Transcription factor EGR1 orchestrates ferroptosis to mitigate sepsis-induced myocardial injury by enhancing ferroportin expression

Abstract

Objective:

Myocardial injury is a devastating complication of sepsis and a leading cause of mortality in critically ill patients. This study aimed to investigate the role and underlying mechanisms of early growth response factor 1 (EGR1) in sepsis-induced myocardial injury (SIMI).

Material and Methods:

A rat model of SIMI was established using cecal ligation and puncture, and in vivo and in vitro experiments were conducted. In vivo, the myocardial tissue levels of cytokines, myocardial injury markers, apoptosis, and reactive oxygen species (ROS) were measured, along with the expression levels of EGR1, ferroportin (FPN), cystine/glutamate transporter ( xCT), and glutathione peroxidase 4 (GPX4). In vitro, H9c2 cardiomyoblast cell line ( H9c2) cardiomyocytes were transfected to overexpress or silence EGR1, and cell viability, oxidative stress, ferroptosis-related indicators, and mitochondrial membrane potential (ΔYm) were assessed. Transcriptome sequencing and dual-luciferase reporter gene assays were performed to analyze the mechanism of EGR1-mediated transcriptional regulation of FPN.

Results:

Septic rats exhibited significant inflammation, myocardial injury, apoptosis, and oxidative stress. Transcriptome sequencing revealed that EGR1 expression was downregulated in the myocardium of septic rats and associated with the ferroptosis pathway. Dual-luciferase reporter gene assays confirmed that EGR1 is directly bound to and activates the FPN promoter. In vitro, EGR1 overexpression significantly promoted H9c2 cardiomyocyte viability, reduced malondialdehyde (MDA) and iron (II) ion (Fe²⁺) levels, increased glutathione (GSH) levels, upregulated the FPN/xCT/GPX4 axis, maintained ΔYm, and inhibited ROS production. Conversely, EGR1 knockdown exhibited opposite effects. In vivo, EGR1 overexpression effectively attenuated myocardial injury; improved myocardial histopathology; significantly increased EGR1, FPN, xCT, and GPX4 expression levels; significantly reduced serum Fe²⁺ and MDA levels; increased GSH levels; and improved the survival rate of septic rats.

Conclusion:

This study provides a novel finding that EGR1 plays a pivotal protective role in myocardial injury through the direct transcriptional activation of FPN. Mechanistically, EGR1 alleviates SIMI by transcriptionally activating the FPN/xCT/GPX4 axis, which leads to the suppression of ferroptosis and oxidative stress and the preservation of mitochondrial function.

INTRODUCTION

Sepsis, characterized by a dysregulated response to infection leading to a complex of organ dysfunction, is one of the leading diseases that gravely jeopardizes human health on a global scale.^[1] The heart is a particularly vulnerable target organ in sepsis. Clinical studies demonstrated an approximately 80% increase in mortality associated with sepsis-induced cardiac injury.^[2] Sepsis-induced myocardial dysfunction (SIMD) is recognized as a contributing factor to hospital-acquired mortality.^[3] Therefore, elucidating the pathophysiology of sepsis-induced myocardial injury (SIMI) and identifying effective therapeutic targets are of paramount importance.

Myocardial injury in sepsis has been reported to be closely associated with overproduction of reactive oxygen species (ROS), which are responsible for cardiac dysfunction in septic shock.^[4] Although antioxidants have been widely investigated for their potential to protect the myocardium from sepsis, their efficacy has been rather limited. This limitation is largely due to rapid ROS accumulation, which triggers programmed cell death. Ferroptosis is mainly characterized by increased levels of lipid ROS resulting in lipoperoxidation and cellular membrane damage.^[5] Under normal physiological conditions, cellular iron homeostasis is maintained by a dynamic equilibrium between the oxidative system, which includes Fe³⁺, the Fenton reaction, and ROS, and the antioxidant system, which comprises glutathione peroxidase 4 (GPX4), glutathione (GSH), and the cystineglutamate antiporter ( Xc) system.^[6] A decrease in the activity of GPX4 or GSH resulted in the accumulation of Fe²⁺, which intensified mitochondrial ROS production, leading to mitochondrial dysfunction and ultimately causing cellular ferroptosis.^[7-9] Research has shown that ferroptosis is closely linked to sepsis, and its inhibition can improve SIMI and increase survival rates.^[10] For example, the use of ferroptosis inhibitors has been shown to potentially improve SIMD and reduce the incidence of myocardial cell death.^[4,11] Ferroportin (FPN, SLC40A1) is the sole characterized mammalian non-haem iron exporter, transporting iron from iron storage cells into the bloodstream to maintain cellular iron homeostasis.^[12] The inhibition of FPN-mediated iron export has been shown to augment intracellular iron accumulation and sensitize cells to ferroptosis.^[13] A thorough elucidation of the mechanisms underlying ferroptosis in the context of sepsis-induced myocardial damage could potentially uncover critical clues for the formulation of innovative therapeutic interventions.

Early growth response factor 1 (EGR1), serving as a transcription factor, has been implicated in regulating cell growth, proliferation, differentiation, and apoptosis.^[14] For example, in the neonatal heart, EGR1 aids in the promotion of angiogenesis and the proliferation of cardiomyocytes.^[15] In keloids, EGR1 modulates ROS levels by targeting nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4).^[16] These findings imply a potential role for EGR1 in myocardial protection or stress responses. However, the specific role of EGR1 in SIMI warrants further exploration. The present study aimed to investigate whether EGR1 influences ferroptosis and, consequently, SIMI by regulating the expression of FPN. EGR1 may interact with the promoter region of FPN, thereby modulating its transcriptional activity, which could lead to the regulation of intracellular iron homeostasis and signaling pathways associated with ferroptosis.

MATERIAL AND METHODS

Animals and grouping

This animal study was reviewed and approved by the Animal Experimental Ethical Inspection Form of Guizhou University of Traditional Chinese Medicine [Experimental Animal Use License No.: SYXK(Xiang)2024-0019; Experimental Animal Production License No.: SYXK(Xiang)2021-0002; Approval Date: July 2, 2024]. Thirty-six 12-month-old male Sprague-Dawley rats weighing 200–250 g were purchased from Hunan Slake Jingda Laboratory Animal Co., Ltd. The rats were stratified into a sham-surgery group and an experimental model group, with a subset of three animals from each group designated for the validation of the model. The animals were uniformly maintained at a temperature of 23°C ± 2°C, relative humidity between 35% and 60%, and 12 h of alternating light-dark cycle.

