Targeting CCNB1 Repressed Cartilage Degradation Induced by Inflammation Through NF-κB Pathway in Osteoarthritis

Abstract

Inflammation contributes to osteoarthritis, and cyclin B1 (CCNB1) dysregulation is implicated. Understanding its role and regulation is crucial for developing targeted therapies against this degenerative disease. Mice chondrocytes were acquired from C57BL/6 wild-type mice and treated with interleukin (IL)-1β for inflammation induction, followed by assays for cell viability, apoptosis, inflammatory mediators, cartilage markers, and nuclear factor kappa B (NF-κB) pathway. CCNB1 was knocked down or upregulated in chondrocytes, respectively. The modified Hulth method was used to establish osteoarthritis model. The knee joint was visualized using micro-computed tomography, and histopathologic evaluation was carried out by immunohistochemistry staining, Safranin O/fast green, and hematoxylin and eosin staining for cartilage degradation markers. CCNB1 knockdown inhibited IL-1β-caused decrease in cell viability and increase in apoptosis of chondrocytes. Inflammatory mediators in IL-1β-treated chondrocytes were decreased after CCNB1 knockdown. CCNB1 knockdown reduced the expression of MMP-13 and ADAMTS-5, while elevated collagen II and aggrecan accumulation, alongside with NF-κB inactivation, in chondrocytes administered with IL-1β. Targeting inhibition of CCNB1 reduced the production of inflammation regulators, decreased cartilage degradation, and blocked NF-κB pathway activation. Targeting CCNB1 may serve as a potential therapeutic strategy for osteoarthritis by reducing inflammation, protecting cartilage, and modulating the NF-κB pathway.

Introduction

Osteoarthritis affected 528 million people, with a much higher prevalence in older people, women, and those with lower socioeconomic status, based on the Global Burden of Disease, Injuries and Risk Factors Study (GBD).^1,2 According to the latest reported data, the global age-standardized prevalence rate in 2019 was 7.5% higher than in 1990. ³ In China, there were 10,681,311 cases of osteoarthritis in 2019, an increase of 132.66% compared with 1990. ³ These conditions lead to serious social problems and significant economic burdens. ⁴ As an intractable chronic degenerative joint damage, osteoarthritis is primarily featured by the advanced degradation of articular cartilage. ⁵ It is most common in weight-bearing and overused joints, including the knees, hand joints, hips, and spine. ⁶ The pathogenesis of osteoarthritis is complex and multi-factorial and is influenced by aging, mechanical stress, inflammation, and metabolic dysfunction, which contribute to disrupting the balance between repairing and destroying tissue. ⁷

Inflammation is one of the inevitable pathogenic mechanisms that leads to osteoarthritis. ⁸ A pivotal factor in osteoarthritis pathogenesis is a cytokine imbalance favoring pro-inflammatory mediators, which creates self-perpetuating cycle that drives damage to cartilage and other intra-articular structures.^9,10 Interleukin (IL)-1β promotes the progression of osteoarthritis through two pathogenic mechanisms: it upregulates cartilage catabolism while suppressing anabolism, which is critical for cartilage homeostasis. ¹¹ In addition to increasing collagen and proteoglycan degradation, IL-1β upregulates the major extracellular proteolytic enzymes involved in cartilage degradation, such as matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase with thrombospondin motif (ADAMTS). ¹² In addition, IL-1β is able to induce several pro-inflammatory mediators, including tumor necrosis factor (TNF)-α and IL-8, which are involved in spreading local inflammation and tissue damage. ¹³

The primary pathological lesions of articular cartilage are featured by extreme apoptosis and necrosis of chondrocytes. ¹⁴ Necrosis and apoptosis are modulated by the cell cycle checkpoint system.^15,16 In malignant tumors, cyclin B1 (CCNB1) plays a crucial effect on cell proliferation and tissue homeostasis as a pivotal regulator of the G2/M stage transition of the cell cycle.^17,18 CCNB1 ensures proper cell division, which ensures tissue homeostasis, repair, and regeneration, by facilitating the transition from G2 to mitosis.^19,20 Apart from its canonical role in cell cycle modulation, CCNB1 participates in other cellular pathological processes, such as apoptosis and inflammation.^21,22 However, dys-regulation of CCNB1 expression has been included in various pathological conditions, for instance, osteoarthritis.^23,24 Understanding the correlation of cartilage health with CCNB1 protein function, and its regulatory principles in pathological conditions, is critical for developing targeted therapeutic strategies to combat this degenerative disease.

