Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Feb 25.
Published in final edited form as: Neurosci Lett. 2025 Oct 5;868:138409. doi: 10.1016/j.neulet.2025.138409

Regional differences in oxytocin and vasopressin 1a receptor functionality in mouse embryonic brain development

Elliot Sommer 1, Heather K Caldwell 1,2,*
PMCID: PMC12930485  NIHMSID: NIHMS2145747  PMID: 41057092

Abstract

There is mounting evidence that the oxytocin (Oxt) and vasopressin (Avp) systems contribute to early brain development. Work from transgenic mouse models as well as pharmacological manipulation of the Oxt and Avp systems suggests that signaling through the Oxt receptor (Oxtr) and the Avp 1a receptor (Avpr1a) during embryonic brain development affects behavior in adulthood. Unfortunately, at this time, very little is known or understood about where in the brain Oxtr and Avpr1a occurs during embryonic development or what the downstream consequences may be. To help provide some answers, Oxtr- and Avpr1a-stimulated G-protein coupled receptor binding assays were performed using guanosine 5’-(γ-thio)triphosphate, a non-hydrolyzable analog of guanosine triphosphate, to determine the functionality of the Oxtr and Avpr1a in both sexes at embryonic day (E) 14.5, E16.5, and E18.5. Based on previous work, we hypothesized that the Oxtr and Avpr1a would be functional in both sexes by E16.5 and activated by Oxt and Avp, respectively. The data suggest that while the Oxtr and Avpr1a are functional in both sexes starting at E16.5, where in the brain they are functional is not fully aligned with where there is known receptor binding. For the Oxtr, at E16.5, functional binding was observed in the ventricular and subventricular zones of the cortical and septal neuroepithelium and the amygdalar area, this shifted by E18.5 with functional binding observed only in the ventricular and subventricular septal neuroepithelium and the amygdalar area, with no functional binding observed in the ventricular and subventricular cortical neuroepithelium. For the Avpr1a, at E16.5, functional binding was only observed in the ventral hypothalamic area but by E18.5 functional binding was observed across numerous brain regions. Taken together, these data suggest that Oxtr and Avpr1a signaling is positioned to have site-specific effects on mouse brain development starting at E16.5.

Introduction

In mammals, behaviors crucial for an individual’s survival are often modulated by two nine amino acid neuropeptides: oxytocin (Oxt) and arginine vasopressin (Avp) (Caldwell 2021, Carter 2022, Rigney, de Vries et al. 2022). Specifically, from juveniles and adults, Oxt signaling through the Oxt receptor (Oxtr) and Avp signaling through either the Avp 1a receptor (Avpr1a) or the Avp1b receptor (Avpr1b) are known to modulate a variety of behaviors including, but not limited to, aggression, play behavior, maternal behavior, social memory, social monogamy, and sociability (Caldwell 2021, Carter 2022, Rigney, de Vries et al. 2022). Beyond their involvement in regulating these behaviors, there are also known sex differences in the Oxt and Avp systems, most commonly in the distribution of the receptors, which are known to directly contribute to the richness of these systems in the neural regulation of behavior (Rigney, de Vries et al. 2022, Veney and Caldwell 2024).

While understanding the sex- and species-specific influence of the Oxt and Avp systems remains important work, largely unexplored is the developmental origins of these systems and their impact on brain development and neurochemistry. For instance, it is largely unknown as to whether Oxt and Avp’s neuromodulatory effects in juveniles and adults are mostly an extension of their roles in development, if their developmental roles are distinct, or if there is some combination of the two. However, previous work suggests that these systems, acting in embryonic and early postnatal life, help to shape sex-specific brain development, in turn, impacting behavior later in life (Cushing 2013, Hammock 2015, Miller and Caldwell 2015, Tamborski, Mintz et al. 2016, Vaidyanathan and Hammock 2017, Aulino and Caldwell 2020, Tabbaa and Hammock 2020, Aulino and Caldwell 2021, Muscatelli, Matarazzo et al. 2022, Kenkel, Ortiz et al. 2023).

Work in the early postnatal life of prairie voles, and a few other rodent species, suggests that perturbations in either Oxtr and Avpr1a signaling impacts neurochemistry and behavior. In neonatal prairie voles, treatment with an Oxtr antagonist (OxtrA) or Oxt can affect neural activity, as measured by c-Fos immunochemistry, and brain chemistry in sex-specific ways. For example, females treated with an OxtrA have increases in c-Fos immunoreactivity in the supraoptic nucleus (SON) but decreases in the mediodorsal thalamic nucleus (MD) as compared to controls. In males, Oxt administration increases c-Fos immunoreactivity only in the SON (Cushing, Yamamoto et al. 2003). There are also sex-specific effects on the Oxt, Avp, and serotonin systems of prairie voles (Yamamoto, Cushing et al. 2004, Eaton, Roache et al. 2012), with some supporting evidence in rats (Perry, Paramadilok et al. 2009). Behaviorally, neonatal manipulations of the prairie vole Oxt system affects both female and male behaviors (Cook and Sepinwall 1975, Cushing, Levine et al. 2005). In females, pair-bonding, alloparental care, pup retrievals, and stress responses are impacted, the latter measured by ultrasonic vocalizations and plasma corticosterone concentrations (Kramer, Cushing et al. 2003, Bales, van Westerhuyzen et al. 2007, Mogi, Ooyama et al. 2014). In males, parental care and aggressive behaviors are affected (Banciu 1975, Cook and Sepinwall 1975). While there are fewer studies on the Avp system, in Wistar rats, neonatal Avp treatment has long lasting behavioral effects in both males and females, including increases in grooming in both sexes and increases in male locomotor activity (Boer, Quak et al. 1994). In female Sprague-Dawley rats, treatment with an Avpr antagonist in neonatal development results in increases in female copulatory behavior and hypothalamic Avp (Meyerson, Hoglund et al. 1988). Collectively, these studies underscore the significance of Oxtr signaling modulation during critical developmental windows around the time of parturition, which can directly influence the establishment of the foundational mechanisms which govern sex-specific social behaviors.