Establishment of sepsis rat model

Cecal ligation and puncture (CLP) was employed to establish a sepsis rat model. Before the experiment, the rats were deprived of food for 12 h, although they were allowed unrestricted access to water. Anesthesia was induced by administering an intraperitoneal injection of pentobarbital sodium at a concentration of 3% (dose of 30 mg/kg), sourced from BSZH (P3761, Beijing, China). After anesthesia was effectively administered, a median laparotomy was performed. The cecum was carefully ligated at its blind end with a No. 4 suture to prevent injury to the mesenteric vessels. Subsequently, the cecum was punctured on two occasions with an 18G needle, facilitating gentle extrusion of a minimal amount of fecal matter. The cecum was then repositioned into the abdominal cavity, and the abdominal incision was carefully sutured in layers. In the sham group, the rats underwent laparotomy with isolation of the cecum, but without ligation or puncture.

Single-cell RNA sequencing

Transcriptome sequencing analysis was performed on the myocardial tissues of the septic model and sham groups. In each group (n = 3), 1 × 10⁷ cardiac myocytes were isolated, and total RNA was extracted using TRIzol reagent (15596026, Thermo Fisher Scientific, Waltham, Massachusetts, America). The concentration and purity of RNA were detected by a NanoDrop ND-1000 spectrophotometer (A260/A280 ≥ 1.8, A260/A230 ≥ 2.0), and the integrity of RNA was evaluated by an Agilent 2100 bioanalyzer (RIN value ≥ 7.0). For 1 μg of total RNA, the NEBNext Ultra RNA Library Prep Kit (E7530L, NEB, Ipswich, MA, USA) was used to construct the sequencing library. The library was sequenced on an Illumina NovaSeq 6000 platform (website: https://www.illumina.com/systems/sequencing-platforms/novaseq.html) with paired-end 150 bp sequencing (PE150). Each sample had a sequencing depth of 60–80 million reads, and the gene coverage was ≥95%. The raw data were subjected to quality control using fastp (version 0.20.0, download link: https://github.com/OpenGene/fastp). The quality control criteria were as follows: Q30 ≥ 90%, GC content of approximately 42%, and sequencing error rate ≤ 0.1%. High-quality reads were aligned to the Rattus norvegicus reference genome (Rnor_6.0) using HISAT2 (version 2.2.1, download link: https://ccb.jhu.edu/software/hisat2/index.shtml). The bam files were sorted and deduplicated using samtools (version 1.15.1, download link: https://github.com/samtools/samtools). FeatureCounts (version 2.0.1, download link: Subread download|SourceForge.net) was used to count the read counts of genes on the basis of Ensembl Rnor_6.0 annotation. Finally, differential expression analysis was performed using DESeq2 (version 1.32.0, R Project official website: https://www.r-project.org/). The differentially expressed genes (DEGs) were screened with a threshold of |log2foldchange| >1 and P < 0.05.

Analysis of functional enrichment

Gene ontology (GO) enrichment analysis was conducted using the clusterProfiler package (version 4.0.0) in R language (version 4.0.1, R Core Team, official website: www.r-project.org), with p_adj value < 0.05 set as the criterion for significant enrichment. ClusterProfiler was employed to examine the differential gene expression for enrichment in kyoto encyclopedia of genes and genomes (KEGG) pathways, applying the same significance threshold of p_adj value < 0.05 to ascertain enriched pathways.

Analysis of transcriptional regulatory Mechanisms of FPN/SLC40A1 gene

The promoter sequence spanning 2000 bp upstream of the transcription start site was retrieved from the Ensembl database using the biomaRt package to investigate the transcriptional regulation of Slc40a1. Potential transcription factor binding sites, with a focus on EGR1, were then analyzed using the human transcription factor binding site database within the MotifDb package. An 85^th percentile threshold was applied for predicting EGR1 binding sites, and the upstream and downstream flanking sequences of each predicted binding site were extracted for further analysis.

Enzyme-linked immunosorbent assay (ELISA) analysis

Twenty-four hours after CLP, blood was collected from the rats through the abdominal aorta and stored at −20°C. The expression levels of myocardial injury markers interleukin (IL)-6 (CB10218-Ra, COIBO BIO, Shanghai, China), IL-10 (CB10194-Ra, COIBO BIO, Shanghai, China), IL-1b (CB10205-Ra, COIBO BIO, Shanghai, China), tumor necrosis factor-a (TNF-a, CB11057-Ra, COIBO BIO, Shanghai, China), cardiac troponin T (cTnT) (JL27509-48T, JONLNBIO, Shanghai, China), and N-terminal pro-brain natriuretic peptide (NT-proBNP, ER0309, Fine Biotech, Wuhan, China) in the blood of rats were detected using corresponding kits. Specific experimental procedures were carried out in accordance with the instructions of the kits.

Terminal-deoxynucleotidyl transferase mediated nick end labeling (TUNEL) staining

Rats were anesthetized and sacrificed by intraperitoneal injection of an excessive amount of 3% sodium pentobarbital. After confirming that the rats had stopped breathing, had no heartbeat, and had completely lost the corneal reflex, they were fixed supine on the dissecting table, and the chest skin was disinfected with 75% ethanol. The chest cavity was opened by cutting upward from the xiphoid process along the midline of the sternum to expose the heart. The proximal end of the aorta was clamped with hemostatic forceps to reduce blood residue, and the heart was quickly and completely separated and removed. It was immediately placed in pre-cooled 4°C physiological saline and gently rinsed 3 times to remove surface blood, then transferred to 4% paraformaldehyde fixative (volume ratio of tissue to fixative 1:10) and fixed at 4°C for 24 h. The above-mentioned rat heart tissues were used for paraffin section preparation, including tissue fixation, dehydration, clearing, wax immersion, embedding, sectioning, and baking. After the sections were dewaxed and rehydrated, apoptotic cells were detected using a TUNEL detection kit (KGA700, KeyGEN, Jiangsu, China). The sections were incubated with proteinase K working solution at a concentration of 20 μg/mL for 20 min at 37°C. Subsequently, they were incubated with 3% H₂O₂ solution at room temperature for 15 min. Next, the sections were placed in equilibration buffer and equilibrated at room temperature for 10 min. Then, a reaction system was prepared by mixing recombinant TdT enzyme, biotin-dUTP labeling mix, and equilibration buffer at a ratio of 1 μL:5 μL:50 μL, and the sections were incubated in this system at 37°C for 1 h. Afterward, streptavidin-HRP was diluted 1:500 in TBST buffer, and the sections were incubated with this diluted solution at 37°C for 30 min. Finally, the sections were stained with DAB chromogenic working solution (G1507, Servicebio, Wuhan, China), followed by counterstaining of the cell nuclei with hematoxylin (G1004, Servicebio, Wuhan, China). The sections were then dehydrated with gradient ethanol, cleared with xylene, and mounted. Images were captured using an Mshot MF53 inverted microscope (Guangzhou Mshot Optoelectronic Technology Co., Ltd).