Materials and Methods

Cell Isolation

Mice chondrocytes were acquired from the 8-week-old C57BL/6 mice that were purchased from Xingkang Bio. (Jinan China). Mouse cartilage was minced under sterile conditions, followed by 30 min of digestion with trypsin (0.25%) at 37C. Then, cartilage fragments were added with collagenase II solution (0.1%) and digested for 24 h, followed by centrifugation (500 rpm, 5 min) and collection of the supernatant. The supernatant was subjected to centrifugation (1200 rpm, 5 min) to obtain the chondrocytes precipitate. After resuspension, the isolated chondrocytes were cultured in mouse articular chondrocyte complete culture medium (Cat. No. CM-M092; Procell, Wuhan, China).

Transfection

Small-interfering RNAs (siRNAs) were generated by Hippobio (Huzhu, Zhejiang, China) to specifically knock down CCNB1 expression (sense: 5′-AAAUUCUGAACUAGUGUACAG-3′; antisense: 5′-GUACACUAGUUCAGAAUUUGU-3′). Negative control siNC (up: 5′-UUCUCCGAACGUGUCACGUTT-3′; down: 5′-ACGUGACACGUUCGGAGAATT-3′) was also included to account for the specific targeting. For transfection, 50 μl of Opti-MEM medium (Yuchun Biology, Shanghai, China) was mixed with 1.2 μl of Lipofectamine 2000 reagent (Invitrogen) under gentle agitation to form a lipid-RNA complex. The siRNA-lipid complexes were then delivered to each well of a 24-well plate, yielding a final siRNA concentration of 50 nM. The transfection medium was replaced with complete growth medium. Chondrocytes were next cultivated at 37C with 5% CO₂ for 5 h, in a humidified incubator.

Cell Viability

Chondrocytes (5000 cells/well) were seeded in 96-well plates and cultivated in a humidified incubator for 24 h. Next, 10 ng/ml of IL-1β was applied to chondrocytes for graded time periods (24, 48, 72, and 96 h). At designated time points, cell counting kit-8 (CCK-8) reagent (10 μl) (Servicebio, Wuhan, China) was supplemented, followed by incubation with chondrocytes for 4 h at 37C under dark conditions to prevent photodegradation. A microplate reader (Thermo Fisher Scientific, Shanghai, China) was used to detect the optical density at 450 nm.

Apoptosis

Adherent cells were enzymatically dissociated with ethylenediaminetetraacetic acid (EDTA)-free trypsin (BOSTER) until approximately 90% of cells were detached under gentle pipetting. Through centrifugation (500 × g, 5 min), the cell suspension was pelleted, followed by washing in phosphate-buffered saline (PBS) twice. The cellular pellets were re-dissolved in binding buffer (1×) and adjusted to a density of 1 × 106 cell/ml. At room temperature, the cells (1 × 105 cells/100 μl) were stained in 5 μl Annexin V-PE and 5 μl 7-ADD (Meilunebio) for 15 min in the dark. The staining was stopped by 400 μl of binding buffer (1×). Flow cytometer (Agilent Novocyte 3000, Santa Clara, CA) was used for determining apoptosis immediately. CellQuest Pro software (BD Biosciences) was used for data acquisition and analysis.

ELISA

The secretion of TNF-α, IL-18, and IL-6 by chondrocytes was assayed using enzyme-linked immunosorbent assay (ELISA). The examination was performed using the commercial kits (Shanghai Fanke Industrial Co., Ltd.). In short, after 48 h of cultivation with IL-1β, the culture supernatant was collected and centrifuged for 10 min at 1200 × g. After removing the cellular debris, the supernatant was added into the antibody-coated wells and reacted for 1 h at 37C, followed by incubation with the secondary antibody conjugated with horseradish peroxidase (HRP). After addition of 3,3’,5,5’-Tetramethylbenzidine (TMB) substrate solution, the reaction was conducted in the dark to allow colorimetric reaction, which was then terminated with sulfuric acid (2 mol/L, 0.05 ml) after 30 min. The absorbance was assayed in triplicate using a microplate reader at 450 nm.

qRT-PCR

TRIzol reagent (CWBIO, Taizhou, Jiangsu, China) was used for the extraction of total RNA. Then, for cDNA synthesis, 5× Evo M-MLV RT Master Mix was used (Accurate Biology, Changsha, Hunan). For real-time PCR, the procedure was running on ABI 7500 Real-Time PCR system. The reaction system was prepared with SYBR Green Premix Pro Taq HS qPCR kit and the specific primers are shown in Table 1. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control for experimental variability.

