Preliminary assessment of the use of targeted next-generation sequencing technology for detecting lymph node tuberculosis using ultrasound-guided core needle biopsy specimens

Abstract

Purpose

The current study aimed to evaluate the diagnostic utility of targeted next-generation sequencing (tNGS) technology in detecting lymph node tuberculosis (LNTB) using ultrasound-guided puncture core needle biopsy (CNB) samples.

Methods

This study was conducted on patients who underwent ultrasound-guided CNB operation. The samples obtained were used for the tNGS assay, mycobacterial tuberculosis (MTB) culture, Xpert MTB/RIF assay, and pathological examination. The sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and area under the curve (AUC) of these assays were calculated. Then, their diagnostic efficacy was compared with that of the composite reference standard.

Results

The sensitivity, specificity, PPV, NPV, and AUC of the tNGS assay for detecting LNTB were 95.4%, 88.9%, 98.4%, 72.7%, and 0.921, respectively. Those of the MTB culture were 26.2%, 100.0%, 100.0%, 15.8%, and 0.631, respectively. Those of the Xpert MTB/RIF assay were 72.3%, 100.0%, 100.0%, 33.3%, and 0.862, respectively. Those of the pathological examination were 80.0%, 88.9%, 98.1%, 38.1%, and 0.844, respectively. Among the tests, the tNGS assay had the highest sensitivity, and the results significantly differed among the methods.

Conclusion

The tNGS assay using CNB samples had a superior diagnostic efficacy for diagnosing LNTB. Hence, it has potential in clinical application.

Clinical trial

Not applicable.

Introduction

Mycobacterium tuberculosis (MTB) infects the human body and causes tuberculosis, which is still among the 10 most prevalent infectious diseases worldwide. In 2023, 10.8 million people globally were infected with tuberculosis, with 8.2 million new cases of tuberculosis resulting in 1.25 million deaths. Thus, following coronavirus disease 2019, tuberculosis is once again the leading fatal infectious disease worldwide [1]. According to the specific body regions affected, tuberculosis is categorized as pulmonary tuberculosis (PTB) or extrapulmonary tuberculosis (EPTB). PTB accounts for approximately 80% of all tuberculosis cases, meanwhile lymph node tuberculosis (LNTB) is the most common type of EPTB [2]. According to the affected site, LNTB can be categorized as superficial LNTB and deep LNTB. Superficial LNTB defined as the presence of lymph nodes in sites such as the neck, armpit, and groin, which often occurs between the subcutaneous fascia, making it easily detectable by conventional examination methods. Therefore, clinicians can readily obtain qualified specimens, and selecting appropriate diagnostic methods facilitates more efficient identification of the disease cause. Fine-needle biopsy (FNB), core needle biopsy (CNB), and lymph node dissection are the common methods used to obtain lymph node tissue samples [3]. FNB is minimally invasive; however, due to the small sample size obtained by this method, histopathological examination cannot be performed, which may lead to missed diagnoses. Lymph node dissection is often difficult for patients to accept due to its significant trauma, relatively complex procedure, and the need for post-operative hospitalization and observation, which can be costly. Nowadays, in clinical work, CNB examination has the highest utilization rate. This procedure not only ensures that the material is obtained in place but also decreases the risk of puncture, obtains sufficient samples to complete the clinical laboratory testing projects, and reduces the patient’s pain and economic burden.

Currently, the following tests are routinely used to diagnose LNTB: acid-fast bacilli (AFB) smear and MTB culture using puncture fluid samples, Xpert MTB/ RIF assay, targeted next-generation sequencing (tNGS), and routine pathologic test and special staining test using tissue samples. The AFB smear has a low positivity rate at approximately 15%, and MTB culture can take as short as 2 weeks. Hence, both tests are not suitable for early diagnosis [4]. To enhance sensitivity, Cepheid has successively developed the “Xpert MTB/RIF” and “Xpert MTB/RIF Ultra” detection systems. Xpert Ultra employs fully automated nested real-time Polymerase Chain Reaction (PCR) technology, compared to its predecessor, it features an improved PCR reaction system, expanded reaction chamber capacity, and integration of two distinct targets (IS6110 and IS1081). Therefore, Xpert Ultra demonstrates higher sensitivity than Xpert MTB/RIF in detecting low-load MTB loads. However, both detection methods show comparable performance in identifying rifampicin resistance [5, 6]. A pathologic diagnosis of LNTB is also extremely important, however, due to the sample size obtained via puncture is still insufficient, organizing caseous necrosis is difficult to observe, resulting in most conclusions remaining at the descriptive diagnostic level and failing to achieve the “gold standard”. Therefore, the current diagnosis should often be combined with a molecular diagnosis to further validate the etiologic basis.