If we look earlier in development, what is known is no less compelling. In mouse embryonic development there are sex differences in the Oxt system. Work from our lab has shown that Oxt mRNA is measurable in female mice as early as embryonic day (E) 12.5 but is not measurable in males until postnatal day (PND) 2 (Tamborski, Mintz et al. 2016). The Oxtr is expressed in male and female mice as early as E16.5 in the subventricular (SVZ) and ventricular zone (VZ) of cortical and septal neuroepithelium, as well as the developing amygdalar area (Tamborski, Mintz et al. 2016). This differs from the Avp system, in which mRNA transcripts for Avp are detected in both male and female mice at E14.5 (Aulino and Caldwell 2020), with Avpr1a binding a ligand both males and females at E16.5. The Avpr1a at the E16.5 timepoint is also more broadly expressed than the Oxtr, being found in the fornix (F), indusium griseum (IG), nucleus of the vertical limb of the diagonal band of Broca (NVL), the olfactory tubercle (OT), and the anterior ventral hypothalamus (VHA). Additionally, when E16.5 embryos are injected with an OxtrA sex-specific behavioral changes are observed in adulthood (Aulino and Caldwell 2021). Specifically, treatment with an OxtrA, results in males displaying increases in agonistic behavior, social investigation, and depressive-like behavior, and females having impairments in their social recognition memory (Aulino and Caldwell 2021). Treatment with an Avpr1a antagonist (Avpr1aA), however, generally results in increases in social investigation in both sexes (Reese and Caldwell in preparation). Given the differences in developmental timing, and particularly the distribution of the receptors, it seems likely that each system has a distinctive role in brain development. Though, at this time, what those roles are remains largely unknown.

While the receptor binding patterns described above were established using specific 125I labeled linear antagonists, this approach simply confirms the binding of the antagonist to a binding pocket but does not provide information about activation of the 2nd messenger cascade. Thus, in the work described here we set out to determine the functional binding capacity of the Oxtr and the Avpr1a in the mouse embryonic brain using agonist-stimulated [35S] guanosine 5’-(γ-thio)triphosphate (GTPgS) binding autoradiography. By applying either a specific Oxtr agonist or Avp, along with [35S]GTPgS, we were able to assess the functionality of the Oxtr and Avpr1a across embryonic development. We hypothesized that there would be region-, sex-, and temporal-specific differences in receptor functionality in across embryonic brain development.

Methods

Subjects

Group housed female (n=4 dams per timepoint) C57BL/6J mice between 2 to 4 months of age were paired with experienced male C57BL/6J breeders for two weeks. All subjects were provided food and water ad libitum and kept on a 12:12 light-dark cycle. Each morning, during the light phase, females were inspected for a sperm plug to confirm pregnancy, defined as E0.5. Once a female was found to be pregnant, she was single housed. Embryonic tissue was then collected for specific timepoints, detailed below. All experiments were conducted in accordance with protocols approved by the Kent State University Institutional Care and Use Committee.

Embryonic Tissue Collection

Tissue was collected at E14.5, E16.5, and E18.5 from pregnant dams that had been anesthetized with an overdose of isoflurane. To account for possible differences across litters, a male and female embryos were collected from a minimum of n=3 litters per timepoint. Briefly, an abdominal midline incision was made, the uterine horns exposed, and the position of each embryo noted, as it related to the cervix and ovaries. Each embryo was then removed from the uterus and the amniotic sac, and a tail clip taken for sex determination PCR analysis. The heads were then removed and frozen at −80°C until processed. The dam then was then euthanized via cervical dislocation.

Sex-determination PCR

DNA from tail clips was extracted as described previously in (Lambert, Benoit et al. 2000, Tamborski, Mintz et al. 2016, Aulino and Caldwell 2020) amplified and compared to amplified SRY and IL3 (control) genes to determine the sex of embryos using primers (5’ to 3’): SRY gene, forward: TGGGACTGGTGACAATTGTC, reverse: GAGTACAGGTGTGCAGCTCT; IL3 gene, forward: GGGACTCCAAGCTTCAATCA, reverse: TGGAGGAGGAAGAAAAGCAA. The DNA was amplified on a C1000 Touch™ Thermal Cycler (Bio-Rad, Hercules, CA) and programmed with the following cycles: one cycle of 95 °C for 4 min, 39 cycles of 95 °C for 1 min, 50 °C for 1 min, and 72 °C for 45 s, one cycle of 72 °C for 5 min, then held at 10 °C until removed. The samples were then run on a 1.5% agarose gel. A single IL3 band at 543bp identified a female, where the same IL3 band at 543bp in addition to an SRY band at 401bp identified a male.