Table 1.

Specific Primers Used for qRT-PCR.

Genes	Forward (5′–3′)	Reverse (5′–3′)
CCNB1	GCGTGTGCCTGTGACAGTTA	CCTAGCGTTTTTGCTTCCCTT
ADAMTS-5	CCCAGGATAAAACCAGGCAG	CGGCCAAGGGTTGTAAATGG
Aggrecan	GTGGAGCCGTGTTTCCAAG	AGATGCTGTTGACTCGAACCT
Collagen II	GGGTCACAGAGGTTACCCAG	ACCAGGGGAACCACTCTCAC
COX-2	TTCCAATCCATGTCAAAACCGT	AGTCCGGGTACAGTCACACTT
IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
iNOS	GTTCTCAGCCCAACAATACAAGA	GTGGACGGGTCGATGTCAC
MMP-13	TGTTTGCAGAGCACTACTTGAA	CAGTCACCTCTAAGCCAAAGAAA
TNF-α	CAGGCGGTGCCTATGTCTC	CGATCACCCCGAAGTTCAGTAG
GAPDH	GGTGAAGGTCGGTGTGAACG	CTCGCTCCTGGAAGATGGTG

Western Blot

Radio-Immunoprecipitation Assay Buffer (RIPA) lysis buffer (BOSTER) was used to extract total cellular proteins. Protein supernatants were collected via centrifugation (4C, 12,000 × g, 10 min). Bicinchoninic Acid (BCA) protein assay kit (Beyotime) was used for the quantification of protein concentration. After separation through sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Servicebio), the separated proteins were transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore). At room temperature, the membrane was then sealed with 5% non-fat milk (Servicebio) for 60 min. After reaction with the primary antibodies against Bax (1:20,000; 60267-1-Ig) (Proteintech, Chicago, IL), Bcl-2 (1:10,000; 68103-1-Ig; Proteintech), TNF-α (1:1000; 17590-1-AP), IL-6 (1:1000; 21865-1-AP), MMP-13 (1:3000; 83188-4-RR), NF-κB (1:5000; 10745-1-AP), collagen II (1:2000; 28459-1-AP), p-NF-κB (1:5000; 82335-1-RR), GAPDH (1:50,000; 60004-1-Ig), iNOS (1:2000; A3774) (ABclonal Biotechnology Co., Ltd., Wuhan, China), COX-2 (1:1000; A1253), Aggrecan (1:1000; A8536), and ADAMTS-5 (1:2000; A2836), at 4C overnight, the membrane was washed with Tris-buffered saline with Tween (TBST) (BOSTER) for 15 min, and was reacted with the secondary antibody conjugated with HRP (1:10,000; ZB-2301; ZSGB) for 40 min. After washing, the membrane was placed into the mixture of Enhanced Chemiluminescence Substrate Solution A and B (ECLA and ECLB) (Servicebio) and maintained for 5 min. The residual liquid was discarded before image scanning using Tannon 5,200 system (Tannon Science & Technology). Image J software (NIH) was utilized to analyze optical density of the protein bands.

Animal Model

After acclimation to the laboratory environment, 8-week-old C57BL/6 wild-type mice were housed under Specific pathogen-free (SPF) conditions. Twenty-four mice were assigned into three groups: the sham group, model group, and si-CCNB1 group, n=8 mice/group, at random. Mice in the sham group were performed with sham surgery. Osteoarthritis model was established using the Anterior Cruciate Ligament Transection (ACLT) method. In short, the mice were anesthetized and fixed in a supine position on the surgical table. A longitudinal incision (1 cm in length) was marked on the medial site of the patella and incised layer by layer. The patella was everted to expose the articular surface of the knee joint, facilitating access to the joint cavity. During the procedure, sterile saline was intermittently applied to the knee joint cavity to maintain cartilage surface hydration. The knee was maximally flexed to further expose the joint cavity. The Anterior cruciate ligament (ACL) was identified, elevated with a surgical needle, completely transected under direct visualization, and resected the medial meniscus. Si-CCNB1 mice were injected with small interference RNA targeting CCNB1. With water and food available ad libitum, mice were housed under a 12 h light/dark cycle at 22C and 45–55% relative humidity. The Laboratory Animal Ethical and Welfare Committee of North China University of Science and Technology has reviewed and approved the detailed animal experiment protocols.