The newly developed metagenomic next-generation sequencing (mNGS) technology enables precise sequencing of the entire DNA content within a sample. Theoretically, mNGS can simultaneously detect all pathogens present in clinical samples [7]. For low-yield samples, such as those from patients with suspected smear-negative PTB or extrapulmonary tuberculosis, tNGS detection technology combines target capture with next-generation sequencing to enrich nucleic acids within the sample before sequencing [8]. Compared with the conventional AFB smear for MTB, the tNGS assay is advantageous due to its high sensitivity and strong discriminatory ability. Further, it holds a significant advantage in terms of timeliness over liquid and solid culture methods [9]. Compared with metagenomic next-generation sequencing, the tNGS assay has a lower detection time, is more cost effective, and has a higher sensitivity and specificity [10].

This study retrospectively analyzed the diagnostic efficacy of various laboratory tests for LNTB and the use of the tNGS assay as an alternative routine test for LNTB diagnosis.

Materials and methods

Study participants and design

A retrospective case-control analysis was performed to assess patients who had swollen superficial lymph nodes and were hospitalized at the Tuberculosis Diagnosis and Treatment Center, Integrated Traditional Chinese and Western Medicine Hospital, Zhejiang Province, between December 2021 and June 2024. To obtain clinical specimens for the laboratory tests, all patients underwent ultrasound-guided lymph node puncture CNB operation.

The inclusion criteria were as follows: (1) patients aged ≥ 18 years, (2) those with enlarged superficial lymph nodes that were clinically suspected as LNTB, (3) those who could undergo ultrasound-guided lymph node CNB operation, (4) those not receiving antituberculosis treatment, and (5) the human immunodeficiency virus test were negative.

The exclusion criteria were as follows: patients who did not complete all laboratory tests or those without a definitive diagnosis. All patients or legal guardians signed a written informed consent form for lymph node CNB operation. The Ethics Committee of the Integrated Traditional Chinese and Western Medicine Hospital in Zhejiang Province approved this retrospective study (2025-YS-040-001).

Based on the People’s Republic of China’s standards for Tuberculosis Diagnosis (WS 288–2017) and Tuberculosis Classification (WS 196–2017), the composite reference standard (CRS) served as the ultimate diagnostic criterion. LNTB was confirmed based on the following findings: (1) symptoms and physical signs of LNTB; (2) lymph node aspiration specimen Xpert MTB assay or culture positivity, or pathological results indicative of granulomatous inflammation with coagulative necrosis [11]. The clinical diagnosis LNTB was based on the following: Patients with a history of PTB exposure or suspected PTB who test positive for tuberculosis immunological markers in blood (TSPOT, PPD, or tuberculosis antibodies); those presenting with lymphadenopathy or ultrasound findings suggestive of LNTB; and who respond effectively to diagnostic anti-tuberculosis therapy may be clinically diagnosed with LNTB [12]. Both of the abovementioned case types were categorized as LNTB and the rest of the cases as non-LNTB.

Instruments and procedure

Instruments

The instruments used were as follows: color Doppler ultrasound diagnostic instrument (Philips iU22) with an L9-3 wideband linear array probe, ultrasound contrast agent (i.e., SonoVue^® lyophilized powder, Bracco Diagnostics, Italy), 18G core biopsy needle (Bard, Covington, KY, the USA), 5-mL disposable syringe, 10-mL disposable syringe, 2% lidocaine hydrochloride injection, 0.9% sodium chloride injection, and sterile surgical dressing.

Procedure

Based on previous studies, the sensitivity of tNGS technology for diagnosing pulmonary tuberculosis is approximately 95%, with a specificity of 90%. The permissible error margin does not exceed ± 5%. At a test level of α = 0.05 and a test efficacy of 1-β = 0.95, the Pearson chi-square test indicates that 82 patients with lymphadenopathy are required for estimation.

