitrocellulose membranes (Merck Millipore, Billerica, MA, USA). The membranes were blocked overnight at 4 °C using 5 % skim milk (Biyuntian, Shanghai, China) to minimize nonspecific binding.
Following blocking, membranes were incubated at 37 °C for 1 h with the appropriate primary antibody, including mouse anti-6 × His tag monoclonal antibody (1: 10,000 dilution; BIO BASIC, Markham, Canada), mouse anti-rEnGAM82-T pAb (1:100 dilution), rabbit anti-rEnGAM22 pAb (1:100 dilution), or convalescent serum (1: 200 dilution) of chicken infected individually with E. necatrix, E. tenella, E. acervulina or E. maxima. After primary antibody incubation, membranes were washed and subsequently incubated for 1 h at 37 °C with HRP-conjugated secondary antibodies: goat anti-mouse IgG (1: 10,000 dilution; BIO BASIC), goat anti-rabbit IgG (1: 10,000 dilution; BIO BASIC) and HRP-conjugated goat anti-chicken IgY antibody (1: 10,000 dilution; BIO BASIC). Signal detection was performed using the Tanon-5200 Chemiluminescent Imaging System (Tanon, Shanghai, China).
Characterization analysis of EnGAM82
Detection of native protein EnGAM82
Purified GAM and OW samples were transferred to 1.5 mL microcentrifuge tubes and lysed in 300 μL of Pierce™ RIPA lysis buffer (Thermo Fisher Scientific), supplemented with 1 % protease and phosphatase inhibitor cocktail (Xinsaimei, Suzhou, China). GAM samples were sonicated for 5 min in pulsed mode (2 s on / 3 s off) at 30 % output power. For the oocyst wall samples, which possess a more rigid structure, the sonication duration was extended to 15 min under identical conditions. The lysates were then incubated at 4 °C overnight to ensure complete lysis, followed by centrifugation at 10,000 × g for 10 min at 4 °C. The resulting supernatants were collected and stored for subsequent Western blot analysis. Total protein concentrations were measured using the BCA assay with the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, USA), in accordance with the manufacturer's instructions. The primary antibody used was mouse anti-rEnGAM82-T pAb (1:200 dilution).
Immunofluorescence localization of EnGAM82
The rabbit anti-rEnGAM59 pAb has previously been demonstrated to specifically localize EnGAM59 to wall-forming bodies type II (WFBII) in gametocytes (Wang et al., 2023b), and thus serves as a reliable marker to differentiate between wall-forming bodies type I (WFBI) and WFBII.
Freshly isolated GAM and UO were collected and spread onto clean glass microscope slides. The samples were then fixed in pre-chilled methanol at −20 °C for a duration of 10 min. After fixation, cell membranes were permeabilized with 0.1 % Triton X-100 (Beyotime, Shanghai, China) for 10 min at room temperature, and the slides were then incubated with 5 % bovine serum albumin (BSA) diluted in PBS overnight at 4 °C. Following the blocking step, the slides were incubated with either mouse anti-rEnGAM82-T pAb (1:100 dilution) or rabbit anti-rEnGAM59 pAb (1:100 dilution) at 37 °C for 1 h. Subsequently, the samples were incubated with the appropriate fluorescent secondary antibodies at 37 °C for 1 h: FITC-conjugated goat anti-mouse IgG (1:500 dilution; KPL, Gaithersburg, MD, USA) or Cy3-conjugated goat anti-rabbit IgG (1:500 dilution; KPL). Finally, the slides were mounted using an anti-fade mounting medium containing DAPI (Roche, Basel, Switzerland), and fluorescence signals were visualized under a Leica DM2500 fluorescence microscope (Leica Microsystems GmbH, Wetzlar, Germany).
Transcriptional analysis of Engam82 across developmental stages
Total RNA of MZ-2, MZ-3 and UO was extracted and reverse-transcribed into cDNA using the same protocol as described for GAM. Primers were designed according to the sequences listed in Table 1, with 5.8S rRNA serving as the internal reference gene. Quantitative real-time PCR (qPCR) was carried out using the AceQ Universal SYBR qPCR Master Mix (Vazyme) following the manufacturer's guidelines. All reactions were performed in triplicate, and the experiment was independently repeated three times. Threshold cycle (Ct) values were obtained, and relative transcript levels were calculated using the 2⁻ΔΔCt method as described by Livak and Schmittgen (Livak and Schmittgen, 2001). Statistical significance was defined as P < 0.05.
Translational analysis of EnGAM82 across developmental stages
Native proteins of MZ-2, MZ-3 and UO were extracted using the same protocol as described for GAM. Following quantification, equal amounts of protein were denatured and resolved by 12 % SDS-PAGE for subsequent Western blot analysis. The membranes were incubated with either mouse anti-rEnGAM82-T pAb (1:200 dilution) or anti-GAPDH antibody, which served as an internal loading control. After washing, the membranes were incubated with HRP-conjugated goat anti-mouse IgG (1:20,000 dilution) as the secondary antibody.
Immunization and challenge
Two immunization trials were conducted. The first trial aimed to evaluate the protective efficacy of rEnGAM82-T, and the experimental design and immunization schedule are shown in Table 2. Five-day-old chicks with similar body weights were randomly divided into 8 groups, with 16 chicks per group. The experimental groups included: the immunized and challenged groups (IC): rEnGAM82-T-H (200 μg/bird), rEnGAM82-T-M (100 μg/bird) and rEnGAM82-T-L (50 μg/bird) group; the control groups included the unimmunized and challenged group (UC) and an unimmunized and unchallenged group (UU). The second trial was designed to assess the protective efficacy of rEnGAM82-T-22, and the experimental design and immunization schedule are shown in Table 3. The experimental groups included: the immunized and challenged groups (IC): rEnGAM82-T-22-H (200 μg/bird), rEnGAM82-T-22-M (100 μg/bird), rEnGAM82-T-22-L (50 μg/bird), rEnGAM82-T-M (100 μg/bird) and rEnGAM22 (50 μg/bird) group. The same two control groups, UC and UU, were also included.