Micro-CT

The mice knee joint was scanned using the SkyScan1176 micro-CT device and reconstructed using NRecon v1.6 software (Bruker). The reconstructed micro-CT images were visualized using CTVol v2.0 software and data analysis was performed using CTAn v1.9 software. Evaluation metrics included trabecular number (Tb.N, 1/mm), trabecular separation (Tb.Sp, mm), bone volume fraction (BV/TV, %), and trabecular thickness (Tb.Th, mm).

H&E Staining

The tissues were fixed in 10% formalin overnight at 4C. Following decalcification in 20% EDTA solution (Servicebio), the sections were sequentially incubated in the following reagents: xylene I (15 min), xylene II (15 min), xylene III (15 min), 100% ethanol I (5 min), 100% ethanol II (5 min), 85% ethanol (5 min), and 75% ethanol (5 min), followed by rinsing in distilled water. After paraffin embedding, sagittal sections were cut at a thickness of 4 μm. Following deparaffination, sections were stained with hematoxylin solution for 8 min, washed in running tap water for 10 min, and rinsed in 95% alcohol for 10 dips. Next, the sections were washed in eosin solution for 1 min. After washing in 100% alcohol three times (5 min each time), the tissues were immersed in xylene for 5 min. After covering with neutral balsam, the sections were observed under an Olympus BX43 Microscope (Olympus, Tokyo, Japan).

Safranin O/Fast Green Staining

After hematoxylin staining, the tissue sections underwent differentiation in 1% acid alcohol for 15 sec. Next, the sections were stained with 0.02% aqueous Fast Green (Servicebio) for 3 min, followed by counterstaining with 0.1% Safranin O (Servicebio) for 3 min. After dehydration in a gradient of ethanol solutions, the sections were cleared in xylene. The sections were then mounted on glass slides with neutral balsam. All stained sections were then examined under a microscope.

Immunohistochemical Staining

After tissue dewaxing and rehydration, the joint tissue slices were placed in antigen repair solution (100× citrate buffer) (ab93678; Abcam, Cambridgeshire, UK), followed by heating at 95C for 10 min, medium-low heating for 5 min, and natural cooling to room temperature. At room temperature, endogenous peroxidase’s activity was blocked with 3% H₂O₂ for 15 min and then washed in PBS (pH 7.4) three times (5 min per washing). After sealing in 3% goat serum (AiFang, Changsha, China) for 15 min at room temperature, an appropriate amount of primary antibodies against CCNB1 (1:500; ab181593; Abcam), iNOS (1:20; ab3523; Abcam), MMP-13 (1:2000; ab219620; Abcam), and collagen II (1:200; PA5-99159; Thermo Fisher Scientific) was added onto the sections, followed by incubation in a wet box overnight at 4C. After washing in phosphate buffered saline with Tween-20 (PBST) (3 times, 5 min each time), HRP-labeled goat anti-rabbit antibody (AFIHC003; AiFang) was added and reacted at room temperature for 30 min. The sections were washed in PBST (3 times, 5 min each time) before visualization using 3,3’-Diaminobenzidine (DAB) (20 ×) (AFIHC004; AiFang). The sections were then counterstained with hematoxylin, rinsed with tap water, and incubated in hematoxylin differentiating solution. After reaction with hematoxylin bluing solution, the sections were washed with running water. The sections were successively placed into 75% alcohol (5 min), 85% alcohol (5 min), absolute ethanol I (5 min), absolute ethanol II (5 min), n-butanol (5 min), and xylene I (5 min) for dehydration and clearing. After air-drying, the sections were mounted with neutral balsam. The sections were imaged under a microscope (Olympus). CaseViewer Software (3Dhistech Ltd., Budapest, Hungary) was used for analysis.

Statistical Analysis

Statistical analyses were performed using IBM SPSS Statistics 20.0 software (IBM Corporation, Chicago, IL, USA). For data conforming to a normal distribution, independent samples t-test was applied for comparisons between two groups, whereas one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) post hoc test was used for comparisons involving three or more groups. For non-normally distributed data, the Mann–Whitney U test (two groups) and Kruskal–Wallis H test (three or more groups) were employed instead. All experimental data are presented as the mean ± standard deviation (SD) for normal data or median (interquartile range, IQR) for non-normal data. Data visualization was conducted using GraphPad Prism 8.0 software (GraphPad Software, Inc., San Diego, CA, USA). A p-value < 0.05 was considered statistically significant.