Preparation of rat cardiomyocyte suspension

Place a sterile Petri dish on ice, pour 5 mL of pre-chilled Dulbecco’s phosphate-buffered saline (DPBS) (D8537, Sigma-Aldrich, St. Louis, Missouri, USA) into it, and place the ventricular myocardial tissue in it. Use ophthalmic scissors to repeatedly mince the tissue into small pieces of approximately 1 mm³. Using a pipette, transfer the tissue fragments to a new Petri dish containing 5 mL of pre-chilled DPBS. Allow to stand for 1 min; once the tissue pieces have settled, discard the supernatant. Repeat this washing process 3 times. Transfer the washed tissue fragments to a 15 mL centrifuge tube, centrifuge at 1000×g for 5 min at 4°C, discard the supernatant, and retain the tissue pellet. Add 3 mL of pre-warmed 2 mg/mL collagenase (C0130, Sigma-Aldrich, St. Louis, Missouri, USA) to the tissue pellet, mix by inverting the tube up and down, and place it in a 37°C water bath. Every 5 min, remove the centrifuge tube, gently pipette the tissue pieces with a pipette, and observe if they have loosened. When 60–70% of the tissue pieces have dispersed into a flocculent state, filter the supernatant through a 200-mesh cell sieve into another sterile 15 mL centrifuge tube. Add 2 mL of collagenase type I to the remaining tissue pieces and repeat the above digestion step 1–2 times until the tissue pieces are almost completely digested. Combine all filtered cell suspensions, centrifuge at 1000×g for 5 min at 4°C, and discard the supernatant. Add 5 mL of Dulbecco’s modified eagle medium (DMEM) medium containing 10% FBS (D6429, Sigma-Aldrich, St. Louis, Missouri, USA), gently pipette the cell pellet to prepare a cell suspension, then centrifuge at 800×g for 5 min at 4°C and discard the supernatant. Repeat this washing step once to finally obtain the cell pellet.

Transfection of H9c2 cells with overexpression (o e)-EGR1 and small hairpin (s h)-EGR1 plasmids

Oe-EGR1, sh-EGR1, oe-negative control ( NC), and shNC plasmids were constructed. The target site sequence of EGR1 gene RNAi interference (EGR1-oligo1) is TCGAATCTGCATGCGTAATTT. Its top strand is GATCCgTCGAATCTGCATGCGTAATTTCTCGAG AAATTACGCATGCAGATTCGATTTTTTG, and the bottom strand is AATTCAAAAAATCGAAT CTGCATGCGTAATTT CTCGAGAAATTACGCATGCAG

ATTCGAcG. The experiment was completed by General Bio. H9c2 cells (BNCC337726, BNCC, Beijing, China) were procured from a certified cell bank that has completed short tandem repeat genotyping and mycoplasma contamination testing for all cell lines. These quality control measures confirmed that the cell line maintains its biological characteristics and is free of microbial contamination, meeting the requirements for scientific research experiments. The cells were cultured in DMEM (11965092, Thermo Fisher Scientific, Waltham, Massachusetts, USA) supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin at 37°C in a humidified atmosphere containing 5% CO₂. The cells were passaged using 0.25% trypsin-EDTA (25200056, Thermo Fisher Scientific, Waltham, Massachusetts, USA) when reaching 80–90% confluence and used at passages 3–8 for all experiments. Subsequently, the H9c2 cells stored in liquid nitrogen were quickly revived and passaged. Once the cell confluence reached an appropriate level, the cells were seeded onto culture plates 1 day before transfection. In accordance with the protocol of the transfection reagent (16447100, Thermo Fisher Scientific, Waltham, Massachusetts, USA), the constructed and control plasmids (oe-NC and sh-NC) were diluted and prepared into transfection complexes, which were then added dropwise to the wells of the culture plate. The experiment was divided into oe-NC, EGR1 overexpression (oe-EGR1), sh-NC, and sh-EGR1 groups.

Cell counting kit-8 (CCK-8) assay

Post-transfection, H9c2 cells were plated into a 96-well plate, and 10 μL of CCK-8 reagent (C0038, Beyotime, Shanghai, China) was aliquoted into each well. Control wells, containing an equivalent volume of cell culture medium and CCK-8 solution but devoid of cells, were designated for baseline adjustment. After the cells were incubated for 1 h in a cell culture incubator, the absorbance at 450 nm was quantified using a microplate reader (CMax Plus, Molecular Devices, Sunnyvale, Silicon Valley Center, America).

Fe²⁺ detection

Cells were collected and processed in accordance with the protocol of the Cell Ferrous Iron Colorimetric Assay Kit (E-BC-K881-M, Elabscience, Wuhan, China). The optical density (OD) for each well was measured at a wavelength of 593 nm using a microplate reader.

GSH detection

The collected cells were homogenized in physiological saline (0.9% NaCl). The experiment was conducted following the instructions of the GSH Colorimetric Assay Kit (E-BCK030-M, Elabscience, Wuhan, China).

Malondialdehyde (MDA) detection

At least 3 × 10⁶ cells were gathered and then pipetted into a plastic centrifuge tube. The MDA Colorimetric Assay Kit (Cell Samples, E-BC-K028-M, Elabscience, Wuhan, China) was followed for the specific detection procedure. The OD values of the processed samples were measured at 532 nm using a microplate reader.

ROS detection assay

After separately adjusting the cell concentration of the isolated rat cardiomyocytes and H9c2 cells, the cells were incubated with 10–20 μM 2’,7’-dichlorofluorescein diacetate (DCFH-DA) probe (Cat. No. D6883, Sigma-Aldrich, St. Louis, Missouri, USA) at 37°C in the dark for 20–30 min. The cells underwent low-speed centrifugation and washing, and then, they were resuspended and analyzed using the CytoFLEX flow cytometer (Beckman Coulter, Brea, California, USA). The FL1 channel was used to detect fluorescence intensity upon excitation with a 488 nm laser, and the mean fluorescence intensity was recorded.