The patient assumeed a comfortable position, and the skin over the area where the enlarged lymph nodes were located was fully exposed for ultrasound examination. First, the patient’s lymph nodes were scanned using the two-dimensional mode, and the size, morphology, boundaries, echogenicity, and blood flow of the lymph node lesions were recorded. The suspected lymph nodes were punctured. The Philips iU22 ultrasonic diagnostic instrument was used for the examination, and the probe frequency was set to 6–15 Hz. Then, the contrast agent (SonoVue^®, Bracco Diagnostics, Italy) was mixed and diluted with 5 mL of physiological saline, and 2.5 mL of the contrast agent was injected into the elbow vein after mixing. Simultaneously, the ultrasonic imaging mode was activated, and a volumetric high-frequency probe was used to perform three-dimensional color vascular energy imaging of the patient, with the pulse frequency set at 0.6 Hz, to continuously evaluate perfusion enhancement in the lymph nodes in real time. Then, the image was saved, and puncture biopsy was performed. Puncture method: After routine disinfection and toweling, 2% lidocaine was injected subcutaneously at the puncture point, and an 18G biopsy needle was used for the puncture (Bard, Covington, KY, the USA), with a sampling length set at 2.0 cm. Generally, 3–4 needles were required, with the number determined by the operator based on sampling effectiveness. Sufficient sample volume must be ensured to enable parallel submission for Xpert MTB/RIF assay, MTB culture, tNGS assay, and pathological examination. After the puncture was completed, all patients should be monitored closely for 30 min (Fig. 1).

Fig. 1.

Ultrasound-guided puncture core needle biopsy procedure. A: Ultersonography showed multiple enlarged lymph nodes, contrast-enhanced unlrasound showed uneven enhancement of lymph nodes. B: Selection of the largest lymph mode node for puncture. C; Ultrasound-guided lymph node aspirations (arrow shows puncture needle); D: Pulsed wave measured intra-lumph node arterial spectrum with resistamce index (RI) of 0.70; E: Specimens obtained by Ultersound-guided puncture core needle biopsy (CNB)

Sample collection and laboratory methods

Collect a puncture tissue with a total length exceeding 5 mm and place it in a sealed tube containing formalin for routine histopathological examination. The other three samples were packed into three sterile containers sent for the MTB culture, Xpert MTB/RIF assay, and tNGS assay.

MTB culture

The sample was homogenized with an equivalent volume of NALC-NaOH solution via a 15-min mechanical agitation. Subsequent reconstitution was performed using sterile phosphate-buffered saline (PBS, pH 7.4) until complete solubilization was achieved. Then, centrifugal separation was performed for 10 min. The pelleted cellular components were aseptically transferred into the MIGT 960 liquid culture medium.

Strictly adhere to the operational procedures specified by the BACTEC MGIT 960 Mycobacterium Detection System (BD Diagnostics, Sparks, MD, USA) for microbial culture and real-time fluorescence monitoring.

Xpert MTB/RIF

Add 2 mL of sample processing solution to the sterile tissue obtained via core needle biopsy, mixed well, left at room temperature for 15 min, and then vortexed for 8 min. The processed mixture was then placed into the Xpert MTB/RIF reaction cassette, which was then put on the machine module for testing. This device automatically performs PCR amplification and reports tuberculosis infection status and rifampicin resistance within two hours based on fluorescence signal intensity.

tNGS

The samples extracted using ultrasound-guided lymph node puncture were placed in sterile test tubes, preserved on dry ice, and immediately transported to the Adicon Medical Testing Center Hangzhou Branch.

Puncture sample pretreatment and nucleic acid extraction

Add an equal volume of NALC-NaOH solution to the puncture fluid sample and let stand for 15 min until completely liquefied. Centrifuge 2 mL of the sample solution. Add PBS solution to the pellet, mix thoroughly, and centrifuge again. Repeat the addition of PBS solution and centrifuge once more. Discard the supernatant, add lysozyme, and incubate in 37 °C warm water for 1 h. The pretreatment products were used to extract nucleic acid using the Mycobacterium extraction kit (Jieyi Biological Co., Ltd., lot no.: MD049T-P120240701).