Table 2.
Details of the immunization and challenge schedule of combination of rEnGAM82-T.
| Groups | No. of chickens | Immunization dose (µg) | Immunization (d) | Immunization way | Challenge (d) | Oocysts challenge (× 104) |
|---|---|---|---|---|---|---|
| rEnGAM82-T-H | 10 | 200 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM82-T-M | 10 | 100 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM82-T-L | 10 | 50 | 5, 12 | S.C | 19 | 2.5 |
| UC | 10 | / | / | / | 19 | 2.5 |
| UU | 10 | / | / | / | / | / |
Note: S.C., subcutaneous injection.
Table 3.
Details of the immunization and challenge schedule of combination of rEnGAM82-T-22.
| Groups | No. of chickens | Immunization dose (µg) | Immunization (d) | Immunization way | Challenge (d) | Oocysts challenge (× 104) |
|---|---|---|---|---|---|---|
| rEnGAM82-T-22-H | 10 | 200 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM82-T-22-M | 10 | 100 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM82-T-22-L | 10 | 50 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM82-T-M | 10 | 100 | 5, 12 | S.C | 19 | 2.5 |
| rEnGAM22 | 10 | 50 | 5, 12 | S.C | 19 | 2.5 |
| UC | 10 | / | / | / | 19 | 2.5 |
| UU | 10 | / | / | / | / | / |
Note: S.C., subcutaneous injection.
All immunizations were administered via subcutaneous injection at one-week intervals. Blood samples were obtained from three chickens randomly selected from each group at day 12 (one week following the first immunization) and day 19 (one week following the second immunization). All groups were challenged with 2.5 × 104 sporulated E. necatrix oocysts on day 19 except for the UU group.
Assessment of protective efficacy of recombinant proteins
Protective efficacy was evaluated using multiple parameters, including lesion score, survival percentage, relative weight gain (RWG), oocyst reduction (OR) and the anticoccidial index (ACI) (McManus et al., 1968; Johnson and Reid, 1970). Intestinal lesions were scored on day 27 using a 0-4 scale as described by Johnson and Reid (Johnson and Reid, 1970). Survival percentage was calculated as the proportion of surviving birds in each group. Body weight gain (BWG) was measured from day 19 to day 27 (BWG). RWG (%) was calculated as: (BWG of IC or UC group / BWG of UU group) × 100. OR (%) was calculated as: [(Oocyst count in UC group – Oocyst count in IC group) / Oocyst count in UC group] × 100. ACI was calculated as: [RWG (%) + Survival rate (%)] − [Oocyst value + Lesion score] according to established criteria (McManus et al., 1968). ACI values below 120 indicate no anticoccidial activity, 120–140 indicate minimal effectiveness, 140–160 represent moderate efficacy, 160-180 indicate good efficacy, and values exceeding 180 are considered excellent.
On day 8 post-infection, UO were collected from the feces of each group and incubated in 2.5 % potassium dichromate at 28 °C for 72 h to induce sporulation. Sporulated and total oocysts were enumerated microscopically in triplicate for each group. Sporulation reduction rate (SRR, %) was calculated as: [(UC group − IC group) / UC group] × 100 %.
Serum antibody levels of chickens
Serum antibody levels were measured by indirect ELISA. Briefly, 96-well plates were coated overnight at 4 °C with 1 μg/well of purified rEnGAM22, rEnGAM82-T or rEnGAM82-T-22. After three 15-minute washes with PBST, the wells were blocked with 3 % BSA in PBS for 1 h at 37 °C. Subsequently, serum samples (1:200 dilution) were added and incubated at 37 °C for 1 h. Plates were then washed five times with PBST, followed by incubation with HRP-conjugated goat anti-chicken IgY antibody (1:20,000 dilution; BIO BASIC). Optical density was recorded at 450 nm using a microplate reader (Sunrise-Basic, Tecan Trading AG, Männedorf, Switzerland). All assays were performed in triplicate.
Statistical analysis
Statistical analyses were performed using SPSS Statistical Software (SPSS for Windows 22.0; SPSS Inc., Chicago, IL, USA). Data are expressed as means ± standard deviations (SD). Differences among groups were analyzed by one-way ANOVA followed by Dunnett's multiple comparison test. Significance was set at P < 0.05.
Results
Cloning and sequence analysis of the target gene
RT-PCR amplification results revealed that Engam82 yielded five target gene fragments, all of which corresponded to the expected size (Fig. 1A). Analysis using Lasergene 7.1 software revealed that the full-length Engam82 gene (99.10 % PX209086.1) is 1650 bp, containing a complete open reading frame that encodes 549-amino acids protein with a predicted molecular mass of 59.26 kDa and an isoelectric point (pI) of 6.03. SignalP-5.0 predicted a signal peptide within the first 20 amino acids, and 19 antigenic determinants were identified. The amino acid sequence is enriched in tyrosine (Y, 7.1 %), proline (P, 8.7 %), and serine (S, 11.8 %), and shares 99.10 % sequence identity with EnGAM82 from the E. necatrix Houghton strain (XM_013585548.1) (Supplementary Figure 1).