Transmission electron microscopy for mitochondrial structure analysis

The myocardial cell pellets obtained after digestion and centrifugation were collected and fixed with 3% glutaraldehyde (G849973, Macklin, Shanghai, China), followed by 1% osmium tetroxide (GP18456, Leica, Wetzlar, Germany). Samples were then dehydrated through a graded series of acetone (30–100%); infiltrated using acetone/epoxy resin (GP18010, Zhongjingkeyi, Beijing, China) mixtures at ratios of 3:1, 1:1, and 1:3; embedded; and polymerized. Ultrathin sections (50 nm) were prepared and stained with uranyl acetate (10–15 min, GS02624, Zhongjingkeyi, Beijing, China) and lead citrate (1 or 2 min, GZ02616, Zhongjingkeyi, Beijing, China). Finally, the mitochondrial structure was visualized and analyzed using a transmission electron microscope (JEM-1400PLUS, JEOL, Akishima, Japan).

Mitochondrial membrane potential detection

A sample of 100,000 cells was selected and subjected to the procedures outlined in the Mitochondrial Membrane Potential Detection Kit (JC-1, 70-MJ101, MULTISCIENCES, Hangzhou, China). The prepared samples were then analyzed using a flow cytometer (CytoFLEX, Beckman Coulter, Brea, California, USA).

Western blotting

A small amount of sample tissue was added to radioimmunoprecipitation assay (RIPA) lysis buffer (P0013C, Beyotime, Shanghai, China) containing phenylmethylsulfonyl fluoride (PMSF) (ST507, Beyotime, Shanghai, China) and protease inhibitors (P1045, Beyotime, Shanghai, China) and homogenized using a tissue grinder. From each sample’s total protein, 500 μg was mixed with 5 × sodium dodecyl sulfate (SDS) loading buffer (8015011, DAKEWE, Shenzhen, China) in a 4:1 ratio and heated at 100°C in a metal bath (TU-100, Yiheng, Shanghai, China) for 6 min. Following cooling to room temperature, the sample solution containing 60 μg of protein was loaded. Electrophoresis was performed at 80 V through a stacking gel, and then, the voltage was switched to 120 V. After electrophoresis, the protein bands were transferred to a membrane. The membrane was blocked with 5% skimmed milk (P0216, Beyotime, Shanghai, China) and then incubated sequentially with the primary antibody at 4°C overnight and the secondary antibody for 1 h. Finally, an ECL exposure solution (1:1, 34580, Thermo, Waltham, Massachusetts, USA) was applied to the membrane, reacted for 1 min, and then exposed in a nucleic acid protein gel imager (Universal Hood II, Bio-Rad, California, Hercules, USA). The obtained protein band image was visualized with ImageJ software (version 1.8.0, download link: https://soft.3dmgame.com/down/158301.html). The details of the antibodies are as follows: FPN (26601-1-AP, Proteintech, Wuhan, China; 1:2000), EGR1 (A23424, ABclonal, Wuhan, China; 1:6000), xCT (A13685, ABclonal, Wuhan, China; 1:5000), GPX4 (A11243, ABclonal, Wuhan, China; 1:6000), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (A19056, ABclonal, Wuhan, China; 1:10000), and secondary antibody (AS014, ABclonal, Wuhan, China; 1:100).

Real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA extraction was performed on all samples by utilizing the TRIzol reagent. Subsequently, an aliquot of 1 μL from each RNA extract was introduced into a nanospectrophotometer to assess RNA quality. The reverse transcription of RNA to cDNA was facilitated by the Goldenstar RT6 cDNA Synthesis Kit (version 2, Tsingke, TSK302M, Beijing, China), and qPCR was completed using the 2 × T5 Fast qPCR Mix Kit (Tsingke, TSE002, Beijing, China). GAPDH was employed as the endogenous control gene, and the 2^−ΔΔCt method was used to obtain data. The detailed information of gene primer sequences is displayed in Table 1.

Table 1:

Primer sequences used in real-time quantitative polymerase chain reaction.

Primer name	Sequence
FPN-F	ACTTGGCTACGTCGAAAAT
FPN-R	CTGCCTCCTCATGTATAAAC
EGR1-F	GCCAGGAGTGATGAACGCAAGAG
EGR1-R	GGATGGGTAGGAAGAGAGGGAAGAG
xCT-F	CGGGGTTGGCTTCCTTATCA
xCT-R	GAGTCTTCTGGTACAACTTCTAGT
GPX4-F	CCGCTTATTGAAGCCAGCAC
GPX4-R	TATCGGGCATGCAGATCGAC
GAPDH-F	CAATCCTGGGCGGTACAACT
GAPDH-R	TACGGCCAAATCCGTTCACA

FPN: Ferroportin, EGR1: Early growth response factor 1, GAPDH: Glyceraldehyde-3-phosphate dehydrogenase, GPX4: Glutathione peroxidase 4, A: Adenine, T: Thymine, G: Guanine, C: Cytosine.

Hematoxylin-eosin (HE) staining

Tissue samples were fixed with a 4% solution of paraformaldehyde, stained with hematoxylin (G1004, Servicebio, Wuhan, China) for 5 min, washed with running water, treated with 1% hydrochloric acid in alcohol for differentiation, and stained with eosin (G1002, Servicebio, Wuhan, China) for 2 min. Afterward, they were dehydrated through a series of ethanol concentrations and finally covered with neutral resin (10004160, Sinopharm, Beijing, China). After the samples were stained, images were captured using an Mshot MF53 microscope (Guangzhou Mshot Photoelectric Technology Co., Ltd).

Dual luciferase reporter gene assay

Frozen 293T cells were thawed and passed. On the basis of predictive analysis from bioinformatics websites, the wild-type (plasmid luciferase (pGL) 4.11-WT) and mutant (pGL4.11-mut) FPN promoter regions were cloned into the pGL4.11-basic vector. The plasmid cDNA (pcDNA) 3.1-TF (EGR1 overexpression vector) or pcDNA3.1-NC (negative control), pGL4.11-WT or pGL4.11-mut or pGL4.11-NC (negative control), and Renilla luciferase expression vector plasmid renilla luciferase-thymidine kinase (PRL-TK) were co-transfected into 293T cells. Five groups were set up: pcDNA3.1-NC + pGL4.11-FPN-NC + PRL-TK, pcDNA3.1-NC + pGL4.11-FPN-WT + PRL-TK, pcDNA3.1-EGR1-TF + pGL4.11-FPN-NC + PRL-TK, pcDNA3.1-EGR1-TTF + pGL4.11-FPN-WT + PRL-TK, and pcDNA3.1-EGR1-TTF + pGL4.11-FPN-mut + PRL-TK. After transfection, the levels of Firefly luciferase and Renilla luciferase activity were measured using the Dual-Luciferase Reporter Assay Kit (RG027, Beyotime, Shanghai, China). The ratio of Firefly to Renilla luciferase activity was employed to assess the effect of EGR1 on the promoter activity of FPN.