Library construction

Using the Mycobacterium Tuberculosis Gene Detection Kit (Ivy Bio Ltd., lot no.: MD061T-P120240301), the DNA sequences of four MTB genes, (i.e., IS6110, rpoB, hsp65, and gyrB) were subjected to targeted amplification to detect MTB. The primers were IS6110-For: CGATTTTAAAGACCGCGTCG and IS6110-Re: TGATGTGCTCCTTGAGTTCG; rpoB-For: GGCCACCATCGAATATCTGG and rpoB-Re: GAAGAACTCCTTGATCGCGG; inhA-For: AAACGGATTCTGGTTAGCGG and inhA-Re: GCATGAACCCAATCGAATGC; and embB-For: GGTCACCTATGTGCTGATCG and embB-Re: GTAGTAACGCAGGTTCTCGG. The detection target for bacteria is the 16 S rRNA gene locus, which contains 9 conserved regions and 9 hypervariable regions. The primary target for fungal detection is the internal transcribed spacer (ITS) region located between the 18 S, 5.8 S, and 28 S rRNA genes. Viruses lack universal genes; therefore, specific electrochemiluminescent probes or primers are designed for different viral species. In total, 20 µl of nucleic acid was taken for amplification of the target region, and a DNA library for target sequencing was prepared. The cDNA was synthesized at the following conditions: 25 °C for 5 min, 37 °C for 45 min, and 85 °C for 5 s. Then, it was stored at 4 °C. The cDNA products were enriched for cDNA products specific to the region. The process of PCR cycling was as follows: The thermal cycling protocol comprised an initial denaturation at 95 °C (180 s), followed by 28 amplification cycles, each comprising three discrete phases: 30-s denaturation at 95 °C, 30-s primer annealing at 60 °C, and 30-s chain extension at 72 °C. A terminal elongation step at 72 °C (60 s) completed the amplification process, with postreaction stabilization maintained at 4 °C for cryopreservation. The PCR product was supplemented to 100 µl with ddH2O, and 80 µl of purified magnetic beads were added to purify the PCR product from the target region. In total, 10 µl of the PCR-purified product was taken for library amplification. Ion AmpliSeq^™ Kit for Chef DL8 was used for automatic library preparation protocol following the manufacturer’s protocol.

Sequencing and data analysis

The prepared library was diluted and denatured, and sequencing was performed on the KM MiniseqDx-CN platform using Illumina NextSeq^™ CN550 Kits (Illumina Co., lot no.: 11754131). Final reads were compared against pathogen databases for pathogen identification. If the number of sequences was >100 reads and was not a single target sequence, it was considered as positive, while < 10 reads was considered negative. If it was between 10 and 100, real-time fluorescence quantitative PCR was performed for confirmation [13].

Pathological examination

A 10% formalin solution was used to completely soak the tissue specimens. Then, the sampled tissues were subjected to a series of treatments including dehydration, embedding, sectioning, staining, and sealing. Two pathologists analyzed the results of the pathological sections using the medical microscope, and the presence of caseous necrosis in the lesion was identified as LNTB.

Statistical analysis

In this study, SPSS 24.0 (IBM Corp., Armonk, NY) was used to calculate the mean, standard deviation, and true positive, false positive, false negative, and true negative values in a cross-tabulation. CRS was selected as the final diagnostic standard to assess the diagnostic accuracy of the tests. Comprehensive statistical analyses were performed using MedCalc Statistical Software version 15.2.2 (MedCalc Software Ltd, Ostend, Belgium; https://www.medcalc.org) to compute diagnostic performance metrics including sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and receiver operating characteristic (ROC) curve analysis with 95% confidence intervals (CI). Sensitivity: The percentage of patients CRS diagnosed with LNTB who test positive. Specificity: The percentage of individuals CRS diagnosed without LNTB who test negative. PPV: The proportion of subjects with a positive test result who actually have LNTB. NPV: The proportion of subjects with a negative test result who do not have LNTB. Paired data were compared using McNemar test. Comparison of proportions for different specimen types using the Chi square test or Fisher exact test. Z test was used for comparison between different area under the curve (AUC) values. P values < 0.05 were considered statistically significant for all the analyses.