Fig. 1.
Gene cloning and vector construction. (A) RT-PCR amplification of Engam82. M: DL2 000 DNA Marker; Lane 1: amplified PCR product of fragment 1 (621 bp); Lane 2: amplified PCR product of fragment 2 (378 bp); Lane 3: amplified PCR product of fragment 3 (334 bp); Lane 4: amplified PCR product of fragment 4 (588 bp); Lane 5: amplified PCR product of fragment 5 (198 bp). (B) Enzyme digestion identification of pET-28a(+)-Engam82-T. M: 1 kb DNA Marker. Lane 1: enzyme digestion identification of pET-28a(+)-Engam82-T. (C) RT-PCR amplification of Engam82-T-22. M: DL2 000 DNA Marker; Lane 1: amplified PCR product of Engam82-T-22 (1170 bp). (D) Enzyme digestion identification of pET-28a(+)-Engam82-T-22. M: 1 kb DNA Marker. Lane 1: enzyme digestion identification of pET-28a(+)-Engam82-T-22.
The Engam82-T gene contains a 621 bp coding sequence encoding a 207-amino-acid protein with a predicted molecular weight of 23.06 kDa and a theoretical pI of 8.02, corresponding to amino acids 258-464, a region selected for its highest B-cell epitope density (5 of 19 predicted linear epitopes), including a dominant tyrosine‑serine-rich region (aa 258-442). Double digestion of the recombinant plasmid pET-28a(+)-Engam82-T with Bam HⅠ and Xho Ⅰ confirmed the correct insertion of the target gene (Fig. 1B). Similarly, the fusion gene Engam82-T-22 was successfully amplified, and the product size was consistent with the expected length (Fig. 1C). Amino acid sequence analysis revealed that the full-length fusion gene Engam82-T-22 consists of 1170 bp, encoding 390 amino acids, with a predicted molecular weight of approximately 43.52 kDa and a theoretical pI of 6.82. Double digestion of the recombinant plasmid pET-28a(+)-Engam82-T-22 with Bam HⅠ and Xho Ⅰ confirmed the correct insertion of the fusion gene (Fig. 1D).
Expression and purification of recombinant proteins
SDS-PAGE analysis revealed that the recombinant protein rEnGAM82-T, with an apparent molecular mass of approximately 27 kDa, was predominantly present in inclusion bodies (Fig. 2A). Meanwhile, rEnGAM82-T-22 exhibited an apparent molecular mass of approximately 60 kDa on SDS-PAGE, which exceeded the predicted molecular mass of 43.52 kDa (Fig. 2B). This discrepancy is likely attributable to its unusual amino acid composition, as discussed in the Discussion section. The protein was efficiently expressed and was predominantly distributed in the soluble fraction of the cell lysate.
Fig. 2.
Expression and solubility analysis of recombinant protein. A: Expression of rEnGAM82-T protein. Lane M: unstained protein marker; Lane 1: BL21 with IPTG induction; Lane 2: pET28a(+)/BL21 with IPTG induction; Lane 3: pET28a(+)-Engam82-T/BL21 without IPTG induction; Lane 4: pET28a(+)-Engam82-T/BL21 with IPTG induction; Lane 5: Supernatant of pET28a(+)-Engam82-T/BL21 with IPTG induction; Lane 6: Sediments of pET28a(+)-Engam82-T/BL21 with IPTG induction; Lane 7: Purified recombinant protein rEnGAM82-T. B: Expression of rEnGAM82-T-22 protein. Lane M: unstained protein marker; Lane 1: BL21 with IPTG induction; Lane 2: pET28a(+)/BL21 with IPTG induction; Lane 3: pET28a(+)-Engam82-T-22/BL21 without IPTG induction; Lane 4: pET28a(+)-Engam82-T-22/BL21 with IPTG induction; Lane 5: Supernatant of pET28a(+)-Engam82-T-22/BL21 with IPTG induction; Lane 6: Sediments of pET28a(+)-Engam82-T-22/BL21 with IPTG induction; Lane 7: Purified recombinant protein rEnGAM82-T-22.
Western blot analysis of recombinant proteins
Western blot analysis demonstrated that rEnGAM82-T produced a distinct immunoreactive band at approximately 27 kDa, which was specifically recognized by the anti-6 × His monoclonal antibody and mouse anti-rEnGAM82-T pAb (Fig. 3A, B). Subsequent immunological assays revealed that rEnGAM82-T exhibited notable interspecies cross-reactivity. It reacted specifically with convalescent sera from chickens infected individually with E. necatrix, E. maxima, and E. acervulina (Fig. 3C, D, E). In contrast, no reactivity was detected with convalescent sera from chickens infected with E. tenella (Fig. 3F). Comparative sequence alignment of the tyrosine‑serine-rich region (aa 258-442) of GAM82 homologs revealed a high degree of conservation among E. necatrix, E. maxima, E. acervulina, and E. mitis, with numerous tyrosine and serine residues being conserved across all species (Supplementary Fig. 2), which likely underlies the observed serological cross-reactivity of rEnGAM82-T.
Fig. 3.
Western blot analysis of rEnGAM82-T and native protein EnGAM82. The primary antibody was anti-6 × His monoclonal antibody (A), anti-rEnGAM82-T pAb (B), convalescent serum of chicken infected individually with E. necatrix (C), E. maxima (D) E. acervulina (E) or E. tenella (F). Lane M: Prestained molecular marker; Lane 1: Recombinant bacteria induced products; Lane 2: Recombinant bacteria uninduced products. G: Western blot analysis of native protein EnGAM82. Lane M: Prestained molecular marker; Lane 1: Native proteins extracted from gametocytes (GAM); Lane 2: Native proteins extracted from unsporulated oocysts (UO).