Statistical analysis

Data were examined using GraphPad Prism (version 8.0.1, GraphPad Software, USA, download at https://www.graphpad-prism.cn) and typeset for graphing using Adobe Illustrator 2021 (Adobe, USA, download site: https://www.adobe.com/cn/products/illustrator.html). Each experimental manipulation was repeated 3 times, with results presented as the mean ± standard deviation. Group comparisons were performed using GraphPad Prism (version 8.0.1), employing a standard one-way analysis of variance. Statistical significance was defined as P < 0.05.

RESULTS

Successful establishment of SIMI model

CLP was utilized to induce sepsis in rats, with the sham group serving as the control, to establish and validate a model of septic myocardial injury. The quantification of myocardial cytokine levels at 6, 12, and 24 h post-CLP revealed significantly increased levels of the pro-inflammatory cytokines TNF-a, IL-6, IL-1b, and the anti-inflammatory cytokine IL-10 in the model group compared with the sham group at 12 and 24 h timepoints (P < 0.01, [Figure 1a-d]). This finding indicates that CLP effectively induced a systemic inflammatory response in the rat model. The subsequent analysis of serum cTnT and NT-ProBNP levels [Figure 1e and f] demonstrated a significant increase in both markers in the model group compared with the sham group (P < 0.0001), confirming successful induction of myocardial injury consistent with the characteristics of septic cardiomyopathy. The TUNEL assay further showed that the apoptotic rate of myocardial cells in the model group was approximately 2-fold higher than that in the sham group (P < 0.01, [Figure 1g and h]), indicating significant myocardial cell damage. HE staining [Figure 1i] showed that the sham-operated hearts exhibited regularly arranged myocardial fibers with clear boundaries and an absence of inflammatory cell infiltration. By contrast, the myocardial tissue from the CLP-treated rats displayed widened interstitial spaces, cellular edema, focal dissolution, and mild inflammatory cell infiltration. The intracellular ROS levels, assessed using the DCFH probe and flow cytometry, were significantly increased in the myocardial tissue of the model group (1.8-fold increase, P < 0.0001, [Figure 1j and k]), demonstrating increased oxidative stress.

Figure 1:

Validation of the septic rat model of myocardial injury. (a-d) Enzyme-linked immunosorbent assay (ELISA) quantification of interleukin (IL)-6, IL-10, IL-1b, and tumor necrosis factor-a levels. (e and f) Serum levels of cTnT and NT-ProBNP as measured by ELISA. (g) Representative images of terminal-deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) staining for apoptotic cells in myocardial tissue from each group. Scale: 50 μm. (h) Quantification of TUNEL-positive cells in myocardial tissue. (i) Representative images of hematoxylin-eosin (HE) staining of myocardial tissue sections. Scale: 50 μm. (j and k) Flow cytometric analysis of intracellular 2’,7’-dichlorofluorescein fluorescence intensity, indicating reactive oxygen species levels. The sham and model groups were composed of three rats each. n = 3; ns, not significant; ^✶✶P < 0.01; ^✶✶✶✶P < 0.0001. cTnT: Cardiac troponin T, NT-ProBNP: N-terminal pro-brain natriuretic peptide.

EGR1 alleviation of septic myocardial ferroptosis by activating FPN expression

Transcriptome sequencing was performed on the myocardial tissues of septic rats and control group rats. Using |log2foldchange| >1 and P < 0.05 as the screening threshold, a total of 958 DEGs were identified. Compared with the control group, the sepsis model group had 661 significantly upregulated DEGs and 297 significantly downregulated DEGs [Figure 2a and b]. Notably, EGR1 exhibited a significant downregulation trend in the sepsis model group (Table 2). The GO enrichment analysis revealed that these DEGs were primarily involved in biological processes such as cellular stress response, regulation of redox homeostasis, and inflammatory signaling [Figure 2c]. The KEGG pathway analysis further showed significant enrichment of DEGs in key signaling pathways, including ferroptosis, mitogen-activated protein kinase (MAPK) signaling, and phosphatidylinositol 3-kinase-protein kinase B (PI3K-Akt) signaling [Figure 2d]. The transcriptional regulatory network analysis [Figure 2e] revealed a significant association between EGR1 and the predicted potential transcription factors of FPN (SLC40A1). The dual-luciferase reporter assays [Figure 2f] demonstrated a significant twofold increase in luciferase activity in cells co-transfected with an EGR1 overexpression vector and a wild-type FPN promoter (pcDNA3.1-EGR1 + pGL4.11-FPN-WT) compared with the negative control group (pcDNA3.1-NC + pGL4.11-FPN-WT, P < 0.0001). By contrast, no significant change in activity was observed in the mutant binding site group (pcDNA3.1-EGR1 + pGL4.11-FPN-mut, P > 0.05), confirming that EGR1 can directly activate FPN transcriptional expression. This study elucidates, for the 1^st time, the regulatory relationship of the EGR1-FPN axis in septic myocardial injury. The downregulation of EGR1 is hypothesized to suppress FPN expression, leading to impaired iron efflux in myocardial cells, iron overload, and lipid peroxidation, ultimately promoting the occurrence of ferroptosis.

Figure 2:

Role of early growth response factor 1/ferroportin (FPN) axis in septic myocardial injury. (a) Volcano plot illustrating differentially expressed genes (DEGs) in septic myocardial tissue compared with control. (b) Clustered heatmap of DEGs. (c) Gene ontology (GO) enrichment analysis results for DEGs. (d) Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis results for DEGs. The GO and KEGG enrichment analysis bar graphs show the top 20 terms from the GO annotation results of the DEGs. (e) Transcriptional regulatory network analysis of FPN. (f) Luciferase reporter assay results. n = 3, ns, not significant; ^✶✶✶✶P < 0.0001.

Table 2:

Top 20 downregulated genes ranked by degree value in the protein-protein interaction (PPI) network.

