Functional Domains for Amelogenin Revealed by Compound Genetic Defects

Abstract

We have previously used the yeast two-hybrid assay and multiple in vitro methodologies to show that amelogenin undergoes self-assembly involving two domains (A and B). Using transgenic animals, we show that unique enamel phenotypes result from disruptions to either the A- or B-domain, supporting the role of amelogenin in influencing enamel structural organization. By crossbreeding, animals bearing two defective amelogenin gene products have a more extreme enamel phenotype than the sum of the defects evident in the individual parental lines. At the nanoscale level, the forming matrix shows alteration in the size of the amelogenin nanospheres. At the mesoscale level of enamel structural hierarchy, 6-week-old enamel exhibits defects in enamel rod organization caused by perturbed organization of the precursor organic matrix. These studies reflect the critical dependency of amelogenin self-assembly to form a highly organized enamel organic matrix, and that amelogenins engineered to be defective in self-assembly produce compound defects in the structural organization of enamel.

INTRODUCTION

Understanding the functional role of enamel proteins during enamel biomineralization is a long sought goal. Enamel forms entirely extracellularly with the removal of enamel proteins coinciding with their replacement by carbonated hydroxyapatite (Hap) crystallites. The assembly of the enamel organic matrix, its disassembly by proteases, and the growth of the mineral phase at the expense of the organic phase implies that enamel formation is an extremely complex biological phenomenon that operates as a consequence of tightly regulated and orchestrated control mechanisms.^(1–4) Amelogenin is essential for normal enamel formation as demonstrated by animals null for the amelogenin gene, which present with a disorganized hypoplastic enamel.⁽⁵⁾ The amelogenin-null enamel phenotype reveals that amelogenin is not required for enamel crystallite nucleation and subsequent biomineralization, but is essential to the crystal habit and to the organization of the enamel rod architecture and final enamel form.

Amelogenin undergoes self-assembly involving at least two assembly domains (A and B).⁽⁶⁾ The significance of these two assembly domains has been demonstrated by the yeast two-hybrid (Y2H) assay,^(6,7) dynamic light scattering (DLS),⁽⁸⁾ atomic force microscopy (AFM),⁽⁸⁾ and surface plasmon resonance (SPR).⁽⁷⁾ Transgenic animals in which unique enamel phenotypes resulted from disruptions to either self-assembly domain support our previous postulates regarding an amelogenin influence on enamel biosynthesis gained from our in vitro studies.^(7–9) That is, by removing the A-domain of amelogenin, we were able to show in vivo that amelogenin assemblies, more commonly referred to as nanospheres, were significantly reduced in size.⁽⁹⁾ This size reduction was from 19.4 to 13.8 nm.⁽⁹⁾ These data were predicted from previous DLS data using a modified A-domain–deleted recombinant form of amelogenin.⁽⁸⁾ The A-domain–deleted transgenic animals also exhibit organizational defects in the mature enamel with a significant disruption to enamel architecture that includes disruption of rod boundaries, disruption of rod decussation, and increased porosity of the final enamel product.⁽⁹⁾

The mature enamel of the animals in which the amelogenin self-assembly B-domain was removed revealed poorly preserved boundaries between rod and interrod enamel. This may imply that the early collapse of the nanospheres into larger spheres results in a loss of control of crystal orientation, allowing crystallites to grow in a more haphazard fashion and thus making the rod and interrod boundaries less well defined. Indeed, such images have been documented for the immature enamel of these animals.⁽⁴⁾ These data also correlate to our previous AFM and DLS observations that the nanospheres formed from homogeneous populations of recombinant amelogenin lacking the B-domain collapse over time to form larger spheres.⁽⁸⁾

Humans affected by an inherited enamel defect known as amelogenesis imperfecta (AIH1) exhibit a defect in the amelogenin gene locus located on the X chromosome.^(10,11) This defect results in reduced or absent amelogenin protein expression, thus providing a genetic link to amelogenin as an essential component of the enamel matrix.⁽¹²⁾ Enamel phenotypes resulting from gene mutations are broadly characterized as hypoplastic or hypomineralized. As a general rule, and based on documented cases, mutations that alter the C terminus of human amelogenin have resulted in a hypoplastic phenotype, whereas mutations located within the N terminus present as hypomineralized enamel.^(11,13)