Validation: Agonist and GDP Concentration Assays

Adult tissue was sectioned at 15 μm on a cryostat, mounted onto Superfrost Plus™ (Fisher Scientific, Hampton, NH) slides and allowed to air dry. Slides were stored at −80°C until processed with the radiolabel. The Oxtr agonist, HO1 [Thr4]OT (courtesy of Dr. Maurice Manning), was used at 0μM, 1μM, 2μM, and 4μM to induce activation of Oxtr in the sectioned tissue, whereas Avp was used at 0μM, 1μM, 2μM, and 4μM to induce activation of the Avpr1a in the sectioned the tissue. Concentrations of agonist were determined as previously demonstrated in (Sim, Selley et al. 1995), where millimolar levels of agonist were used to effectively stimulate ([35S]GTPɣS binding in brain tissue sections. Sections were thawed for 5 min at room temperature (RT), and were incubated in assay buffer (50 mM Tris-HCl, 3mM MgCl2, 200μM EGTA, and 100mM NaCl at a pH of 7.4) for 10 minutes, assay buffer with GDP for 15 minutes, then incubated in assay buffer containing the radioligand ([35S]GTPɣS 0.04 nM, Product ID: NEG030H, Perkin Elmer, Waltham, MA) for 2h at RT, and finally dipped and washed for 5 min in washing buffer (Tris – HCl 50 mM, pH 7.5) at 4°C. Sections were dipped in distilled water at 4°C and dried using a hair dryer. Optimization of receptor-stimulated [35S]GTPgS binding was determined by the greatest binding density increases for each agonist. Once optimized, agonist concentrations were determined, another assay was run to determine the optimal concentration of GDP. Oxtr agonist, HO1 [Thr4]OT, was used at 2μM to induce activation of Oxtr in the sliced tissue, whereas Avp was used at 4μM to induce activation of the Avpr1a in the tissue at varying concentrations of GDP (1mM, 2mM, 4mM, and 8mM). Optimization of GDP concentration was determined by the greatest binding density increase within the four GDP concentrations measured.

Functional Autoradiography

Agonist-stimulated [35S]GTPgS binding autoradiography was used in order to assess the functional binding capabilities of the Oxtr and Avpr1a. E14.5, E16.5, and E18.5 heads (3 male and 3 female litter-matched sibling pairs at each timepoint) were cut at 15μm on a cryostat (Leica 1950; Leica Biosystems, Buffalo Grove, IL, USA) at −20°C, mounted onto Superfrost Plus™ (Fisher Scientific, Hampton, NH) slides and allowed to air dry. Slides were stored at −80°C until functional autoradiography was performed. The Oxtr agonist, HO1 [Thr4]OT, was used to induce activation of Oxtr in the sliced tissue, whereas Avp was used to induce activation of the Avpr1a in the tissue. HO1 [Thr4]OT was selected as a specific agonist of the Oxtr due to it’s selectivity for the Oxtr over the Avrp1a and Avpr1b, with an affinity of 4179 units/mg for the Oxtr, and 4.92 units/mg and 5.3 units/mg for the Avpr1a and Avpr1b, respectively (Manning, Misicka et al. 2012).Briefly, sections were thawed for 5 min at RT, and were incubated in assay buffer (50 mM Tris-HCl, 3mM MgCl2, 200μM EGTA, and 100mM NaCl at a pH of 7.4) for 10 minutes, assay buffer with GDP (2mM) for 15 minutes, other than the slides to be used with GTPɣ, which are incubated in assay buffer without GDP for 15 minutes instead, then incubated in assay buffer (with or without GDP as specified previously) containing the radioligand ([35S]GTPɣS 0.04 nM, Product ID: NEG030H, Perkin Elmer, Waltham, MA) for 2h at RT, and finally dipped and washed for 5 min in washing buffer (Tris – HCl 50 mM, pH 7.5) at 4°C. Sections were dipped in distilled water at 4°C and dried using a hair dryer. Receptor-stimulated [35S]GTPgS binding was determined by inclusion of the Oxtr agonist, HO1 [Thr4]OT, 2 mM, or Avp at 4mM. Basal [35S]GTPgS binding was determined in the absence of agonist, and validated with the use of Oxtr (d(CH2)5[Tyr(Me)2,Thr4, Tyr-NH29]OVT [courtesy of Maurice Manning]) and Avpr1a ((D(CH2)51,TYR(ME)2,ARG8)-VASOPRESSIN [courtesy of Maurice Manning]) antagonists at 2, 4, 6 and 8 mM.

An increase in mCi/g from the baseline control in response to application of an agonist to the mounted tissue represents functional binding in that region. Antagonist application was expected to result in no change from the baseline control, demonstrating that the Oxtr and Avpr1a were selectively agonized, showing no evidence of receptor cross-talk.