Results

Clinical characteristics of the participants

In total, the clinical information of 81 patients was screened, six patients who did not complete all the laboratory tests and one who was lost to follow-up were excluded. Thus, 74 patients were finally included in this study. The average age of patients was 51 ± 26.87 years. Among them, 22 (29.73%) patients were male and 68 (91.89%) patients tested positive for T.SPOT TB assay. Based on the CRS, 65 (87.84%) patients were diagnosed with LNTB while 9 patients (12.16%) were excluded from this diagnosis. Among these 9 patients, 7 had lymphadenitis, 1 had non-tuberculous mycobacterial lymph node infection, and 1 had lymphoma. The study population and diagnostic classification were presented in Fig. 2.

Fig. 2.

Enrollment and diagnostic classification of patients included in the study

Diagnostic accuracy of MTB culture, Xpert, tNGS and pathology

The overall sensitivity, specificity, PPV, NPV, and AUC of MTB culture in diagnosing LNTB were 26.2% (95% CI: 15.5%–36.8%), 100.0% (95% CI: 100.0%–100.0%), 100.0% (95% CI: 100.0%–100.0%), 15.8% (95% CI: 6.3%–25.3%), and 0.631 (95% CI: 0.577–0.658), respectively.

The overall sensitivity, specificity, PPV, NPV, and AUC of Xpert MTB/RIF were 72.3% (95% CI: 61.4%–83.2%), 100.0% (95% CI: 100.0%–100.0%), 100.0% (95% CI: 100.0%–100.0%), 33.3% (95% CI: 15.6%–51.1%), and 0.862 (95% CI: 0.807–0.916), respectively.

Those same values of tNGS for detecing LNTB were 95.4% (95% CI: 90.3%–100.0%), 88.9% (95% CI: 68.4%–100.0%), 98.4% (95% CI: 95.3%–101.5%), 72.7% (95% CI: 46.4%–99.0%), and 0.921 (95% CI: 0.809–1.000), respectively.

And those same values of pathology were 80.0% (95% CI: 70.3%–89.7%), 88.9% (95% CI: 68.4%–100.0%), 98.1% (95% CI: 94.5%–101.8%), 38.1% (95% CI: 17.3%–58.9%), and 0.844 (95% CI: 0.725–0.964), respectively.

A summarized presentation of these results is presented in Table 1.The ROC curves for the four tests is showed in Fig. 3.

Table 1.

The sensitivity, specificity, PPV, NPV and AUC values of MTB Culture, Xpert MTB/RIF, tNGS and pathology for LNTB using CNB specimens

Test	Sensitivity (95%CI)	Specificity (95%CI)	PPV (95%CI)	NPV (95%CI)	AUC (95%CI)
MTB Culture	0.262 (0.155–0.368)	1.000 (1.000–1.000)	1.000 (1.000–1.000)	0.158 (0.063–0.253)	0.631 (0.577–0.685)
Xpert MTB/RIF	0.723 (0.614–0.832)	1.000 (1.000–1.000)	1.000 (1.000–1.000)	0.333 (0.156–0.511)	0.862 (0.807–0.916)
tNGS	0.954 (0.903-1.000)	0.889 (0.684-1.000)	0.984 (0.953-1.000)	0.727 (0.464–0.990)	0.921 (0.809-1.000)
Pathology	0.800 (0.703–0.897)	0.889 (0.684-1.000)	0.981 (0.945-1.000)	0.381 (0.173–0.589)	0.844 (0.725–0.964)

Fig. 3.

ROC curves for MTB culture, Xpert MTB/RIF, tNGS and pathology tests

Comparison of the diagnostic accuracies of the four tests

The tNGS assay had superior diagnostic sensitivity to the conventional diagnostic modalities, with statistically significant intermethod differences (P < 0.05; refer to Table 2 for comparative metrics). The specificity of the tNGS assay and histopathological examination was 88.9%, inferior to the MTB culture and Xpert MTB/RIF assay, however, there were no significant differences among them. The tNGS assay had the highest diagnostic accuracy and was significantly better than the culture assay (P < 0.05). Nevertheless, when compared to the Xpert MTB/RIF assay and pathological examination, it did not reach statistically significant difference (P > 0.05).

Table 2.