In this study, we bred animals homozygous for a deleted A-domain amelogenin transgene with animals homozygous for a deleted B-domain amelogenin transgene. We report that the immature and mature enamel phenotypes of the compound transgenic animals comprise the sum of defects previously recorded for each parental line. These animals also present a phenotype of well-defined regions of hypomineralization in the immature enamel that is not seen in the immature enamel of either parental line.

MATERIALS AND METHODS

Transgenic animals

Molecular techniques and constructs used in this study have been previously described, as have the transgenic parental animal lines.^(8,9) Briefly, the mouse amelogenin promoter^(14,15) was used to express the modified amelogenin transgenes. The first transgenic animal line involved the addition of the FLAG epitope in the self-assembly A-domain region of the amelogenin protein previously occupied by amino acids 3–42; this construct will be referred to as M180ΔA-FLAG. The second transgenic animal lines involved the addition of the hemagglutinin epitope in the self-assembly B-domain region of the amelogenin protein previously occupied by amino acids 157–173; this construct will be referred to as M180ΔB-HA. The genotyping of the crossed animals, which carry both of the engineered amelogenin transgenes, was determined by Southern blot and polymerase chain reaction (PCR) analysis. Two unique compound transgenic mice lines were studied and each gave largely identical data. These two lines were created when a single founder line homozygous for the M180ΔA-FLAG transgene was bred to two different founder lines homozygous for the M180ΔB-HA transgene.

PCR and reverse transcriptase-PCR

The oligonucleotide primers used in this study are listed in Table 1. For PCR amplification of the M180ΔA-FLAG and M180ΔB-HA transgenes, the primers PA74 and PA73 were used; each of the transgenes could be distinguished based on size. A reverse transcriptase (RT)-PCR was performed on total RNA extracted from the mandibles of newborn mice and was performed for a nontransgenic mouse, a compound transgenic animal, and an animal from each of the transgenic parental lines. After the initial RT reaction, the primer set used for PCR was PA75 and PA73, which could distinguish the presence of the respective mRNAs based on size. For all reactions, a PCR annealing temperature of 56°C was used. All other conditions for RT-PCR and PCR followed a standard protocol with an extension time of 3 minutes and using 28 cycles.⁽¹⁶⁾ PCR-generated DNA was resolved on a 1% agarose gel.

Table 1.

Primers Used in this Study (5′-3′)

Name	Sequence	Orientation	Location
PA73	TTAATCCACTTCTTCCCGCTTGGT	reverse	exon 6
PA74	ATGGGGACCTGGATTTTGTTTGCCTGC	forward	exon 2
PA75	ACCATCGGATCAAGCATCCCTGAGCTT	forward	exon 1

Scanning and transmission electron microscopy

Methodology for sample preparation and imaging by scanning electron microscopy (SEM) were previously reported and were followed without modification.^(17–19) Six-week-old animals were killed for SEM imaging. A 6-weekold mouse incisor is presented to indicate the regions from which the SEM images were collected (Fig. 1). In all, three animals from each of the two compound transgenic lines were subjected to SEM analysis, and all gave largely identical results. The figures used are representative of the defects noted in these animals.

FIG. 1.

Sagittal view of a mandible from a 6-week-old mouse. The mature (M) end and growing end (GE) of the incisor tooth are identified, as are the secretory zone (sz), transitional zone (tz), and mature (m) enamel.

Semi-thin sections from the incisors of three 4-day postnatal mice from each of the two compound transgenic lines were prepared and stained with toluidine blue O dye. An incisor judged to have representative defects to the enamel at the level of light microscopy was selected for transmission electron microscopy (TEM) analysis. Samples were taken from the growing end of the incisor adjacent to the area surveyed by light and included Tomes’ processes, secretory ameloblasts, and immature enamel. Methodology for sample preparation and imaging by TEM were previously reported and were followed without modification.^(8,9,20) Approximately 30 fields from this incisor were viewed and photographed, and the figures used are representative of the defects noted.