Gene name	Color	Shape	Degree	Size
Ccl2	0.000264	Down	21	23
Cxcl12	0.000238	Down	19	20.9
Cxcl10	2.23E-07	Down	16	17.75
Cxcl9	2.87E-11	Down	16	17.75
Cxcl11	0.000844	Down	15	16.7
Actc1	2.34E-11	Down	15	16.7
Xcl1	0.002826	Down	14	15.65
Acta1	8.94E-05	Down	14	15.65
Asb2	3.36E-08	Down	13	14.6
Foxp3	0.041539	Down	13	14.6
Klhl31	5.61E-05	Down	13	14.6
Asb4	0.001274	Down	12	13.55
Ccl1	9.01E-06	Down	12	13.55
Ccn2	7.25E-05	Down	12	13.55
Egr1	1.72E-07	Down	11	12.5
Ncbp2	0.013515	Down	11	12.5
Ccl22	0.0094	Down	11	12.5
Cd40	0.040167	Down	11	12.5
Cd247	0.009891	Down	10	11.45
Myh7	0.001670554	Down	10	11.45

EGR1 suppression of ferroptosis through activation of FPN/xCT/GPX4 axis

The messenger RNA (mRNA) and protein expression levels of EGR1 and FPN in the myocardial tissue of septic rats were examined to further validate the expression changes in the EGR1-FPN axis in septic myocardial injury. The results [Figure 3a-d] showed that compared with the sham group, the sepsis model group demonstrated a reduction in EGR1 and FPN mRNA and protein expression levels by approximately 50% (P < 0.01). These findings were highly consistent with the transcriptomic sequencing data, further suggesting that EGR1 may act as an upstream regulator of FPN, and its downregulation directly leads to reduced FPN expression.

Figure 3:

Validation of early growth response factor 1 (EGR1) and ferroportin (FPN) expression in rat model of septic myocardial injury. (a) Real-time quantitative polymerase chain reaction (RT-qPCR) analysis of EGR1 messenger RNA (mRNA) expression in myocardial tissue. (b) Western blot analysis of EGR1 protein expression in myocardial tissue. (c) RT-qPCR analysis of FPN mRNA expression in myocardial tissue. (d) Western blot analysis of FPN protein expression in myocardial tissue. (e) CCK-8 assay assessing viability of rat cardiomyocytes. (f-h) Colorimetric assays measuring myocardial cell MDA, Fe²⁺, and GSH levels. n = 3; ^✶P < 0.05; ^✶✶P < 0.01; ^✶✶✶P < 0.001; and ^✶✶✶✶P < 0.0001.

On the basis of the above findings, EGR1 overexpression (oe-EGR1) and knockdown (sh-EGR1) plasmids were constructed, and functional validation was performed in H9c2 cardiomyocytes. The CCK-8 assays revealed that EGR1 overexpression promoted H9c2 cell viability (P < 0.01), whereas EGR1 silencing inhibited cell viability (P < 0.0001, [Figure 3e]). The assessment of oxidative stress and ferroptosis-related indicators showed that [Figure 3f-h] EGR1 overexpression significantly decreased the intracellular MDA (P < 0.05) and Fe²⁺ levels (P < 0.01) while significantly increasing the GSH content (P < 0.0001). EGR1 silencing exhibited opposite trends (P < 0.0001). Further investigation revealed that EGR1 overexpression upregulated the expression levels of EGR1 (P < 0.0001), FPN (P < 0.001), and the ferroptosis suppressor genes xCT (P < 0.001) and GPX4 (P < 0.001), whereas EGR1 silencing downregulated their expression levels (P < 0.05, [Figure 4a-c]). Mitochondrial membrane potential analysis [Figure 4d and e] showed that the mitochondrial membrane potential (ΔYm) overexpression of EGR1 significantly increased the ΔYm (P < 0.0001), while silencing of EGR1 caused no significant change in the ΔYm (P > 0.05). The flow cytometric analysis of intracellular ROS levels [Figure 4f and g] showed that EGR1 overexpression reduced DCFH-DA fluorescence intensity to half of that of the control group (P < 0.0001), whereas EGR1 silencing resulted in an approximately twofold increase in fluorescence intensity (P < 0.0001).

Figure 4:

Functional validation of transcription factor early growth response factor 1 (EGR1) in cardiomyocytes from septic rat model. (a) Real-time quantitative polymerase chain reaction analysis of EGR1, ferroportin (FPN), xCT, and glutathione peroxidase 4 (GPX4) messenger RNA levels in cardiomyocytes. (b and c) Western blot analysis of EGR1, FPN, xCT, and GPX4 protein expression levels in cardiomyocytes. (d and e) Assessment of mitochondrial membrane potential in cardiomyocytes from the septic rat model. (f and g) Flow cytometric analysis of intracellular 2’,7’-dichlorofluorescein fluorescence intensity in cardiomyocytes. n = 3; ns, not significant; ^✶P < 0.05; ^✶✶P < 0.01; ^✶✶✶P < 0.001; and ^✶✶✶✶P < 0.0001.

Enhancement in antioxidant capacity and suppression of ferroptosis in vivo by EGR1 overexpression

The in vivo experiments demonstrated that at 24 h post-injection of adeno-associated virus vector encoding EGR1 into the myocardium of septic rats, the survival rate of the oe-EGR1 + model group (70%) was significantly higher than that of the model group and the oe-NC + model group (both 50%) but lower than that of the sham group (90%, [Figure 5a]). Compared with the oe-NC + model group, the oe-EGR1 + model group exhibited significantly reduced serum levels of the myocardial injury markers cTnT and NT-proBNP (P < 0.0001, [Figure 5b and c]). The histopathological analysis of myocardial tissue revealed more regular myocardial fiber arrangement and reduced edema and cell lysis in the oe-EGR1 + model group than in the oe-NC + model group [Figure 5d].

Figure 5:

Functional investigation of early growth response factor 1 (EGR1) overexpression in septic rat model of myocardial injury. (a) Mortality rate of septic rats. (b and c) enzyme-linked immunosorbent assay quantification of serum myocardial injury markers cTnT and NT-ProBNP in rats. (d) Representative hematoxylin and eosin (H&E)-stained sections of rat myocardial tissue, showing pathological damage. Scale: 50 μm. (e) Transmission electron microscopy images of mitochondria (red arrow) within cardiomyocytes from each group. Scale: 20 μm. (f and g) Flow cytometric analysis of intracellular DCFH fluorescence intensity in cardiomyocytes. The sham and model groups had six rats each, and the oe-NC + model and oe-EGR1 + model groups had three rats each. n = 3; ns, not significant; ^✶✶✶P < 0.001; and ^✶✶✶✶P < 0.0001. cTnT: Cardiac troponin T, NT-ProBNP: N-terminal pro-brain natriuretic peptide.