Results

CCNB1 Silencing Decreased Chondrocytes Apoptosis After IL-1β Treatment

To investigate whether silencing CCNB1 gene expression affects the apoptosis of chondrocytes, chondrocytes with low gene expression of CCNB1 were administered with IL-1β. In comparison with the control cells, IL-1β significantly elevated CCNB1 mRNA expression in chondrocytes (p<0.05) (Fig. 1A). After treatment with IL-1β, CCNB1 mRNA was decreased in the si-CCNB1 when compared with the si-NC cells. Next, cell viability was examined 24–96 h after IL-1β treatment. As presented in Fig. 1B, administration with IL-1β apparently reduced the viability of chondrocytes (p<0.05). However, cell viability of si-CCNB1 chondrocytes was increased compared with the si-NC cells 24–96 h after administration with IL-1β (p<0.05). As depicted in Fig. 1C, IL-1β elevated apoptosis of chondrocytes compared with the control cells, while CCNB1 silence restrained apoptosis caused by IL-1β compared with the si-NC cells (p<0.05). Figure 1D suggested that, after administration with IL-1β, Bax protein expression was elevated, compared with the control cells (p<0.05). Bax protein expression in the si-CCNB1 cells was decreased after IL-1β, compared with the si-NC cells. Bcl-2 protein expression was elevated in chondrocytes administered with IL-1β (p<0.05). In the si-CCNB1 cells, Bcl-2 protein expression was elevated in comparison to the si-NC cells after IL-1β treatment (p<0.05). From these results, silencing CCNB1 protected chondrocytes against IL-1β-caused apoptosis.

Figure 1.

Silencing CCNB1 gene expression protected chondrocytes against IL-1β-induced apoptosis. (A) CCNB1 mRNA expression in si-NC or si-CCNB1 transfected chondrocytes after IL-1β treatment. (B) Silencing CCNB1 gene expression elevated cell viability against IL-1β treatment. (C) IL-1β-induced apoptosis of chondrocytes was repressed by CCNB1 gene silence. (D) CCNB1 silence altered apoptosis-associated protein expression (Bcl-2 and Bax). Data are summarized as the mean ± SD. N = 3. **p<0.01, ***p<0.001.

Effects of CCNB1 on Expression Profile of Inflammation Mediators in IL-1β-Treated Chondrocytes

Inflammation markers were assayed to confirm whether CCNB1 is involved in regulating inflammation response caused by IL-1β.

Results showed that compared with the si-NC cells, the transcription level of COX-2 was evidently enhanced in IL-1β-treated chondrocytes, as well as iNOS, IL-6, and TNF-α (p<0.05) (Fig. 2A). As presented in Fig. 2B, IL-1β treatment induced significant accumulations of inflammation factors (p<0.05) (Fig. 2B). Transfection with si-CCNB1 decreased the production of inflammation factors elicited by IL-1β at mRNA levels (p<0.05). Besides, IL-1β promoted protein expression and secretion of IL-6, IL-18, and TNF-α, which were decreased by CCNB1 knockdown compared with the si-NC cells (p<0.001) (Fig. 2C). To investigate whether CCNB1 mediates cartilage degradation caused by IL-1β, the accumulation of aggrecan was examined, as well as the production of aggrecan, collagen II, MMP-13, and ADAMTS-5. As demonstrated in Fig. 2D and E, compared with the untreated group, IL-1β effectively downregulated aggrecan and collagen II, while markedly upregulated ADAMTS-5 and MMP-13 levels (p<0.05). However, in comparison with si-NC cells, CCNB1 silence increased the accumulation of aggrecan and collagen II, while decreased ADAMTS-5 and MMP-13 in IL-1β-treated chondrocytes (p<0.05). Mechanistically, IL-1β promoted the phosphorylation of NF-κB, activating the inflammation pathway, while silencing CCNB1 decreased NF-κB phosphorylation (p<0.05) (Fig. 2F). These results position CCNB1 as a critical mediator bridging inflammatory signaling pathway (NF-κB) and ECM regulation in osteoarthritis.

Figure 2.