RESULTS

Genotyping and phenotyping

The genotypes and phenotypes of the founder animal lines carrying each of the two transgenes (M180ΔA-FLAG and M180ΔB-HA) were previously documented.⁽⁹⁾ In this study, Southern blot analysis was performed to determine the genetic status of the pups that resulted from cross-breeding. The luciferase 3′-untranslated region included in each transgene⁽⁹⁾ was identified with a complementary random-primed 32P-labeled DNA template. Each transgenic animal line gives a unique banding pattern following restriction enzyme digest of genomic DNA (data not shown). Thus, Southern analysis provided the genetic status for each animal. The subsequent TEM and SEM analysis was restricted to animals carrying both of the transgenes, and we refer to these animals as compound transgenic animals. Additionally, PCR and RT-PCR were used to amplify genomic and reversetranscribed single-stranded DNA from selected transgenic and compound transgenic animals. Representative result from such genotyping (Fig. 2A) and phenotyping (Figs. 2B and 2C) of transgenic animals are presented. It is apparent from the RT-PCR that, at the newborn stage of development for the animal from which RNA was extracted, the M180ΔB-HA transgene has a higher mRNA expression level than does the wild-type amelogenin (Fig. 2B). Also, for this particular animal, the level of wild-type amelogenin mRNA is greater than the level seen for the M180ΔA-FLAG transgene (Fig. 2B).

FIG. 2.

(A) Genotyping of compound transgenic animals. PCR-generated DNA products resulting from genomic DNA templates isolated from tail clippings of new-born mice. Lane 1 is a M180ΔB-HA transgenic animal, lane 2 is a M180ΔA-FLAG transgenic animal, and lane 3 is the compound transgenic animal. Both of the transgenes are present in the compound animal. The primers used for PCR were PA74 and PA73, which produced bands of the predicted sizes for M180ΔB-HA (627 bp; lanes 1 and 3) and M180ΔA-FLAG (534 bp; lanes 2 and 3). A 100-bp DNA size marker is included for comparisons (lane 4). (B and C) Phenotyping of compound transgenic animals. RT-PCR DNA products resulting from an mRNA template isolated from the mandible of a single compound transgenic animal. The primers used were PA75 and PA73. Panel C is the highlighted region of B that has been magnified. This animal contained both of the transgenes (M180ΔA-FLAG and M180ΔB-HA) derived from each respective parental line, and also wild-type amelogenin. Lanes 2 and 3 in B are DNA size markers and the relative lengths in nucleotide base pairs for lane 2 are given in C. Three PCR amplified cDNAs at the predicted 661 bp (wild-type), 604 bp (M180ΔA-FLAG), and 697 bp (M180ΔB-HA) were evident. An additional band at 298 bp can be seen in lane 1 of B, and this corresponds to the cDNA for the leucine-rich amelogenin polypeptide (LRAP).

An additional band from the reaction was noted (Fig. 2B, lane 1), and its size of approximately 300 nucleotide bp related to the leucine-rich amelogenin polypeptide (LRAP).⁽²¹⁾

Immature enamel observed by TEM

TEM has been used to observe amelogenin nanospheres within the immature enamel proximal to Tomes’ processes. For the compound transgenic animals, there is a heterogeneous population of nanospheres with respect to size and shape (Figs. 3A–3C), which differs from the relatively homogenous population of nanospheres previously reported for nontransgenic mice.^(9,20) It seems that neighboring nanospheres may indeed be fusing to one another because the nanospheres of compound transgenic animals are frequently nonspherical (Fig. 3B). The collapse of nanospheres is a feature described previously for the transgenic animals with a deleted B-domain.⁽⁹⁾ Excluding the nonspherical electron-lucent “nanspheres,” and using a calibrated lenticular, 100 nanospheres from six fields proximal to Tomes’ processes were measured, yielding diameters of 5.8 ± 0.99 nm (range, 3.7–7.4 nm).