The recombinant protein rEnGAM82-T-22 displayed a single, specific immunoreactive band at approximately 60 kDa, which was strongly recognized by the anti-6 × His monoclonal antibody (Fig. 4A). Furthermore, this protein reacted with three distinct antibodies: the mouse anti-rEnGAM82-T pAb (Fig. 4B), the rabbit anti-rEnGAM22 pAb (Fig. 4C), and convalescent sera from chickens infected with E. necatrix (Fig. 4D).
Fig. 4.
Western blot analysis of rEnGAM82-T-22. The primary antibody was anti-6 × His monoclonal antibody (A), anti-rEnGAM82-T pAb (B), anti-rEnGAM22 pAb (C) or convalescent serum of chicken infected with E. necatrix (D). Lane M: Prestained molecular marker; Lane 1: Recombinant bacteria induced products; Lane 2: Recombinant bacteria uninduced products.
Detection and localization of native protein EnGAM82
Western blot analysis using the mouse anti-rEnGAM82-T pAb detected the native EnGAM82 protein in both GAM and OW samples. A specific immunoreactive band of approximately 100 kDa was observed in both samples, which was considerably higher than the predicted size of EnGAM82 (Fig. 3G).
IFA analysis further revealed that EnGAM82-T was specifically localized to the WFBII in gametocytes (Fig. 5A-E) and exhibited a distinct colocalization pattern with EnGAM59, as previously reported (Wang et al., 2023b). As the gametocytes matured, EnGAM82 was progressively translocated and incorporated into the oocyst wall (Fig. 5F-J), indicating its potential role in oocyst wall formation. No specific fluorescence signals were detected in the negative control using non-immune mouse serum.
Fig. 5.
Localization of EnGAM82 in gametocytes (GAM) and unsporulated oocysts (UO) with mouse anti-rEnGAM82-T pAb. A, F, K, P: Bright-field microscopy photographs; B, G, L, Q: Counter-stained with DAPI; C, H, M, R: Immunofluorescence localization with FITC-conjugated mouse anti-rEnGAM82-T pAb; D, I, N, S: Immunofluorescence localization with Cy3-conjugated Rabbit anti-rEnGAM59 pAb; E, J, O, T: The superposition of different fluorescences (Merge of images). Scale bar=10.0 μm. Note: The relatively weak DAPI fluorescence in gametocytes and unsporulated oocysts is attributable to the diffuse, decondensed chromatin of macrogametocyte nuclei and the limited DAPI penetration through the thick oocyst wall, respectively.
Transcriptional and translational profiles of Engam82
qPCR analysis demonstrated that the transcript level of Engam82 was significantly higher at the GAM stage than at the MZ-2, MZ-3, and UO stages (P < 0.05) (Fig. 6). Using GAPDH as an internal control, Western blot analysis showed that the EnGAM82 protein was most abundantly expressed at the GAM stage, followed by the UO stage, whereas a low expression level was detected in the MZ-3 stage and no expression was observed in the MZ-2 stage (P < 0.05) (Fig. 7A, B).
Fig. 6.
The transcriptional level of Engam82 in different developmental stages. MZ-2: Second-generation of merozoites; MZ-3: Third-generation of merozoites; GAM: Gametocyte; UO: Unsporulated oocysts. *Significant difference (P < 0.05); ⁎⁎significant difference (P < 0.01); ⁎⁎⁎significant difference (P < 0.001); ⁎⁎⁎⁎significant difference (P < 0.0001).
Fig. 7.
The translation level of Engam82 in different developmental stages. (A) Western blot analysis of EnGAM82 protein levels. (B) Quantitation of the Western blot analysis of EnGAM82 protein levels. MZ-2: Second-generation of merozoites; MZ-3: Third-generation of merozoites; GAM: Gametocyte; UO: Unsporulated oocysts. *Significant difference (P < 0.05); ⁎⁎significant difference (P < 0.01); ⁎⁎⁎significant difference (P < 0.001). ⁎⁎⁎⁎significant difference (P < 0.0001).
Protective efficacy of rEnGAM82-T immunization
ACI (Anticoccidial Index)
All chickens survived throughout the experiment period (100 % survival rate). Bloody droppings were first observed at approximately 120 hpi, peaking between 144 and 168 hpi, and gradually subsided after 180 hpi, accompanied by recovery of appetite and activity. Persistent bloody droppings were observed in the IC and UC groups, whereas no abnormal symptoms noted in the UU group. Quantitative analysis showed that the UC group (143) had the highest number of bloody droppings, while the rEnGAM82-T-M group (102) had the lowest (Fig. 8A). The average body weight gain of all IC groups was significantly higher than that of the UC group (P < 0.05), with the rEnGAM82-T-M group exhibiting the best growth performance (Table 4).
Fig. 8.
Temporal changes in fecal blood scores among different experimental groups following Eimeria infection. (A) The number of bloody droppings in each group during the rEnGAM82-T protective effect experiment. (B) The number of bloody droppings in each group during the rEnGAM82-T-22 protective effect experiment.
Table 4.