CCNB1-mediated alterations in inflammatory mediator expression in chondrocytes after IL-1β administration. (A) mRNA and (B) protein levels of inflammation factors in si-CCNB1 chondrocytes after IL-1β treatment. (C) Cytokine secretion (IL-18, IL-6, and TNF-α) by si-CCNB1 chondrocytes after IL-1β treatment, assayed by ELISA. (D) mRNA and (E) protein levels of aggrecan, collagen II, ADAMTS-5, and MMP-13 in si-CCNB1 chondrocytes after IL-1β treatment. (F) CCNB1 knockdown blocked NF-κB pathway activated by IL-1β. Data are summarized as the mean ± SD. N = 3. *p<0.05, **p<0.01, ***p<0.001.

CCNB1 Knockdown Inactivated NF-κB Pathway Which Is Associated With the Inhibition of Cartilage Degradation

It has been proved that silencing CCNB1 protected chondrocytes against apoptosis induced by IL-1β. To prove cartilage degradation mediated by CCNB1 is associated with inflammation response, chondrocytes were treated with inhibitor to block NF-κB pathway. Notably, CCNB1 overexpression significantly exacerbated IL-1β-elicited cytotoxicity to chondrocytes, which was evidenced by increased apoptosis and decreased cell viability in comparison with wild-type controls treated by IL-1β (p<0.05) (Fig. 3A and B). Besides, CCNB1-overexpressing chondrocytes excreted more IL-6, IL-18, and TNF-α than the control cells after IL-1β treatment (p<0.05) (Fig. 3C). Results of qRT-PCR and Western blot also demonstrated the higher expression of COX-2, IL-6, iNOS, and TNF-α in CCNB1-overexpressing cells than wild-type chondrocytes, after IL-1β treatment (p<0.05) (Fig. 3D and E).

Figure 3.

CCNB1 regulated inflammatory response through NF-κB pathway. (A) CCNB1 overexpression decreased the cell viability of IL-1β-treated chondrocytes via NF-κB pathway; (B) CCNB1 promoted chondrocyte apoptosis induced by IL-1β via NF-κB; (C) CCNB1 induced cytokine secretion (IL-18, IL-6, TNF-α) in chondrocytes treated by IL-1β via NF-κB pathway, assayed by ELISA; (D-E) CCNB1 increased the accumulation of TNF-α, IL-6, iNOS, and COX-2, at mRNA (D) and protein levels (E), in chondrocytes treated by IL-1β via NF-κB pathway; (F) mRNA and (G) protein levels of cartilage degradation markers (Aggrean, Collagen II, MMP-13, ADAMTS-5) were altered by CCNB1 overexpression via NF-κB in IL-1β-treated chondrocytes; (H) Effects of CCNB1 on NF-κB pathway. Data are summarized as the mean ± SD. N = 3. *p<0.05, **p<0.01, ***p<0.001.

In comparison with control cells, CCNB1-overexpressing cells were detected with significant changes in cartilage degradation markers, evidenced by reduced accumulation of aggrecan and collagen II and enhanced accumulation of ADAMTS-5 and MMP-13, following IL-1β stimulation (p<0.05) (Fig. 3F and G). However, NF-κB inhibitor aggravated apoptosis of CCNB1-overexpressing chondrocytes elicited by IL-1β and promoted the secretion of TNF-α, IL-18, and IL-6 (p<0.05). Besides, NF-κB inhibitor decreased COX-2, iNOS, IL-6, and TNF-α, both at mRNA and protein levels, in CCNB1-overexpressing chondrocytes with IL-1β stimulation (p<0.05). As to cartilage degradation markers, NF-κB inhibitor decreased ADAMTS-5 and MMP-13 while maintained aggrecan and collagen II in CCNB1-overexpressing cells following IL-1β treatment (p<0.05). After administration with pathway inhibitor for NF-κB, the activation of NF-κB by IL-1β or CCNB1 overexpression was blocked as evidenced by the inhibition of NF-κB phosphorylation. Hence, CCNB1-mediated cartilage degradation was related to IL-1β-induced inflammation response, which was regulated by NF-κB pathway.