Imaging and Analysis

Images for analysis were generated by exposing processed tissue sections to Perkin Elmer Cyclone© Storage Phosphor Screens and run for four hours in the Perkin Elmer Cyclone© system (Perkin Elmer, Waltham, MA), together with a 14C microscale (American Radiolabeled Chemicals, St. Louis, MO). The images from the phosphor screens were analyzed and quantified using images imported into iVision Scientific Image Processing software (BioVision Technologies, Exton, PA). Densitometric readings were converted into values of radioligand bound to tissue due using the 14C microscale as the standard and expressed as mCi/g tissue. Tissue sections were then cresyl violet stained and used along with the developing mouse brain atlas (Paxinos, Watson et al. 2006) to determine the neuroanatomical location of the receptor binding in the images from the phosphorimager (Figure 1). Regions of analysis were based upon where embryonic Oxtr and Avpr1a binding were observed in previous autoradiographic studies from our lab (Tamborski, Mintz et al. 2016, Aulino and Caldwell 2020).

Figure 1:

Figure 1:

Open in a new tab

Representative autoradiograms of a coronal section of an E16.5 mouse brain on which Oxtr functional binding was performed. Left Panel: Baseline binding, [35 S]GTPgammaS radiolabel and GDP only. Middle Panel: Agonist binding, [35 S]GTPgammaS radiolabel with the Oxtr agonist. Right Panel: Antagonist binding, a [35 S]GTPgammaS radiolabel with the Oxtr antagonist. These images represent the same animal at approximately the same point of the brain (anterior to posterior). The outline of the brain is in black and the regions of interest that were analyzed are outlined in red and labelled on the baseline image: 1) Subventricular/ventricular zone, cortical neuroepithelium (SVZ/VZ CN), 2) Subventricular/ventricular zone (SVZ/VZ SN), septal neuroepithelium, and 3) amygdala (AMY). Pseudocolor was applied to all of the images to enhance the visibility of the binding, no individual changes were made to any of the autoradiograms. Scale bar=1mm.

Statistical Analysis

Consistent with previous work, a two-way analysis of variance (ANOVA) (Dupuis, Palmier et al. 1998) was run to compare experimental treatments with sex as a between-subject factor. Paired t-tests were run between the agonist treated slides and the baseline slides and the antagonist treated slides and the baseline slides for each anatomical region of interest at a 95% confidence interval (Femenia and Manzanares 2012). A p-value of <0.05 was considered statistically significant.

Results

The Oxtr is not functional until E16.5

No functional binding was observed at E14.5 following application of HO1[Thr4]OT in any region of the brain (p>0.05). However, at E16.5, functional binding was observed, as determined by increased mCi/g in the SVZ/VZ cortical neuroepithelium (CN) (p<0.001, df=7, t=5.473), SVZ/VZ septal neuroepithelium (SN) (p<0.001, df=7, t=6.695), and the amygdala (p<0.05, df=7, t=2.936) (Figure 2). At E18.5, increased mCi/g, representing agonist-stimulated functional binding, was observed in the SVZ/VZ SN (p<0.05, df=5, t=2.187) and the amygdala (p<0.05, df=7, t=3.184) only, with no significant increases in binding density observed in the SVZ/VZ CN (Figure 3). There were no sex differences observed at any of the timepoints evaluated and thus the data across the sexes were collapsed in the graphs.

Figure 2:

Figure 2:

Open in a new tab

Male and female embryonic mice brains (n=4 per sex, E16.5) were cut at 15 μm and treated with a [35S]GTPgammaS radiolabel, as well as an Oxtr agonist (agonist binding), an Oxtr antagonist (antagonist binding), or a control condition of only the radiolabel and GDP (baseline binding). Data from males and females were collapsed as there were no sex differences. Functional agonist stimulated binding was observed in the subventricular/ ventricular zone cortical neuroepithelium (SVZ/VZ CN) (p <0.001), the subventricular/ ventricular zone septal neuroepithelium (SVZ/VZ SN) (p <0.001), and the amygdala (AMY) (p=0.011). *represents a p value <0.05 and *** represents a p value <0.001.

Figure 3:

Figure 3:

Open in a new tab

Male and female embryonic mice brains (n=3 per sex, E18.5) were cut at 15 μm and treated with a [35S]GTPgammaS radiolabel, as well as an Oxtr agonist (agonist binding), an Oxtr antagonist (antagonist binding), or a control condition of only the radiolabel and GDP (baseline binding). Data from males and females were collapsed as there were no sex differences. Functional agonist stimulated binding was observed in the subventricular/ ventricular zone septal neuroepithelium (SVZ/VZ SN) (p<0.05) and the amygdala (AMY) (p<0.05). Functional binding was not observed in the last remaining area identified previously as expressing the Oxtr at E18.5: the subventricular/ ventricular zone cortical neuroepithelium (SVZ/VZ CN). *represents a p value <0.05.

The Avpr1a is functional at E16.5, but in a brain-region dependent way across embryonic development

At E14.5, no brain region showed functional Avpr1a binding following application of Avp to agonize the receptor. At E16.5, the developing VHA is the only neuroanatomical region where significantly increased binding density was observed in response to Avp acting at the Avpr1a (p=0.001, df=7 t=4.482). Even though Avpr1a binding has been observed in the NVL, F, OT, and the IG at E16.5 (Aulino and Caldwell 2020), there were no significant changes in mCi/g, suggestive of receptors that were not functional (Figure 4). At E18.5, significant increases in mCi/g representing functional Avpr1a activity were observed in the diagonal band of Brocca (DBB) (p<0.05, df=5, t=2.283), the OT (p<0.05, df=5, t=3.281), the septohippocampal nucleus (SHN) (p<0.05, df=5, t=2.800), glial wedge (GW) (p<0.05, df=5, t=2.085), and the arcuate hypothalamic nucleus (AHN) (p<0.05, df=5, t=2.286). Increased binding densities were not observed in the NVL, the medial septal nucleus (MSN), or the medial tuberal nucleus (MTN), where we have previously reported receptor binding (Aulino and Caldwell 2020) (Figure 5). There were no sex differences observed at any of the timepoints evaluated and thus the data across the sexes were collapsed in the graphs.