Protective efficacy of rEnGAM82-T vaccination on E. necatrix challenge.
| Groups | Body weight gains (g) |
Relative weight gain (%) |
lesion scores | oocyst reduction (%) | Sporulation rate (%) | Anticoccidial index |
|---|---|---|---|---|---|---|
| rEnGAM82-T-H | 184.53 ± 14.25c | 82.94 | 2.25 ± 0.54b | 50.89 | 70 | 150.44 |
| rEnGAM82-T-M | 206.50 ± 11.44b | 92.82 | 2.20 ± 0.35b | 55.30 | 63 | 160.82 |
| rEnGAM82-T-L | 181.80 ± 19.60c | 81.72 | 2.50 ± 0.58b | 40.22 | 68 | 136.72 |
| UC | 148.51 ± 26.36d | 66.75 | 3.10 ± 0.39a | - | 77 | 95.75 |
| UU | 222.48 ± 10.21a | 100.00 | 0 ± 0.00c | - | / | 200.00 |
Note: a–d values with different letters in the same column are significantly different (P < 0.05) according to the ANOVA Duncan test.
Among all IC groups, the rEnGAM82-T-M group had the highest RWG (92.28 %). Pathological examination revealed that intestinal lesion scores were significantly lower in all IC groups than in the control group (P < 0.05), with the rEnGAM82-T-M group showing the mildest lesions. Oocyst output and sporulation rate were also significantly reduced in all IC groups (P < 0.05). The UC group produced an average of 1.52 × 10⁶ oocysts per bird, whereas the rEnGAM82-T-M group produced only 0.68 × 10⁶ oocysts per bird, corresponding to a 55.3 % reduction. The lowest sporulation rate (63 %) was observed in the rEnGAM82-T-M group. The ACI of rEnGAM82-T-M group reached 160.82, indicating a moderate anticoccidial efficacy, whereas the other IC groups showed low efficacy (ACI < 160).
Serum antibody responses
As shown in Fig. 9A, at 7 days after the primary immunization (12 d), all IC groups exhibited significantly higher antibody levels than the UC and UU groups (P < 0.05). Following the booster immunization (19 d), antibody levels further increased, with the rEnGAM82-T-H group showing the highest response among all groups (P < 0.0001).
Fig. 9.
The antibody levels were measured using an indirect ELISA. (A) ELISA detection of IgY levels response to immunization with rEnGAM82-T protein. The antibody levels increased obviously in the immunized groups after the second immunization (19 days old). The highest IgY levels were found in the group rEnGAM82-T-H, which was significantly higher than in all other groups (P < 0.0001). (B) ELISA detection of IgY levels response to immunization with rEnGAM82-T-22, rEnGAM82-T or rEnGAM22 protein. The antibody levels increased obviously in the immunized groups after the second immunization (19 days old). The rEnGAM82-T-22-H group had the highest IgY levels among the all groups, followed by rEnGAM22 group after the second immunization. Significant difference (P < 0.05); ⁎⁎significant difference (P < 0.01); ⁎⁎⁎Significant difference (P < 0.001); ⁎⁎⁎⁎Significant difference (P < 0.0001).
Protective efficacy of rEnGAM82-T-22 fusion protein
ACI (Anticoccidial Index)
With the exception of one death observed in the UC group, no mortality was recorded in any other experimental group. During days 19-28 post-challenge, all IC groups showed significantly higher BWG than the UC group (P < 0.05), with the rEnGAM82-T-22-L group showing the most pronounced growth-promoting effect (Table 5). The frequency of bloody droppings in the IC groups was significantly lower than that in the UC group (139), and the rEnGAM82-T-22-L group (92) showing the lowest frequency (Fig. 8B). Among all IC groups, the rEnGAM82-T-22-L group had the highest RWG (94.21 %). Intestinal lesion scores were highest in the UC group, significantly exceeding those of all IC groups (P < 0.05). Furthermore, the rEnGAM82-T-22-L group exhibited the highest oocyst reduction rate (63.82 %), followed by the rEnGAM22 group (52.97 %). The highest sporulation rate (80 %) was observed in the rEnGAM82-T-22-H group, followed by the rEnGAM82-T-22-M group (75 %). Overall, the rEnGAM82-T-22-L group achieved the highest ACI of 161.21.
Table 5.
Protective efficacy of rEnGAM vaccination on E. necatrix challenge.
| Groups | Body weight gains (g) |
Relative weight gain (%) |
lesion scores | oocyst reduction (%) | Sporulation rate (%) | Anticoccidial index |
|---|---|---|---|---|---|---|
| rEnGAM82-T-22-H | 204.14 ± 14.61c | 85.06 | 2.70 ± 0.35b | 37.47 | 80 | 138.06 |
| rEnGAM82-T-22-M | 219.17 ± 16.25bc | 91.32 | 2.55 ± 0.37b | 41.86 | 75 | 145.82 |
| rEnGAM82-T-22-L | 226.10 ± 17.72ab | 94.21 | 2.30 ± 0.54b | 63.82 | 61 | 161.21 |
| rEnGAM82-T-M | 219.92 ± 16.89bc | 91.63 | 2.55 ± 0.28b | 50.13 | 70 | 156.13 |
| REnGAM22 | 213.85 ± 15.70bc | 89.11 | 2.50 ± 0.58b | 52.97 | 72 | 154.11 |
| UC | 163.89 ± 21.97d | 68.29 | 3.40 ± 0.70a | - | 85 | 84.29 |
| UU | 239.99 ± 10.88a | 100.00 | 0 ± 0.00c | - | / | 200.00 |
Note: a–d values with different letters in the same column are significantly different (P < 0.05) according to the ANOVA Duncan test.
Serum antibody responses
As shown in Fig. 9B, at 12 days post-immunization, all immunized groups displayed significantly higher antibody levels than the UC and UU groups (P < 0.05). By 19 days post-immunization, antibody levels had further increased, with the rEnGAM82-T-22-H group showing the highest response among all groups (P < 0.0001).