Targeting CCNB1 Relieved Inflammation-Induced Cartilage Degradation in Osteoarthritis

To induce osteoarthritis, the modified Hulth was performed, followed by assessment of whether silencing CCNB1 alleviates inflammation and cartilage degradation. Compared with the sham group, the model mice exhibited significantly increased COX-2, iNOS, IL-6, and TNF-α (p<0.05) (Fig. 4A and B). Silencing CCNB1 decreased inflammation factors (p<0.05). The critical matrix components of articular cartilage, aggrecan and collagen, were downregulated, reflecting structural deterioration following the surgery (p<0.05) (Fig. 4C and D). Currently, the enhancement of proteolytic enzymes, ADAMTS-5 and MMP-13, suggested accelerated cartilage degradation (p<0.05). CCNB1 knockdown increased aggrecan and collagen II, and reduced MMP-13 and ADAMTS-5, to a degree, suggesting that cartilage degradation was significantly inhibited by silencing CCNB1 in osteoarthritis (p<0.05). Phosphorylation of NF-κB was increased, indicating NF-κB pathway was activated in osteoarthritis mice (p<0.05) (Fig. 4E). Silencing CCNB1 reduced the phosphorylation of NF-κB (p<0.05), suggesting that CCNB1 knockdown inactivated NF-κB pathway in osteoarthritis. As a result, silencing CCNB1 inhibited cartilage degradation induced by inflammation through inactivating NF-κB pathway in osteoarthritis.

Figure 4.

Modulatory role of CCNB1 in inflammation response of osteoarthritis established by the modified Hulth method. (A) mRNA and (B) protein levels of COX-2, iNOS, IL-6, and TNF-α in cartilage tissues of osteoarthritis mice with CCNB1 silence; (C) mRNA and (D) protein levels of cartilage degradation markers in cartilage tissues; (E) NF-κB pathway was inactivated after CCNB1 silence. Data are summarized as the mean ± SD. n=8 for each group. *p<0.05, **p<0.01, ***p<0.001.

Histopathologic Evaluation

Osteoarthritis mice displayed irregular cartilage surfaces, disarranged chondrocyte clusters, and damaged cartilage (Fig. 5A). CCNB1 knockdown prominently decreased the destruction of articular cartilage in osteoarthritis. To examine the extracellular matrix in cartilage, the major component proteoglycan was stained by Safranin O/fast green. Figure 5B indicated that the model mice displayed reduced intensity of Safranin O/fast green staining. CCNB1 knockdown partially alleviated proteoglycan loss.

Figure 5.

Pathological morphology of articular cartilage. (A) Visualization of articular cartilage after H&E staining; scale bar (3.0×), 500 μm; scale bar (40.0×), 20 μm. (B) Glycosaminoglycans in articular cartilage stained by safranin O/fast green; scale bar (3.0×), 500 μm; scale bar (20.0×), 50 μm.

Furthermore, IHC staining revealed, when compared with the normal mice, CCNB1 and MMP-13 were not significantly observed in chondrocytes due to the loss of cartilage tissue in osteoarthritis mice. Model mice exhibited increased degradation of collagen-II compared with the sham mice. However, in the CCNB1 knockdown group, cartilage degradation was inhibited, and chondrocytes exhibited increased accumulation of iNOS, MMP-13, and collagen II (Fig. 6). To investigate bone structure in the osteoarthritis model with CCNB1 knockdown, micro-CT was used to three-dimensional imaging followed by analysis of quantitative morphometry indices. The results indicated that bone resorption and osteophyte formation were significantly induced in the Model group (Fig. 7A), as evidenced by the enhancement in Tb.Sp, and decrease in BV/TV, Tb.Th, and Tb.N (Fig. 7B–E). CCNB1 knockdown significantly suppressed bone remodeling in osteoarthritis progression.

Figure 6.

IHC staining presented the accumulation levels of CCNB1, iNOS, MMP-13, and Collagen II. NC, rabbit IgG monoclonal isotype control. n=8 for each group; scale bar (10.0×), 100 μm; scale bar (40.0×), 20 μm.

Figure 7.

Effects of CCNB1 silence on joint bone destruction in osteoarthritis. (A) Mice knee joints were imaged via the reconstructed 3D micro-CT; (B) BV/TV represented the bone volume fraction; Trabecular thickness (C), number (D), and separation (E) were measured in each group. Data are summarized as the mean ± standard deviation. Data are shown as the mean ± SD. n=8 for each group. *p<0.05, **p<0.01, ***p<0.001.

Discussion

Cell cycle regulator CCNB1 has been reported to participate in the chondrocyte damage of Kashin-Beck disease, suggesting its role in mediating cartilage health. ²⁵ In our study, overexpression of CCNB1 induced by IL-1β reduced cell survival and promoted chondrocyte apoptosis, along with the accumulation of inflammatory factors, IL-6, IL-18, TNF-α, and cartilage degradation. The overexpression of CCNB1 induced by IL-1β represents a critical shift in chondrocyte behavior. For the therapy of osteoarthritis, the dual role of CCNB1 in inflammation and tissue damage highlights the possibility of CCNB1 as a therapeutic candidate.