Figure 4:

Figure 4:

Open in a new tab

Male and female embryonic mice brains (n=4 per sex, E16.5) were cut at 15 μm and treated with a [35S]GTPgammaS radiolabel, as well as an Avpr1a agonist (agonist binding), an Avpr1a antagonist (antagonist binding), or a control condition of only the radiolabel and GDP (baseline binding). Data from males and females were collapsed as there were no sex differences. Functional agonist stimulated binding was only observed in the ventral hypothalamic area (VHA) (p<0.01). Functional binding was not observed in any of the other four areas identified previously as expressing the Avpr1a at E16.5: the nucleus of the vertical limb of the diagonal band of Broca (NVL), fornix (F), olfactory tubercle (OT), and the indusium griseum (IG). ** represents a p value <0.01.

Figure 5:

Figure 5:

Open in a new tab

Male and female embryonic mice brains (n=3 per sex, E18.5) were cut at 15 μm and treated with a [35S]GTPgammaS radiolabel as well as an Avpr1a agonist (agonist binding), an Avpr1a antagonist (antagonist binding), or a control condition of only the radiolabel and GDP (baseline binding). Data from males and females were collapsed as there were no sex differences. Functional agonist stimulated binding was observed in the diagonal band of Broca (DBB) (p<0.05), the olfactory tubercle (OT) (p<0.05), the septohippocampal nucleus (SHN) (p<0.05), glial wedge (GW) (p<0.05), and the arcuate hypothalamic nucleus (AHN) (p<0.05). Functional binding was not observed in any of the other areas identified previously as expressing the Avpr1a at E18.5: the nucleus of the vertical limb of the diagonal band of Broca (NVL), the medial septal nucleus (MSN), or the medial tuberal nucleus (MTN). * represents a p value <0.05.

Discussion

This work sought to determine the functional binding capability of both the Oxtr and the Avpr1a throughout mouse embryonic brain development. Using agonist-stimulated [35S]GTPgS receptor autoradiography, this study is the first to determine if expressed Oxtr and Avpr1a at E14.5, E16.5, and E18.5 are functional and capable of activating a second messenger cascade. While there were no sex-specific differences in functional receptor autoradiography for either receptor at any of the timepoints evaluated, it is important to acknowledge that the modest sample size may reduce the power to detect more subtle sex-related effects; therefore, interpretations regarding sex differences should be considered preliminary. The functionality of the receptors was unique to each system over the course of embryonic development. Thus, these results reinforce the assertion that the two systems have independent roles during embryonic brain development (Tamborski, Mintz et al. 2016, Aulino and Caldwell 2020).

Given that that there is no Oxtr and Avpr1a binding at E14.5 (Tamborski, Mintz et al. 2016, Aulino and Caldwell 2020), this timepoint served as an important negative control for the agonist-stimulated autoradiography. As would be predicted, there was no evidence of activation of the Oxtr or Avpr1a in the brain at this timepoint. However, at E16.5, the Oxtr was functional in each of the three neuroanatomical areas found to express the Oxtr at this timepoint, the VZ/SVZ CN, the VZ/SVZ SN, and the amygdala (Tamborski, Mintz et al. 2016). These data suggest that the changes social behaviors that are observed following a central injection of an OxtrA at E16.5 is due to a shift in the development of one or more of these brain regions (Aulino and Caldwell 2021). Therefore, it is likely that Oxt signaling in these brain regions contributes to the neural circuitry necessary for appropriate social behavior, or at least the building of that circuitry, at E16.5.

In the Avp system, only one brain region expressing the Avpr1a, the VHA, was functional at E16.5; even though Avpr1a binding is observed in several brain regions at this timepoint (Aulino and Caldwell 2020). These data also suggest that the increased social interactions observed in adults administered an Avpr1aA at E16.5 are likely specific to Avpr1a’s effects in this brain region (Reese & Caldwell, in preparation). Given the importance of the VHA, and in particular the ventral lateral portion, to social interest and reward, in social settings (Mei, Osakada et al. 2023), what the downstream effects of Avpr1a antagonism on this brain region can now be interrogated.

One of the three identified brain regions displaying functional binding capability for the Oxtr at E16.5, the SVZ/VZ CN, appears to become nonfunctional at E18.5. Interestingly, at E18.5, an increased number of neuroanatomical regions, as compared to E16.5, containing the Avpr1a display functional binding as compared to E16.5. Specifically, the DBB, OT, SHN, GW, and AHN have functional Avpr1a. However, the NVL, MSN, and MTN do not show functional binding at E18.5. This suggests that both the Oxtr and the Avpr1a have both temporal- and site- specific functions in embryonic development. Currently, there are no data on the possible behavioral effects of Oxtr or Avpr1a signal disruption at E18.5. However, with the changes in receptor functionality at this timepoint, studies regarding temporal and sex-specific behavioral changes following transient receptor signaling disruption at E18.5 could provide valuable insights into how these two systems temporally contribute shape the neural circuitry that is important to the neural regulation of behavior across embryonic development.