FIG. 3.

Transmission electron microscopy of immature enamel of compound transgenic mice. Sampling is taken from a location close to Tomes’ processes. (A) The location between Tomes’ processes (TP), rod-enamel (R), and interrod-enamel (IR). The boxed areas numbered “1” and “2” are magnified in B and C, respectively. The single arrowheads (►) in B point to nanospheres of relatively small size (5–7 nm), whereas the double arrowheads (►►) in B point to nanospheres of relatively large size (25–30 nm). The arrows (→) in C show a series of nanospheres of normal size (19–20 nm); this condition is expected because the canonical amelogenin gene remains functional in these animals. (D) A region that contains nanospheres of uniform size, which are small (approximately 6 nm) when compared with nanospheres of nontransgenic immature teeth (approximately 19–20 nm). The region shown by D is relatively void of crystallites, but it is a region that is completely encased by crystallites. This region identified by D measures approximately 1 μm. The single arrowheads in D identify relatively small nanospheres of approximately 7.6 nm. Asterisks in D identify an occasional crystallite. Bar scale in A is 500 nm. Bar scale in B–D is 100 nm.

An even more prominent feature of the immature enamel of compound transgenic animals is the many regions that contain uniformly shaped amelogenin nanospheres. These regions have few crystallites compared with the surrounding tissues (Fig. 3D). Such regions are rarely observed in incisor teeth of aged-matched nontransgenic animals. Based on our screening of approximately 30 TEM fields from a single tooth, these regions measure 1.0–1.5 μm across and disrupt the forming enamel in the rods (Fig. 3). Again, using a calibrated lenticular, it was apparent that the nanospheres from these regions measured approximately 6 nm. It is not possible to determine if these defective regions would be regions of hypomineralization in the mature enamel because the methodologies used do not allow for the observation of individual regions over time. However, the fact that there is a small population of crystallites within these regions (Fig. 3D) might suggest that there is a retardation to mineralization, rather than a lack of mineralization.

Light microscopic observations of enamel of 6-week-old mice

The gross phenotype of incisor enamel of 6-week-old compound transgenic mice was similar to nontransgenic control mice. The enamel and underlying dentine was of normal shape and thickness. At this magnification there was no indication of enamel hypoplasia, and the coloring was normal in appearance. There were no signs of excessive wear or fracture.

SEM observations of enamel samples from the growing zone, transitional zone, and mature end of an incisor

The compound transgenic mice were shown to exhibit a significant disruption to the enamel architecture, including disruption to the rod boundaries, disruption to rod decussation, and increased porosity of the enamel by SEM analysis (Figs. 4 and 5). The defective phenotypes were more pronounced within the secretory zone of enamel (Fig. 4B) than were the phenotypes observed within the transition zone (Fig. 4D) or the maturation zone of enamel (Fig. 4F). At the area close to the growing end, we observed that the enamel-rods and the enamel-interrods were largely disrupted, and that the rod-boundaries had largely disappeared (Fig. 4B). As the enamel matured, the defect within the enamel-rods recovered slightly, and the porosity seen at the growing end was less apparent (Fig. 4D). The overall impression of the mature enamel of the compound transgenic mice (Fig. 4F), when compared with nontransgenic control enamel (Fig. 4E), was of an enamel layer of relatively normal and uniform thickness, but exhibiting hypomineralization that could be accounted for by regions of porosity. Based on SEM images that show a disruption to the rod and interrod boundaries, we believe that the compound transgenic animals exhibited a greater contribution of interrodenamel.

FIG. 4.

Scanning electron microscopy of enamel from 6-week-old mouse incisors. Panels A, C, and E are from an incisor of age-matched, nontransgenic control mice, whereas panels B, D, and F are from compound transgenic animals. Panels A and B are from the secretory zone, panels C and D from the transition zone, and panels E and F are from mature zone. All samples are from incisors that have been ground in a sagittal section and lightly acid etched.^(17–19) The magnification for each panel is identical. Bar scale in each panel is 10.0 μm.