Discussion
The oocyst wall plays an essential role in Eimeria survival and transmission by conferring structural protection and environmental resistance (Mai et al., 2009). Wall-forming proteins originate from gametocyte precursor proteins that undergo enzymatic processing and are crosslinked through disulfide bonds and dityrosine bridges within WFBs (Jia et al., 2023; Wang et al., 2023c). These reactions generate a highly stable oocyst wall matrix. Targeting gametocyte proteins involved in this process has emerged as a promising strategy for subunit vaccine development aimed at blocking oocyst wall assembly through antibody-mediated interference (Huang et al., 2018; Wang et al., 2025b).
In this study, the E. necatrix gam82 gene (1650 bp) was successfully cloned, encoding a 549-amino acid protein with a predicted molecular weight of 59.26 kDa. A truncated fragment corresponding to amino acids 258-464, enriched in tyrosine‑serine-rich regions (aa 258-442), was selected for recombinant expression on the basis of B-cell epitope predictions, yielding the recombinant protein rEnGAM82-T. Studies on the homologous EmGAM82 in E. maxima have shown that such tyrosine-rich domains are major immunodominant antigens (Belli et al., 2002, 2003b), and these motifs are directly involved in dityrosine cross-linking during oocyst wall assembly, representing functionally critical targets for transmission-blocking immunity. Interestingly, the native protein EnGAM82 exhibited an apparent molecular mass of approximately 100 kDa, which was markedly higher than the predicted value of 59.26 kDa. This discrepancy is consistent with previous observations for gametocyte antigens and may be attributed to post-translational modifications such as glycosylation (Belli et al., 2002), as well as the unusual amino acid composition of EnGAM82. In particular, its high proline content (8.7 %) is known to contribute to anomalous electrophoretic mobility, as proline-rich regions can introduce structural rigidity that prevents complete protein unfolding during SDS-PAGE, resulting in an increased stokes radius and electrophoretic mobility (Scheller et al., 2021; Levine and Oren, 2009; Wang et al., 2023a). Similarly, the recombinant fusion protein rEnGAM82-T-22 displayed an apparent molecular mass of approximately 60 kDa, exceeding the predicted value of 43.52 kDa. This anomalous electrophoretic mobility is consistent with that observed for native EnGAM82 and rEnGAM82. Additionally, the (Gly₄Ser)₃ flexible linker and the N-terminal His-tag may further contribute to the observed molecular mass shift.
Western blot analysis demonstrated that rEnGAM82-T exhibited strong immunoreactivity, being recognized by both polyclonal antibodies and convalescent sera from E. necatrix, E. maxima, and E. acervulina, but not from E. tenella. This species-specific reactivity pattern is consistent with the apparent absence of identifiable GAM82 homologs in the E. tenella genome database. The cross-reactivity observed among these three species suggests that EnGAM82 may serve as a broad-spectrum vaccine candidate targeting multiple Eimeria species that infect poultry. This cross-reactivity likely reflects the sequence conservation of GAM82 homologs among these Eimeria species, suggesting that the tyrosine‑serine-rich region essential for oocyst wall biosynthesis are functionally constrained and represent conserved immunological targets. Notably, the absence of cross-reactivity with E. tenella sera is consistent with the lack of identifiable GAM82 homologs in its genome. These findings support the potential for developing a broad-spectrum, multi-Eimeria transmission-blocking vaccine based on conserved GAM82 epitopes, although systematic comparative analyses of GAM82 homologs across all poultry-infecting Eimeria species are needed to validate this strategy.
Immunofluorescence analysis revealed that EnGAM82 is specifically localized to WFBII during the GAM stage and subsequently incorporated into the developing oocyst wall. This localization pattern, together with the synchronized transcriptional and translational peaks observed during the GAM and UO stages, further supports a critical role for EnGAM82 in oocyst wall biogenesis. Notably, EnGAM82 is localized in WFBII, whereas EnGAM22 is localized in WFBI (Wang et al., 2023b). The WFBI and WFBII compartments contribute distinct protein components to the oocyst wall, with WFBI-derived proteins forming the outer wall layer and WFBII-derived proteins constituting the inner layer (Ferguson et al., 2003). Therefore, combining these two proteins in a fusion construct may elicit synergistic immune responses by simultaneously targeting distinct structural components essential for oocyst wall integrity.
Immunization trials demonstrated that rEnGAM82-T significantly alleviated infection symptoms, reduced intestinal lesions and oocyst shedding, and improved growth performance. The medium-dose group (100 μg/bird) achieved the highest protective efficacy (ACI = 160.82), indicating moderate protection based on established criteria. Importantly, the fusion protein rEnGAM82-T-22 conferred the strongest protection at a lower dose (50 μg/bird) with an ACI of 161.21, and yielded significantly higher ACI values than those of the single-antigen groups. These results support the strategy of combining WFBI- and WFBII-derived proteins to achieve enhanced protection. Interestingly, higher antigen doses (200 μg/bird) resulted in diminished protective efficacy despite eliciting the highest antibody titers. This inverse dose-response relationship may be attributed to antigen-induced immune tolerance or dysregulation resulting from excessive antigenic stimulation, rather than antibody-dependent enhancement (ADE), which is predominantly associated with viral infections (Lee et al., 2020). These findings underscore the critical importance of dose optimization in recombinant vaccine design, because excessive activation of humoral immunity may paradoxically impair protective outcomes (Wang et al., 2024).