Further observation of mitochondrial ultrastructure by transmission electron microscopy revealed intact mitochondrial structure with clear cristae and membrane structure in the sham group; mitochondrial matrix swelling, cristae fracture, and membrane fragmentation in the model group and the oe-NC + model group; and reduced mitochondrial swelling and partial cristae recovery in the oeEGR1 + model group, although not fully restored to the level of the sham group [Figure 5e]. In the assessment of oxidative stress-related indicators, the flow cytometric analysis of DCFH fluorescence intensity in cardiomyocytes showed that the DCFH fluorescence intensity in the oe-EGR1 + model group was significantly lower than that in the oe-NC + model group (P < 0.001) but higher than that in the sham group [Figure 5f-g], indicating that EGR1 overexpression could, to some extent, inhibit oxidative stress levels within cardiomyocytes. Simultaneously, gene and protein levels of EGR1, FPN, x CT, and GPX4 in the myocardial tissue of the oe-EGR1 + model group were significantly increased compared to the oe-NC + model group (P < 0.05, [Figure 6a-f]), suggesting that EGR1 overexpression can promote the expression of these genes and proteins related to iron metabolism and antioxidant defense. Furthermore, in the assessment of serum-related indicators, the serum GSH content in the oe-EGR1 + model group was significantly increased compared to the oe-NC + model group (P < 0.001), while Fe²⁺ (P < 0.001) and MDA (P < 0.0001) levels were significantly reduced compared to the oe-NC + model group [Figure 6g], further confirming the regulatory effect of EGR1 overexpression on iron metabolism and oxidative stress. In summary, EGR1 overexpression alleviates septic myocardial injury and improves rat survival rate by upregulating the FPN/xCT/GPX4 axis, inhibiting ferroptosis and oxidative stress, and improving mitochondrial ultrastructure.

Figure 6:

Effects of early growth response factor 1 (EGR1) overexpression on the expression levels of key genes and proteins in septic rat model. (a) Real-time quantitative polymerase chain reaction analysis of EGR1, ferroportin (FPN), xCT, and glutathione peroxidase 4 (GPX4) messenger RNA levels in rat myocardial tissue. (b-f) Western blot analysis of EGR1, FPN, xCT, and GPX4 protein levels in rat myocardial tissue. (g) Colorimetric assays measuring Fe²⁺, glutathione, and malondialdehyde levels in rat serum. The sham and model groups were composed of six rats each, and the oe-NC + model and oe-EGR1 + model groups had three rats each. n = 3; ns, not significant; ^✶P < 0.05; ^✶✶P < 0.01; ^✶✶✶P < 0.001; and ^✶✶✶✶P < 0.0001.

DISCUSSION

Myocardial injury induced by sepsis is a pathophysiological process that includes increased circulating myocardial depressant factors, oxidative and nitrosative stress, and mitochondrial dysfunction, which are major contributors to the worsening condition and poor prognosis in patients with sepsis.^[17] Therefore, elucidating the molecular mechanisms of SIMI and exploring new therapeutic targets are significant for the prognosis of patients with sepsis.

CLP, a classic method for establishing a sepsis rat model, has been proven to be of great value in the study of SIMI, because it can increase cardiac iron content, deplete GSH, and enhance lipid peroxidation in rats.^[18] In the present study, the model validation results showed that 12–24 h after CLP, the rats exhibited significant systemic inflammatory responses, myocardial structural damage, and enhanced oxidative stress. Meanwhile, the levels of myocardial injury markers cTnT and NT-ProBNP in the serum of the model rats increased.^[19] These characteristics are highly consistent with the features of SIMI reported by Abdelnaser et al.,^[20] indicating that this model has good pathological representativeness.

EGR1 can regulate cardiac repair by promoting angiogenesis and cardiomyocyte proliferation,^[15] and it is a new therapeutic target for cardiovascular diseases.^[21] In the present study, the DEG EGR1 related to sepsis was screened out through transcriptome sequencing, and it is a downregulated gene in sepsis. The functional enrichment analysis showed that the sepsis-related DEGs are associated with the ferroptosis pathway. Ferroptosis is an iron-dependent non-apoptotic cell death caused by lipid peroxidation, and the inhibition of ferroptosis can effectively alleviate SIMI.^[22] For example, Fer-1 has a protective effect on myocardial injury after myocardial infarction by inhibiting ferroptosis.^[23] Moreover, melanin nanoparticles alleviate SIMI by inhibiting ferroptosis and inflammation.^[24] FPN, a multi-transmembrane protein, is the only known mammalian iron exporter that transports iron from the cytoplasm to the extracellular space. It negatively regulates ferroptosis by reducing the intracellular iron concentration.^[25] For instance, knocking down FPN accelerates erastin-induced ferroptosis by increasing iron-dependent lipid ROS (L-ROS) accumulation.^[26] Through transcriptional regulatory network analysis and dual-luciferase reporter gene assays, the present study demonstrated, for the ^1st time, the regulatory relationship between EGR1 and FPN in SIMI, and that EGR1 may serve as an upstream regulator of FPN. This finding breaks through the previous understanding that EGR1 regulates iron metabolism only through indirect pathways.^[27] Meanwhile, the synchronous downregulation of EGR1 and FPN expression levels in the sepsis model group indicated that the EGR1-FPN axis may be a key regulatory node in SIMI.

The in vivo and in vitro experiments showed that the expression levels of EGR1 and FPN significantly decreased, which is consistent with the results of transcriptome sequencing, thus confirming the upstream regulatory relationship of EGR1 on FPN. The results of functional verification showed that EGR1 overexpression could significantly promote cell viability; reduce MDA and Fe²⁺ levels; increase GSH content; and upregulate the expression levels of FPN, xCT, and GPX4. This finding indicates that EGR1 can inhibit oxidative stress and ferroptosis by activating the FPN/xCT/GPX4 axis. Accumulating evidence has firmly established that EGR1 serves as a pivotal regulator of ferroptosis and is intricately involved in the pathological mechanisms underlying diverse diseases. For instance, within bladder cancer cells, EGR1 mediates ferroptosis through transcriptional modulation of arachidonate 5-lipoxygenase.^[28] In the context of acute myocardial infarction, EGR1 promotes ferroptosis by regulating the GPX4/solute carrier family 7 member 11 (SLC7A1) pathway.^[27] Li et al.^[29] demonstrated a significant association between EGR1 and the ferroptosis pathway. The findings of the present study are in agreement with these previous reports, further validating the crucial role of EGR1 in the regulation of ferroptosis. Zhang et al.^[30] reported that ferroptosis ensues when GSH is depleted and GPX4 is inactivated. This allows a substantial influx of Fe²⁺ into mitochondria, where the Fenton reaction generates L-ROS, ultimately culminating in cell death. Specifically, GPX4 functions to reduce hydrogen peroxide, organic peroxides, and lipid peroxides. Inhibition of its activity triggers lipid peroxidation on the membrane structure, thereby giving rise to lipid alkoxy groups and reactive aldehydes such as MDA.^[31] In the present study, EGR1 overexpression significantly reduced the MDA levels and increased the GSH content, indicating its capacity to inhibit lipid peroxidation and alleviate ferroptotic damage. XCT, a subunit of the Xc^- system, mediates extracellular cystine transport into cells where it is reduced to cysteine—the rate-limiting precursor for GSH biosynthesis. GSH is essential for GPX4 antioxidative function.^[32-35] This finding further corroborates the role of EGR1 in suppressing ferroptosis through the FPN/xCT/GPX4 axis. In addition, EGR1 preserved ΔYm, demonstrating its ability to improve mitochondrial function and reduce ROS production, thereby attenuating oxidative stress injury. These results align with previous reports linking mitochondrial dysfunction and autophagy dysregulation to the pathogenesis of myocardial injury.^[36,37] Specifically, EGR1 overexpression prevented excessive intracellular ROS accumulation and Fe²⁺ influx into the mitochondria, thereby inhibiting ferroptosis and mitigating oxidative stress in septic myocardial injury.^[38]