FIG. 5.

Scanning electron microscopy of incisor enamel from 6-week-old mice. Samples were prepared by fracturing teeth coronally through the transitional zone and prepared for imaging. Fractured samples were not acid etched during their preparation. (A) An incisor of a nontransgenic control mice. (B) An aged-matched, compound transgenic animal. Panel A′ is a higher magnification of a region from A, and panel B′ is a higher magnification of a region from B. For all images, the enamel surface is at the top of each panel. In panels A and B, the dentine enamel junction (arrow) is apparent and the dentine is below the dentine enamel junction. Bar scale in A and B is 50.0 μm. Bar scale in A′ and B′ is 20.0 μm.

In addition to the ground and lightly etched sagittal sections of the samples shown in Fig. 4, a number of compound transgenic teeth were sampled by fracturing in a coronal section through the transitional zone of incisor teeth. All the characteristics described above for etched teeth were corroborated in the enamel of the compound transgenic animals prepared by fracture. That is, the teeth from the compound transgenic animals exhibited hypomineralization and a disturbance to the rod architecture (Figs. 5B and 5B′). This phenotype was apparent when compared with age-matched nontransgenic animals (Figs. 5A and 5A′).

DISCUSSION

Amelogenin nanospheres influence enamel formation at the nanoscale level and at the mesoscale level.^(4,9) Our in vitro and in vivo data demonstrated that the self-assembly “A” and “B” domains of the amelogenin protein each play a critical role in amelogenin nanosphere assembly. In vivo, disruption of the amelogenin A-domain results in an increased ratio of interrod-enamel compared with rodenamel.⁽⁹⁾ Furthermore, the porosity of the enamel increased in the A-domain–deleted transgenic animals is caused perhaps by a lack of internanosphere interaction or the absence of nanosphere tethering to Tomes’ processes that is required to form the interrod-enamel.⁽⁹⁾ An intact amelogenin B-domain stabilizes nanosphere assemblies,⁽⁸⁾ but disruption to the B-domain results in the apparent fusion of neighboring nanospheres,⁽⁸⁾ and this seems to result in a loss of control of crystal orientation as observed in vivo.⁽⁹⁾ Enamel from the B-domain–deleted transgenic mice revealed largely disoriented crystallites and poorly preserved boundaries between rod-enamel and interrod-enamel.⁽⁹⁾ The enamel of compound mice in which both the amelogenin self-assembly “A” and “B” domains were deleted display in concert the phenotypic characteristics described for each of the parental lines. The enamel phenotype in the compound transgenic animals could briefly be summarized as having disoriented crystallites within the rods, disrupted rod to interrod boundaries, an increased interrod-enamel at the expense of rod-enamel, and an increase in overall porosity.

In addition, these compound transgenic animals present a phenotype in the immature enamel that is not seen in either of the parental lines. This phenotype is of large areas within the immature enamel-rods and enamel-interrods that contain an abundance of relatively small, but uniformly sized nanospheres. These areas also contain a notable decrease in the inorganic crystallite component when compared with the surrounding developing tissue. Using DLS, it has been noted that a homogeneous population of recombinant amelogenin proteins with a deleted A-domain form spherical structures with an atomic radii of either 2.7 or 3.7 nm.⁽⁸⁾ These previous in vitro observations may explain the smaller nanospheres observed in these compound transgenic animal. The inclusion of the A-domain–deleted amelogenin transgene into the enamel matrix impacts on amelogenin self-assembly, which may perturb the timing of crystallite formation.⁽²²⁾ If mineralization is prevented in these areas, then voids in the mature enamel may be expected. Such voids are not seen in the mature enamel, which suggests that there is a biological mechanism that allows for the self-healing of structural defects during amelogenesis. Small nanospheres may retard, but not completely inhibit, the initiation and growth of crystallites. Animals null for the amelogenin gene form a hypoplastic enamel, which suggests that amelogenin does not regulate the initiation of crystallite formation.⁽⁵⁾