Despite these promising results, several limitations should be acknowledged. The duration of protective immunity was not assessed, which is essential for determining optimal booster schedules. Additionally, although humoral responses were characterized, the contribution of cell-mediated immunity to protection remains unclear and warrants further investigation through T-cell functional assays. Furthermore, the molecular mechanisms by which anti-GAM82 antibodies interfere with oocyst wall biogenesis remain to be elucidated.
In conclusion, our findings demonstrate that EnGAM82 is a WFBII-localized gametocyte antigen with strong immunogenicity that is likely involved in oocyst wall formation, as evidenced by its specific localization to WFBII, stage-specific expression pattern, and subsequent incorporation into the developing oocyst wall. The synergistic protection achieved by combining EnGAM82 with WFBI-derived antigens, together with the importance of dose optimization, provides valuable insights for the rational design of next-generation multi-component vaccines against avian coccidiosis. Moreover, the observed cross-reactivity of rEnGAM82-T with sera from multiple Eimeria species highlights the potential of conserved GAM82 homologs as targets for the development of broad-spectrum transmission-blocking vaccines.
Funding
This work was supported by the National Natural Science Foundation of China (No.31602039); the Graduate Student Scientific Research Innovation Projects of Jiangsu Province (KYCX25_4076); the 111 Project D18007, the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
Ethical approval
Ethical approval was obtained from the Animal Experiment Ethics Committee of Yangzhou University (Approval No. 202402010) on February 20, 2024.
Mice were anaesthetized by carbon dioxide (CO₂) inhalation prior to retroorbital blood collection. CO₂ was introduced into the chamber at a gradual displacement rate of 20-30 % of the chamber volume per minute, allowing the animals to gradually lose consciousness and ensuring that sampling was conducted in a pain-free state.
Chickens were euthanized via CO₂ inhalation using a gradual-fill method, in which the CO₂ concentration was steadily increased to 60-70 % of the chamber volume, ensuring a humane and distress-free induction of unconsciousness.
CRediT authorship contribution statement
Feiyan Wang: Writing – original draft, Investigation. Xinyin Zhang: Writing – original draft, Investigation. Yongcui Feng: Investigation. Lu Zhang: Investigation. Yu Zhang: Investigation, Funding acquisition. Jinjun Xu: Writing – review & editing. Jianping Tao: Writing – review & editing, Funding acquisition. Dandan Liu: Writing – review & editing, Funding acquisition.
Disclosures
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Acknowledgement
We truly appreciate the time and effort volunteered by the Associate Prof. Dandan Liu and Xinyin Zhang during the hard‐working days. We would also like to thank Home for Researchers (www.home-for-researchers.com) and ChatGPT for their assistance with language polishing, which helped to enhance the clarity and fluency of this manuscript.
Footnotes
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.psj.2026.106635.
Contributor Information
Feiyan Wang, Email: 243874433@qq.com.
Xinyin Zhang, Email: 1343642725@qq.com.
Yongcui Feng, Email: 1586198434@qq.com.
Lu Zhang, Email: 3270472017@qq.com.
Yu Zhang, Email: 1149027543@qq.com.
Jinjun Xu, Email: jjxu@yzu.edu.cn.
Dandan Liu, Email: ddliu@yzu.edu.cn.
Appendix. Supplementary materials
References
- Attree E., Sanchez-Arsuaga G., Jones M., Xia D., Marugan-Hernandez V., Blake D., Tomley F. Controlling the causative agents of coccidiosis in domestic chickens; an eye on the past and considerations for the future. CABI Agric. Biosci. 2021;2:37. doi: 10.1186/s43170-021-00056-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Belli S.I., Lee M.., Thebo P., Wallach M.G., Schwartsburd B., Smith N.C. Biochemical characterisation of the 56 and 82 kDa immunodominant gametocyte antigens from Eimeria maxima. Int. J. Parasitol. 2002;32:805–816. doi: 10.1016/s0020-7519(02)00011-5. [DOI] [PubMed] [Google Scholar]
- Belli S.I., Wallach M..G., Luxford C., Davies M.J., Smith N.C. Roles of tyrosine-rich precursor glycoproteins and dityrosine- and 3,4-dihydroxyphenylalanine-mediated protein cross-linking in development of the oocyst wall in the coccidian parasite Eimeria maxima. Eukaryot. Cell. 2003;2:456–464. doi: 10.1128/EC.2.3.456-464.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Belli S.I., Wallach M..G., Smith N.C. Cloning and characterization of the 82 kDa tyrosine-rich sexual stage glycoprotein, GAM82, and its role in oocyst wall formation in the apicomplexan parasite, Eimeria maxima. Gene. 2003;307:201–212. doi: 10.1016/s0378-1119(03)00451-7. [DOI] [PubMed] [Google Scholar]
- Blake D.P. Eimeria of chickens: the changing face of an old foe. Avian Pathol. 2025:1–12. doi: 10.1080/03079457.2024.2441180. [DOI] [PubMed] [Google Scholar]
- Ferguson D.J.P., Belli S.I., Smith N.C., Wallach M.G. The development of the macrogamete and oocyst wall in Eimeria maxima: immuno-light and electron microscopy. Int. J. Parasitol. 2003;33:1329–1340. doi: 10.1016/s0020-7519(03)00185-1. [DOI] [PubMed] [Google Scholar]