While we do not know if the receptors are functioning in the same way across the lifespan, we do know that signaling at functional receptors is a critical step in the development of contextually appropriate social behavior. The absence of Oxt or Oxtr in transgenic mice has been shown to cause physiological effects, such as increases in seizure activity, as well as impairments in social behaviors, such as heightened aggressive behaviors and impaired social memory (Sala, Braida et al. 2011, Caldwell, Aulino et al. 2017, Ripamonti, Ambrozkiewicz et al. 2017). Genetic disruption of Avpr1a signaling on the other hand appears to be less disruptive, with reports of more subtle effects on olfaction and aspects of memory (Goebel 1975, Meisler 1975, Wersinger, Caldwell et al. 2007, Wersinger, Temple et al. 2008). However, it appears that no matter the system, disruptions in either Oxtr or Avpr1a signaling directly contribute to lifelong changes in behavior (Aulino and Caldwell 2021, Reese and Caldwell in preparation)

While much of this work has focused on evaluating each system as an independent entity, it is important to recognize that Oxt is capable of binding to the Avpr1a and Avp is capable of binding to the Oxtr (Albers 2015, Song and Albers 2018). Due to structural similarities, the affinity of Avp for the Oxtr is approximately equal to that of the affinity of Avp for the Avpr1a, while Oxt has a higher affinity for its own receptor, the Oxtr (Mauillac, Chini et al. 1995, Hawtin, Tobin et al. 2001, Kawamata, Mitsui-Saito et al. 2003), suggesting that Avp may be just as likely to bind to and potentially signal through the Oxtr as the Avpr1a. Therefore, understanding the roles of the Oxt and Avp systems remains a real challenge, and it is useful to consider them together.

It is also of note that peptide availability in vivo in the neuroanatomical regions expressing these receptors during development has yet to be investigated. Thus, it is possible that in vivo Oxt is signaling through the Avpr1a and Avp is signaling through the Oxtr at these timepoints, and that the downstream effects of reciprocal signaling at these receptors could be modulating downstream effects important to the developing social brain. This could also be an underlying mechanism influencing the behavioral changes observed upon transiently disrupting receptor signaling in both systems (Aulino and Caldwell 2021, Reese and Caldwell in preparation).

In summary, the data presented here demonstrate that the Oxtr and Avpr1a are capable of functionally binding Oxt and Avp, respectively, during embryonic brain development. Previously, our lab identified the developmental time course of Oxt and Avp mRNA and Oxtr and Avpr1a distribution during embryonic development (Tamborski, Mintz et al. 2016, Aulino and Caldwell 2020). We have also determined that central administration of receptor antagonists for the Oxtr (Aulino and Caldwell 2021) and Avpr1a (Reese and Caldwell in preparation) can impact adult behavior. Specifically, transient disruption of the Oxtr at E16.5 with an OxtrA, results in adult male mice displaying increases in agonistic behaviors, increases in depressive-like behaviors, and increases in time spent investigating both novel and familiar stimulus mice (Aulino and Caldwell 2021). Adult female mice, on the other hand have impaired social memory, but no changes in depressive- or anxiety-like behaviors (Aulino and Caldwell 2021). Current work from our lab suggests that in male mice, but not female mice, transient disruption of the Avpr1a at E16.5 via an Avpr1aA, results in decreased affiliative grooming on day three of behavioral testing and increased sniffing on day 1 of resident-intruder testing, but no impairments in social discrimination, or depressive- or anxiety-like behaviors (Reese and Caldwell in preparation). What is reported here builds on these findings and provides further evidence that Oxtr and Avpr1a signaling during embryonic development is likely important for the development of the ‘social brain’. This possibility is very exciting and there remains much work to do.