Amelogenin is essential for normal enamel formation as demonstrated by animals null for the amelogenin gene.⁽⁵⁾ Mutations in the human amelogenin gene located on the X chromosome result in amelogenesis imperfecta (AIH1) with enamel phenotypes broadly characterized as hypoplastic or hypomineralized. Documented cases of AIH1 with mutations in the C terminus of amelogenin have resulted in a hypoplastic phenotype, whereas mutations located within the N terminus have resulted in hypomineralized enamel.^(11,13) We have shown in vitro that single amino acid mutations, identical to those appearing in AIH1, reduce amelogenin self-assembly.⁽⁷⁾ A possible explanation for this genotype/phenotype relationship observed in vivo may be related to a reduction in the rate of amelogenin hydrolysis⁽²³⁾ and the subsequent events of mineralization. We observed increased enamel porosity in animals with defects to the N terminus (defined previously by the A-domain).⁽⁹⁾ We also noted that some porosity was a feature of B-domain–deleted transgenic animals,⁽⁹⁾ although here we failed to identify hypoplastic defects in the enamel of incisor teeth in compound transgenic animals.

Finally, we speculate on the molecular mechanism that may be responsible for the altered enamel phenotype observed for the compound transgenic animals. We believe that within every nanosphere there are differing proportions of the wild-type amelogenin and the two mutated amelogenins. The final shape and dimension of each nanosphere may be a reflection of the majority amelogenin protein form. For example, a nanosphere with the deleted A-domain dominating may more closely resemble the smaller spherical structures observed by DLS.⁽⁸⁾ In turn, the composition of the enamel matrix proteins would in be related to the transcriptional and translational activities of each ameloblast at any point in time. We believe that individual transgenes function in a dominant-negative manner over the wild-type gene product. In the compound transgenic mice, because nanosphere assembly is a summation of many individual amelogenin molecules contributing to the nanosphere, the resulting enamel phenotype is likely the sum the phenotypes contributed by each of the parental lines.

One aspect of transgenic animal studies that has not been elaborated by our group is the issue of transgene copy numbers that integrate into the chromosomes of a particular line, and whether copy numbers relate to different degrees of phenotype penetrance. Rather, we have relied on monoclonal antibodies to short peptide “epitopes” included in the transgene to show significant qualitative data related to active gene transcription and translation. We chose this approach because the altered amelogenin, which is encoded by the transgene, must be included in the enamel organic matrix for the protein to alter nanosphere function. Our impression has been that for all the animals studied to date⁽⁹⁾ have shown levels of the transgene protein product comparable with wild-type amelogenin. The transgenic protein product is also expressed in a spatial and temporal pattern identical to that of wild-type amelogenin.⁽¹⁴⁾

We have used a transgenic approach to express in vivo amelogenin protein engineered to lack critical elements essential to its self-assembly. Using this approach we have altered the physiological function of amelogenin. Our transgenic strategy will also permit other engineered proteins to be introduced into forming enamel using the temporal and spatial specificity of the amelogenin promoter.⁽¹⁴⁾ This genetic approach could be used to study the role of other mineralized tissue specific proteins in the process of biomineralization. As more transgenic animals are created, it will be possible to produce complex changes to enamel phenotypes by the simple breeding of each distinct transgenic line to one other.⁽¹⁴⁾ Here we show that by combining the phenotypes of two transgenic lines, an effective understanding of the role of a protein directed biomineralization can be gained. With an enhanced understanding of the protein structures of mineralized-specific genes and by constraining the function of enamel proteins and their functional domains, it should be possible to gain a more complete understanding of biomineralization. By combining insights obtained from studies on patients with inherited enamel defects with in vitro and in vivo experimental data, we achieve a more complete understanding of the complex protein-crystallite interaction that in turn governs mammalian biomineralization.