When EGR1 is overexpressed, the gene and protein expression levels of FPN are upregulated. Since inhibiting FPN-dependent iron export can make intracellular iron overload worse, heighten mitochondrial ROS production, and bring about mitochondrial dysfunction that leads to ferroptosis,^[39,40] the upregulation of FPN expression suggests that EGR1 overexpression can regulate myocardial injury in septic rats by controlling FPN in cardiomyocytes. This finding further verified that EGR1 specifically binds to the promoter region of FPN and then activates FPN transcription. As Pan et al.^[41] have confirmed, FPN is capable of transporting Fe²⁺. This finding indicated that EGR1 overexpression can boost FPN expression. Such an increase in FPN helps maintain the balance of intracellular Fe³⁺, lessens the accumulation of Fe³⁺ in cells, and thereby preserves the ΔYm, in line with the results of the present study.

SUMMARY

This study demonstrates that EGR1 overexpression inhibits ferroptosis in septic myocardium by activating the FPN/xCT/GPX4 axis to regulate iron metabolism, enhance antioxidant defense, and preserve mitochondrial function. These findings provide a potential therapeutic target for developing novel treatment strategies against septic myocardial injury. Future studies could focus on developing drugs that either upregulate EGR1 expression or directly activate the FPN/xCT/GPX4 signaling axis, thereby enhancing cardiomyocyte resistance to ferroptosis, alleviating sepsis-induced myocardial damage, and improving patient outcomes. However, a notable detail is that while this research focuses on the role and downstream mechanisms of EGR1, the upstream regulatory mechanisms of EGR1 in the context of sepsis – such as potential regulatory factors or signaling pathways that may influence EGR1 expression during septic myocardial injury – remain underexplored.

AVAILABILITY OF DATA AND MATERIALS

The data and materials used to support the findings of this study have been included in this article.

ABBREVIATIONS

ALOX5: Arachidonate 5 – lipoxygenase

CCK-8: Cell counting Kit-8

CLP: Cecal ligation and puncture

cTnT: Cardiac troponin T

DCFH-DA: 2’,7’-dichlorofluorescein diacetate

EGR1: Early growth response factor 1

ELISA: Enzyme-linked immunosorbent assay

FPN: Ferroportin

GO: Gene ontology

GPX4: Glutathione peroxidase 4

GSH: Glutathione

HE: Hematoxylin-eosin

IL-10: Interleukin-10

IL-1β: Interleukin-1β

IL-6: Interleukin-6

KEGG: Kyoto Encyclopedia of Genes and Genomes

L-ROS: Lipid reactive oxygen species

MDA: Malondialdehyde

NOX4: Nicotinamide adenine dinucleotide phosphate oxidase 4

NT–proBNP: N-terminal pro-brain natriuretic peptide

OD: Optical density

ROS: Reactive oxygen species

RT-qPCR: Real-time quantitative polymerase chain reaction

SIMD: Sepsis-induced myocardial dysfunction

SIMI: Sepsis-induced myocardial injury

SLC7A1: Solute carrier family 7 member 11

TNF-α: Tumor necrosis factor-α

TUNEL: Terminal–deoxynucleotidyl transferase mediated nick end labeling

AUTHOR CONTRIBUTIONS

SHJ and GLS: Conceived and designed the study and drafted the manuscript; SHJ, GLS, and HQZ: Conducted the experiments and analyzed the data; XSW, ZQD, and TTP: Assisted in data analysis and critically revised the manuscript for important intellectual content. All authors critically reviewed the article for important intellectual content. All authors read and approved the final published version of the manuscript. They agree to take responsibility for all aspects of the work and to ensure that issues related to the accuracy or completeness of any part of the work are properly investigated and resolved. All authors meet ICMJE authorship requirements.

Funding Statement

FUNDING: This study was funded by the Science and Technology Fund Project of Guizhou Provincial Health Commission (Project Name: Study on the Mechanism of Ferroportin-mediated Ferroptosis in Regulating Myocardial Injury in Septic Rats; Project Number: gzwkj2025-216) and the Guizhou Science and Technology Plan Project (Project Name: Study on the Protective Effect of Sini Decoction on Septic Cardiomyopathy in Rats through METTL3-mediated M6A Modification of NF-KB mRNA; Project Number: Qian Ke He Ji Chu - ZK[2024] General 415).

ETHICS APPROVAL AND CONSENT TO PARTICIPATE

All the experiments involving animals in our research adhered to the ethical regulations of the Animal Experiment Ethics Inspection Form of Guizhou University of Traditional Chinese Medicine and have been approved by this committee (Ethics Approval Number: 2024092; License Number for the Use of Laboratory Animals: SYXK (Xiang)2024-0019; License Number for the Production of Laboratory Animals: SYXK (Xiang)2021-0002; Approval Date: July 2, 2024). We followed strict animal welfare standards, ensured the comfort of the animals during the experiments, and minimized their suffering. Consent to participate was not required as there were no human subjects in the study.

CONFLICTS OF INTEREST

The authors declare no conflicts of interest.

EDITORIAL/PEER REVIEW

To ensure the integrity and highest quality of CytoJournal publications, the review process of this manuscript was conducted under a double-blind model (authors are blinded for reviewers and vice versa) through an automatic online system.