References Cited

  1. Albers HE (2015). “Species, sex and individual differences in the vasotocin/vasopressin system: relationship to neurochemical signaling in the social behavior neural network.” Front Neuroendocrinol 36: 49–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aulino EA and Caldwell HK (2020). “Subtle sex differences in vasopressin mRNA expression in the embryonic mouse brain.” J Neuroendocrinol 32(2): e12835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aulino EA and Caldwell HK (2021). “Pharmacological manipulation of oxytocin receptor signaling during mouse embryonic development results in sex-specific behavioral effects in adulthood.” Horm Behav 135: 105026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bales KL, van Westerhuyzen JA, Lewis-Reese AD, Grotte ND, Lanter JA and Carter CS (2007). “Oxytocin has dose-dependent developmental effects on pair-bonding and alloparental care in female prairie voles.” Horm Behav 52(2): 274–279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Banciu T (1975). “[Current studies in the clinical physiology of gastric secretion].” Rev Med Interna Neurol Psihiatr Neurochir Dermatovenerol Med Interna 27(2): 83–92. [PubMed] [Google Scholar]
  6. Boer GJ, Quak J, de Vries MC and Heinsbroek RP (1994). “Mild sustained effects of neonatal vasopressin and oxytocin treatment on brain growth and behavior of the rat.” Peptides 15(2): 229–236. [DOI] [PubMed] [Google Scholar]
  7. Caldwell HK (2021). The Role of Oxytocin and Vasopressin in the Neural Regulation of Social Behavior, Oxford University Press. [Google Scholar]
  8. Caldwell HK, Aulino EA, Freeman AR, Miller TV and Witchey SK (2017). “Oxytocin and behavior: Lessons from knockout mice.” Dev Neurobiol 77(2): 190–201. [DOI] [PubMed] [Google Scholar]
  9. Carter CS (2022). “Sex, love and oxytocin: Two metaphors and a molecule.” Neurosci Biobehav Rev 143: 104948. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cook L and Sepinwall J (1975). “Behavior analysis of the effects and mechanisms of action of benzodiazepines.” Psychopharmacol Bull 11(4): 53–55. [PubMed] [Google Scholar]
  11. Cushing BS (2013). The orgnizational effects of oxytocin and vasopressin. Oxytocin, Vasopressin and Related Peptides in the Regulation of Behavior. Choleris E, Pfaff DW and Kavaliers M, Cambridge University Press: 56–72. [Google Scholar]
  12. Cushing BS, Levine K and Cushing NL (2005). “Neonatal manipulation of oxytocin influences female reproductive behavior and success.” Horm Behav 47(1): 22–28. [DOI] [PubMed] [Google Scholar]
  13. Cushing BS, Yamamoto Y, Hoffman GE and Carter CS (2003). “Central expression of c-Fos in neonatal male and female prairie voles in response to treatment with oxytocin.” Brain Res Dev Brain Res 143(2): 129–136. [DOI] [PubMed] [Google Scholar]
  14. Dupuis DS, Palmier C, Colpaert FC and Pauwels PJ (1998). “Autoradiography of serotonin 5-HT1A receptor-activated G proteins in guinea pig brain sections by agonist-stimulated [35S]GTPgammaS binding.” J Neurochem 70(3): 1258–1268. [DOI] [PubMed] [Google Scholar]
  15. Eaton JL, Roache L, Nguyen KN, Cushing BS, Troyer E, Papademetriou E and Raghanti MA (2012). “Organizational effects of oxytocin on serotonin innervation.” Dev Psychobiol 54(1): 92–97. [DOI] [PubMed] [Google Scholar]
  16. Femenia T and Manzanares J (2012). “Increased ethanol intake in prodynorphin knockout mice is associated to changes in opioid receptor function and dopamine transmission.” Addict Biol 17(2): 322–337. [DOI] [PubMed] [Google Scholar]
  17. Goebel WF (1975). “The golden era of immunology at the Rockefeller Institute.” Perspect Biol Med 18(3): 419–426. [DOI] [PubMed] [Google Scholar]
  18. Hammock EA (2015). “Developmental perspectives on oxytocin and vasopressin.” Neuropsychopharmacology 40(1): 24–42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hawtin SR, Tobin AB, Patel S and Wheatly M (2001). “Palmitoylation of the vasopressin V 1a receptor reveals different conformational requirements for signaling, agonist-induced receptor phosphorylation, and sequestration.” The Journal of Biological Chemistry 276(41): 38139–38146. [DOI] [PubMed] [Google Scholar]
  20. Kawamata M, Mitsui-Saito M, Kimura T, Takayanagi Y, Yanagisawa T and Nishimori K (2003). “Vasopressin-induced contraction of uterus is mediated solely by the oxytocin receptor in mice, but not in humans.” Eur J Pharmacol 472(3): 229–234. [DOI] [PubMed] [Google Scholar]
  21. Kenkel WM, Ortiz RJ, Yee JR, Perkeybile AM, Kulkarni P, Carter CS, Cushing BS and Ferris CF (2023). “Neuroanatomical and functional consequences of oxytocin treatment at birth in prairie voles.” Psychoneuroendocrinology 150: 106025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kramer KM, Cushing BS and Carter CS (2003). “Developmental effects of oxytocin on stress response: single versus repeated exposure.” Physiol Behav 79(4–5): 775–782. [DOI] [PubMed] [Google Scholar]
  23. Lambert JF, Benoit BO, Colvin GA, Carlson J, Delville Y and Quesenberry PJ (2000). “Quick sex determination of mouse fetuses.” J Neurosci Methods 95(2): 127–132. [DOI] [PubMed] [Google Scholar]