Microarray analysis revealed genes associated with osteoarthritis, and the enriched pathways of dys-regulated genes are predominantly related to the cell cycle. ²⁴ Based on the GSE1919 dataset, we performed bioinformatic analysis and found CCNB1 was significantly downregulated in the osteoarthritis group (logFC = 1.77, p<0.001). However, other evidence reported that CCNB1 was identified as a downregulated gene in IL-1β-treated chondrocytes. ²³ In particular, functional enrichment analysis showed that CCNB1 as a downregulated gene is involved in the mitotic cell cycle process. ²⁴ The inconsistent findings may be attributable to the differences in the enrolled samples. In our study, we excluded rheumatoid arthritis patients and included only osteoarthritis patients. Moreover, our experimental results showed that in IL-1β-treated chondrocytes, CCNB1 was significantly increased compared with the control cells.

Inflammation is a complex biological response to tissue injury, involving the delivery of pro-inflammatory cytokines, activation of immune cells, and the modulation in proliferation and apoptosis. ²⁶ From our results, the upregulation of CCNB1, along with the accumulation of COX-2, iNOS, IL-6, and TNF-α, in chondrocytes treated by IL-1β, highlight the intricate interplay between cell cycle regulation and inflammatory responses in cartilage tissues. CCNB1 is traditionally known for its role in cell cycle progression, but emerging evidence indicates that it may also contribute to the regulation of cellular stress responses and inflammatory signaling pathway. ²⁷ TNF-α, a cytokine predominantly secreted by activated macrophages, elicits a profound impact on mammary epithelial homeostasis by orchestrating the activation of PI3K/Cdk1/cyclin B1 cascade, which illuminates the critical functional significance in preserving cellular activity and function within the mammary gland microenvironment.^28,29 To elucidate the precise mechanisms by which osteoarthritis affects CCNB1 expression, further research is required.

The enhanced expression of inflammation cytokines not only promotes inflammation but also stimulates the generation of matrix degrading enzymes, which contribute to cartilage collapse.^30,31 The upregulation of CCNB1 in this context may amplify the inflammatory response by decreasing the proliferative and survival capacity of chondrocytes, potentially leading to the generation of a more pronounced inflammation environment, featured by the overproduction of cytokines, chemokines, and ROS. What’s more, the apoptosis of chondrocytes may produce an imbalanced ratio of ECM components, favoring the generation of matrix-degrading enzymes, ADAMTS-5 and MMP-13, over structural components like collagen II and aggrecan. This imbalance weakens the cartilage matrix, making it more susceptible to degradation. As a consequence, CCNB1 may be part of a positive feedback loop, where its upregulation promotes inflammation and matrix degradation, which in turn further elevates CCNB1 expression, perpetuating the cycle of tissue damage.

At the center of the interplay between CCNB1 and cartilage breakdown lies the NF-κB signaling cascade. NF-κB activation is intricately linked to the processes described, including the upregulation of matrix-degrading enzymes, increased levels of inflammation cytokines, and dys-regulation of chondrocyte proliferation and survival. IL-1β is regarded as an available activator of the NF-κB pathway, facilitating NF-κB nucleus translocation and thereby inducing TNF-α and IL-6 transcription.^32,33 The elevated expression of CCNB1 may amplify NF-κB activity. On the one hand, the sustained activation of NF-κB results in a pro-inflammatory environment, characterized by the overproduction of cytokines, chemokines, and ROS, which in turn stimulate the production of matrix-degrading enzymes, exacerbating cartilage breakdown. ³⁴ On the other hand, the upregulation of CCNB1 may influence NF-κB-mediated apoptosis of chondrocytes. Chondrocytes loss caused by IL-1β reduces the generation of structural components such as aggrecan and collagen II, while the surviving cells may continue to produce matrix-degrading enzymes, further accelerating cartilage breakdown. ³⁵

IL-1β-induced overexpression of CCNB1 inhibited proliferation and induced apoptosis of chondrocytes. Silencing CCNB1 alleviated cartilage degradation in osteoarthritis through inactivating NF-κB pathway. The findings from this study emphasize the critical effects of CCNB1 in the pathogenesis of osteoarthritis, particularly in regulating chondrocyte proliferation, apoptosis, and cartilage degradation. Future studies are needed to confirm these results in preclinical models and exploiting objective therapies to specifically modulate CCNB1 activity in the context of osteoarthritis.