Comparison of the diagnostic accuracy of MTB culture, Xpert MTB/RIF, tNGS and pathology for LNTB

Test	Sensitivity (P-value)	Specificity (P-value)	PPV (P-value)	NPV (P-value)	AUC (P-value)
Pathology vs. tNGS	0.008	1.000	0.989	0.207	0.381
Pathology vs. Culture	< 0.001	0.317	0.928	0.080	0.002
Pathology vs. Xpert	0.225	0.317	0.923	0.783	0.789
tNGS vs. Culture	< 0.001	0.317	0.933	0.003	< 0.001
tNGS vs. Xpert	0.001	0.317	0.931	0.120	0.345
Culture vs. Xpert	< 0.001	1.000	0.983	0.122	< 0.001

Discussion

LNTB is the most common type of EPTB. Due to its traumatic and complicated process, surgical excision biopsy cannot be easily accepted by the general public [14]. In contrast, ultrasound-guided aspiration biopsy is widely recognized because it is safe and convenient and it causes minimal trauma. Ultrasound imaging can clearly visualize the microstructure inside the lymph nodes and identify areas of low-velocity blood perfusion, which can help obtain more valuable puncture samples. Different samples with varying ultrasound characteristics can be selected for various detection methods. The samples obtained from areas not enhanced by the contrast agent are not suitable for pathologic examination. However, the positive rate of the sample sent for the Xpert MTB/RIF assay is higher [15], which is in accordance with our findings. Only 26.2% of patients who underwent the MTB culture, which is the traditional method used for tuberculosis testing, yielded positive results. This result is in accordance with the findings of other LNTB studies [16], which is lower when this test applied in PTB diseases [17]. This may be attributed to the limited sample size obtained from the lymph node puncture tissue and the fact that some bacteria are dormant and have a low metabolic activity and the high concentration of inflammatory factors in the lymph node tissue inhibits bacterial proliferation. Meanwhile, PTB is an open tuberculosis with a large number of free bacteria in the bronchial lavage fluid specimen, which makes it easier to be detected.

In addition, the Xpert MTB/RIF assay had a sensitivity of 72.3% (61.4%–83.2%) and a specificity of 100.00% (100.00%–100.00%). The specificity of the Xpert MTB/RIF assay for diagnosing EPTB is 98%–99.8%. However, its sensitivity (72.3–100%) varies significantly based on the source of the sample and the quality of the lymph node puncture sample [18], depends on the quality of the lymph node puncture sample. As to how to improve the positive rate, scholars found that the short-axis diameter of the lymph nodes is an independent risk factor [19]. If the short-axis diameter of the lymph nodes is larger, the volume and bacterial load are greater. On the other hand, early foreign studies have revealed that granuloma formation was the most typical histopathologic feature of LNTB [20]. However, the MTB content in this area was low. If the disease continues to progress with the appearance of caseous necrotic areas, the lymph nodes become the “hardest-hit area” for bacterial growth [21].

For LNTB with small samples, the combined application of the Xpert MTB/RIF assay, MTB culture, and pathological testing does not significantly increase the diagnostic positivity rate. Therefore, the Xpert MTB/RIF assay is primarily recommended for this group of patients. For LNTB with larger lesions, more puncture samples can be obtained using the currently available techniques, and samples should be sent for combined testing, which has a superior diagnostic efficacy to single testing [22]. In addition, in this study, three rifampicin-resistant patients were also identified by applying the Xpert MTB/RIF assay, and the results of drug sensitization after 3 weeks were consistent with the phenotypic drug sensitization results of the patients.

As for the diagnostic value of the lymph node pathology, if the puncture biopsy samples are small and the central necrosis is not evident, the characteristic changes of the nodules are often not clearly recognized. Thus, the pathologist provides a more descriptive diagnosis that cannot directly confirm the disease. The current study found that the AUC value of the pathology was slightly lower than that of the Xpert MTB/RIF assay, which is consistent with the results of the Yang’s study [23].