  24. Manning M, Misicka A, Olma A, Bankowski K, Stoev S, Chini B, Durroux T, Mouillac B, Corbani M and Guillon G (2012). “Oxytocin and vasopressin agonists and antagonists as research tools and potential therapeutics.” J Neuroendocrinol 24(4): 609–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Mauillac B, Chini B, Balestre M, Elands J, Trumpp-Kallmeyer S, Hoflack J, Hibert M, Jard S and Barberis C (1995). “The Binding Site of Neuropeptide Vasopressin V1a Receptor.” The Journal of Biological Chemistry 270(43): 25771–25777. [DOI] [PubMed] [Google Scholar]
  26. Mei L, Osakada T and Lin D (2023). “Hypothalamic control of innate social behaviors.” Science 382(6669): 399–404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Meisler MH (1975). “Inhibition of human liver beta-galactosidases and beta-glucosidase by n-bromoacetyl-beta-D-galactosylamine.” Biochim Biophys Acta 410(2): 347–353. [DOI] [PubMed] [Google Scholar]
  28. Meyerson BJ, Hoglund U, Johansson C, Blomqvist A and Ericson H (1988). “Neonatal vasopressin antagonist treatment facilitates adult copulatory behavior in female rats and increases hypothalamic vasopressin content.” Brain Res 473(2): 344–351. [DOI] [PubMed] [Google Scholar]
  29. Miller TV and Caldwell HK (2015). “Oxytocin during Development: Possible Organizational Effects on Behavior.” Front Endocrinol (Lausanne) 6: 76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Mogi K, Ooyama R, Nagasawa M and Kikusui T (2014). “Effects of neonatal oxytocin manipulation on development of social behaviors in mice.” Physiol Behav 133: 68–75. [DOI] [PubMed] [Google Scholar]
  31. Muscatelli F, Matarazzo V and Chini B (2022). “Neonatal oxytocin gives the tempo of social and feeding behaviors.” Front Mol Neurosci 15: 1071719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Paxinos G, Watson C, Koutcherov Y, Wang H and Halliday GM (2006). Atlas of the Developing Mouse Brain at E17.5, P0 and P6, Elsevier Science. [Google Scholar]
  33. Perry AN, Paramadilok A and Cushing BS (2009). “Neonatal oxytocin alters subsequent estrogen receptor alpha protein expression and estrogen sensitivity in the female rat.” Behav Brain Res 205(1): 154–161. [DOI] [PubMed] [Google Scholar]
  34. Reese K and Caldwell HK (in preparation). “Disruption of embryonic vasopressin 1a receptor signaling results in altered social behavior in adulthood.”
  35. Rigney N, de Vries GJ, Petrulis A and Young LJ (2022). “Oxytocin, Vasopressin, and Social Behavior: From Neural Circuits to Clinical Opportunities.” Endocrinology 163(9). [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ripamonti S, Ambrozkiewicz MC, Guzzi F, Gravati M, Biella G, Bormuth I, Hammer M, Tuffy LP, Sigler A, Kawabe H, Nishimori K, Toselli M, Brose N, Parenti M and Rhee J (2017). “Transient oxytocin signaling primes the development and function of excitatory hippocampal neurons.” Elife 6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sala M, Braida D, Lentini D, Busnelli M, Bulgheroni E, Capurro V, Finardi A, Donzelli A, Pattini L, Rubino T, Parolaro D, Nishimori K, Parenti M and Chini B (2011). “Pharmacologic rescue of impaired cognitive flexibility, social deficits, increased aggression, and seizure susceptibility in oxytocin receptor null mice: a neurobehavioral model of autism.” Biol Psychiatry 69(9): 875–882. [DOI] [PubMed] [Google Scholar]
  38. Sim LJ, Selley DE and Childers SR (1995). “In vitro autoradiography of receptor-activated G proteins in rat brain by agonist-stimulated guanylyl 5’-[gamma-[35S]thio]-triphosphate binding.” Proc Natl Acad Sci U S A 92(16): 7242–7246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Song Z and Albers HE (2018). “Cross-talk among oxytocin and arginine-vasopressin receptors: Relevance for basic and clinical studies of the brain and periphery.” Front Neuroendocrinol 51: 14–24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Tabbaa M and Hammock EAD (2020). “Orally administered oxytocin alters brain activation and behaviors of pre-weaning mice.” Horm Behav 118: 104613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tamborski S, Mintz EM and Caldwell HK (2016). “Sex Differences in the Embryonic Development of the Central Oxytocin System in Mice.” J Neuroendocrinol 28(4). [DOI] [PubMed] [Google Scholar]
  42. Vaidyanathan R and Hammock EA (2017). “Oxytocin receptor dynamics in the brain across development and species.” Dev Neurobiol 77(2): 143–157. [DOI] [PubMed] [Google Scholar]
  43. Veney SL and Caldwell HK (2024). Oxytocin, vasopressin, and sex differences in social behavior. It’s complicated! Neuroendocrinology of Behavior and Emotions: Environmental and Social Factors Affecting Behavior. Caldwell HK and Albers HE, Springer: 109–129. [Google Scholar]
  44. Wersinger SR, Caldwell HK, Martinez L, Gold P, Hu SB and Young WS 3rd (2007). “Vasopressin 1a receptor knockout mice have a subtle olfactory deficit but normal aggression.” Genes Brain Behav 6(6): 540–551. [DOI] [PubMed] [Google Scholar]
  45. Wersinger SR, Temple JL, Caldwell HK and Young WS 3rd (2008). “Inactivation of the oxytocin and the vasopressin (Avp) 1b receptor genes, but not the Avp 1a receptor gene, differentially impairs the Bruce effect in laboratory mice (Mus musculus).” Endocrinology 149(1): 116–121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Yamamoto Y, Cushing BS, Kramer KM, Epperson PD, Hoffman GE and Carter CS (2004). “Neonatal manipulations of oxytocin alter expression of oxytocin and vasopressin immunoreactive cells in the paraventricular nucleus of the hypothalamus in a gender-specific manner.” Neuroscience 125(4): 947–955. [DOI] [PubMed] [Google Scholar]

RESOURCES