- Huang J., Liu T., Li K., Song X., Yan R., Xu L., Li X. Proteomic analysis of protein interactions between Eimeria maxima sporozoites and chicken jejunal epithelial cells by shotgun LC-MS/MS. Parasit. Vectors. 2018;11:226. doi: 10.1186/s13071-018-2818-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jia L., Zhao Q., Zhu S., Han H., Zhao H., Yu Y., Yang J., Dong H. Proteomic analysis of fractionated eimeria tenella sporulated oocysts reveals involvement in oocyst wall formation. IJMS. 2023;24 doi: 10.3390/ijms242317051. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson J., Reid W.M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970;28:30–36. doi: 10.1016/0014-4894(70)90063-9. [DOI] [PubMed] [Google Scholar]
- Lee W.S., Wheatley A..K., Kent S.J., DeKosky B.J. Antibody-dependent enhancement and SARS-CoV-2 vaccines and therapies. Nat. Microbiol. 2020;5:1185–1191. doi: 10.1038/s41564-020-00789-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Levine A.J., Oren M. The first 30 years of p53: growing ever more complex. Nat. Rev. Cancer. 2009;9:749–758. doi: 10.1038/nrc2723. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu D., Cao L., Zhu Y. Cloning and expression of Engam59 gene from Eimeria necatrix gametocyte and immunogenicity analysis of its expressed product. Chin. Vet. Sci. 2017;47:1510–1516. [Google Scholar]
- Liu D., Cao L., Zhu Y., Deng C., Su S., Xu J., Jin W., Li J., Wu L., Tao J. Cloning and characterization of an Eimeria necatrix gene encoding a gametocyte protein and associated with oocyst wall formation. Parasit. Vectors. 2014;7:27. doi: 10.1186/1756-3305-7-27. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Mai K., Sharman P.A., Walker R.A., Katrib M., De Souza D., McConville M.J., Wallach M.G., Belli S.I., Ferguson D.J.P., Smith N.C. Oocyst wall formation and composition in coccidian parasites. Mem. Inst. Oswaldo Cruz. 2009;104:281–289. doi: 10.1590/s0074-02762009000200022. [DOI] [PubMed] [Google Scholar]
- Mathis G.F., Lumpkins B.., Cervantes H.M., Fitz-Coy S.H., Jenkins M.C., Jones M.K., Price K.R., Dalloul R.A. Coccidiosis in poultry: disease mechanisms, control strategies, and future directions. Poult. Sci. 2025;104 doi: 10.1016/j.psj.2024.104663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McManus E.C., Campbell W..C., Cuckler A.C. Development of resistance to quinoline coccidiostats under field and laboratory conditions. J. Parasitol. 1968;54(6):1190–1193. 54: 1190–1193. 1968. [PubMed] [Google Scholar]
- Scheller C., Krebs F., Wiesner R., Wätzig H., Oltmann-Norden I. A comparative study of CE-SDS, SDS-PAGE, and Simple Western-precision, repeatability, and apparent molecular mass shifts by glycosylation. Electrophoresis. 2021;42:1521–1531. doi: 10.1002/elps.202100068. [DOI] [PubMed] [Google Scholar]
- Su S., Hou Z., Liu D., Jia C., Wang L., Xu J., Tao J. Comparative transcriptome analysis of second- and third-generation merozoites of Eimeria necatrix. Parasit. Vectors. 2017;10:388. doi: 10.1186/s13071-017-2325-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Venkatas J., Adeleke M.A. A review of Eimeria antigen identification for the development of novel anticoccidial vaccines. Parasitol. Res. 2019;118:1701–1710. doi: 10.1007/s00436-019-06338-2. [DOI] [PubMed] [Google Scholar]
- Wang F., Cao L., Wang L., Xu J., Tao J., Liu D. Characterization of the antigenic and immunogenic properties of the gametocyte antigen 56 from Eimeria necatrix. Animals. 2025;15:1750. doi: 10.3390/ani15121750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang H., Guo M., Wei H., Chen Y. Targeting p53 pathways: mechanisms, structures and advances in therapy. Sig. Transduct. Target. Ther. 2023;8:92. doi: 10.1038/s41392-023-01347-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang L., Liu D., Gao Y., Hou Z., Zhu Y., Wang F., Li W., Zhang A., Xu J., Hu J., Tao J. Examination of gametocyte protein 22 localization and oocyst wall formation in Eimeria necatrix using laser confocal microscopy and scanning electron microscopy. Parasit. Vectors. 2023;16:124. doi: 10.1186/s13071-023-05742-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang L., Liu D., Zhu Y., Wang F., Cai W., Feng Q., Su S., Hou Z., Xu J., Hu J., Tao J. Comparative proteomic analysis of wall-forming bodies and oocyst wall reveals the molecular basis underlying oocyst wall formation in Eimeria necatrix. Parasit. Vectors. 2023;16:460. doi: 10.1186/s13071-023-06076-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang F., Peng Y., Ye Z., Feng Y., Zhang Y., Xu J., Tao J., Liu D. A novel glutathione peroxidase (EnGPX) from Eimeria necatrix contributes to oocyst wall biogenesis and confers protective immunity in chickens. Vet. Parasitol. 2025;339 doi: 10.1016/j.vetpar.2025.110588. [DOI] [PubMed] [Google Scholar]
- Wang H., Tian J., Zhao J., Zhao Y., Yang H., Zhang G. Current status of poultry recombinant virus vector vaccine development. Vaccines. 2024;12:630. doi: 10.3390/vaccines12060630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhu Y., Liu D., Wang L., Feng Q., Wang F., Xue N., Hou Z., Xu J., Hu J., Tao J. Observations of the fine structural changes associated with merogony and gametogony in eimeria necatrix and localization of two gametocyte proteins. Microorganisms. 2025;13:1135. doi: 10.3390/microorganisms13051135. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.