Further, this study initially explored the clinical application of the tNGS assay in the diagnosis of LNTB. The sensitivity of tNGS assay using CNB sample significantly exceeded that of MTB culture, Xpert MTB/RIF, and pathological examination, with statistically significant differences observed in pairwise comparisons (P < 0.001). For patients suspected of having LNTB, submitting aspirate specimens for tNGS testing is recommended to enhance the positive detection rate of LNTB, thereby facilitating early identification of tuberculosis patients. However, based on the AUC values in this study, although the tNGS assay achieved the highest AUC, but it showed no significant statistical difference compared to the traditional Xpert MTB/RIF and pathological examination. Previous literature reports concluded that tNGS assay exhibits the most ideal diagnostic performance in PTB diagnosis, outperforming traditional detection methods [24]. Nevertheless, this study suggests that the diagnostic performance of tNGS technology in detecting LNTB is comparable to that of the Xpert MTB/RIF method.

The tNGS assay has the highest sensitivity, which is attributed to the specific localization of different regions and MTB loci using this technique. This assay can also detect mixed infections caused by bacteria, viruses, and fungi other than MTB, which is significantly advantageous for clinical diagnosis [25]. During the study, we immediately diagnosed a patient with disseminated nontuberculous mycobacteriosis caused by intracellular mycobacterial infection. In this case, the patient’s lymph nodes rapidly decreased with early and effective drug therapy. In addition, four cases of isoniazid-resistant LNTB were identified, which provides an important reference value for the early provision of an antituberculosis treatment regimen. However, tNGS detects nucleic acid fragments and therefore cannot distinguish between live and dead MTB. When interpreting reports, it is essential to first conduct a detailed medical history inquiry, including past tuberculosis history and whether the patient completed a full course of standard anti-tuberculosis treatment. Simultaneously, a comprehensive assessment should integrate the number of sequences reported, changes in the patient’s clinical symptoms, ultrasound imaging findings, and other laboratory results—particularly the outcome of MTB culture—to achieve a more precise overall diagnosis and guide rational treatment [26]. If clinicians opt to use tNGS for comprehensive pathogen detection, patients face significant out-of-pocket costs—approximately 1,000 RMB, and the test is currently excluded from medical insurance coverage. This makes implementation impractical in resource-constrained settings.

The current study had several limitations. First, our institution belongs to the designated hospital for tuberculosis in Zhejiang Province, and some patients were suspected of LNTB at the time of consultation. Thus, selection bias in the screening of the enrolled population might have existed. Second, ultrasound-guided needle biopsy is significantly based on the operator’s accumulated experience and technical level, which has a certain impact on the final results. Third, this study included a limited number of cases and excluded HIV-positive patients, making it susceptible to sampling error. Consequently, its conclusions cannot be generalized to the entire population.

Conclusion

In tuberculosis-endemic regions, for patients with unexplained superficial lymphadenopathy, ultrasound-guided CNB of lymph nodes combined with tNGS testing is recommended to enhance the positive rate of early diagnosis for LNTB.

Abbreviations

AFB

Acid-fast bacilli

mNGS

Metagenomic next-generation sequencing

tNGS

Targeted next-generation sequencing

MTB

Mycobacterial tuberculosis

PTB

Pulmonary tuberculosis

EPTB

Extrapulmonary tuberculosis

LNTB

Lymph node tuberculosis

NPV

Negative predictive value

PPV

Positive predictive value

ROC

Receiver operating characteristic

CI

Confidence intervals

AUC

Area under the curve

CRS

Composite reference standard

FNB

Fine-needle biopsy

CNB

Core needle biopsy

PBS

Phosphate-buffered saline

PCR

Polymerase chain reaction

Author contributions

LHZ: Research design, writing of the original manuscript, financial support; HHZ: Research design, writing of the first draft; XWZ: Data collection, software analysis, financial support; CX: Experimental manipulation, experimental data analysis; BPW: Data collection, image organization, manuscript review. QH: Research design, software, study design and article review.

Funding

This study was supported by the Hangzhou Municipal Health Committee grant [LiHong Zhou, 2022WJC200]. The fund support was used for the tNGS specimen delivery process and the sending and receiving of reports.

Data availability

All datasets used and analyzed in this study are available from the corresponding author upon reasonable request.

Declarations

Ethics approval and consent to participate

All patients who participated in the study or their legal representatives signed a written informed consent. The study was reviewed and approved by the Ethics Committee of Zhejiang Provincial Hospital of Integrative Medicine (2025-YS-040-001) and was performed in accordance with the ethical principles of the Declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.