Skip to main content
Medical Gas Research logoLink to Medical Gas Research
. 2026 Jan 6;16(3):211–220. doi: 10.4103/mgr.MEDGASRES-D-25-00160

Anesthetic gas sevoflurane postconditioning alleviates cognitive impairment induced by hemorrhagic shock and resuscitation

Su Hu 1,#, Xiaoci Huang 2,#, Xiaojing Wan 2, Zhilun Niu 2, Xianwen Hu 2,*
PMCID: PMC12935133  PMID: 41496299

graphic file with name MGR-16-211-g001.jpg

Keywords: anesthetic gas, cerebral ischemia–reperfusion injury, cognitive impairment, hemorrhagic shock and resuscitation, HIF-1α, NLRP3, oxygen–glucose deprivation/reoxygenation, pyroptosis, sevoflurane postconditioning, SIRT1

Abstract

Sevoflurane is a new type of halogen inhalation anesthetic gas with a rapid induction and emergence. It is widely used for general anesthesia. Previous studies have demonstrated that sevoflurane postconditioning alleviates cerebral ischemia–reperfusion injury and enhances the tolerance of the brain to ischemia and hypoxia. However, whether sevoflurane postconditioning can reduce cerebral ischemia–reperfusion injury caused by hemorrhagic shock and resuscitation and the underlying mechanism are unclear. The present study established cerebral ischemia–reperfusion injury models through an in vivo hemorrhagic shock and resuscitation method in C57BL/6 mice and an in vitro oxygen–glucose deprivation/reoxygenation method in HT22 cells. After hemorrhagic shock and resuscitation treatment, the mice developed significant spatial learning and memory impairments accompanied by aggravated cerebral infarction, whereas sevoflurane postconditioning significantly improved these effects. After in vitro oxygen–glucose deprivation/reoxygenation, the survival rate of HT22 cells was decreased, the apoptosis rate was increased, the expression of silent information regulatory factor 1 was decreased, and the expressions of hypoxia-inducible factor 1α, NOD-like receptor protein 3, gasdermin D, caspase-1, and interleukin-1β were increased. Sevoflurane postconditioning inhibited oxygen–glucose deprivation/reoxygenation-induced changes. Following silent information regulatory factor 1 knockdown by small interfering RNA, the cytoprotective effects of sevoflurane postconditioning were significantly attenuated. These findings suggest that the anesthetic gas sevoflurane postconditioning ameliorates hemorrhagic shock and resuscitation-induced cognitive impairment. This may be mediated by the silent information regulatory factor 1/hypoxia-inducible factor 1α/NOD-like receptor protein 3 pathway.

Introduction

Sevoflurane, a new halogen inhalation anesthetic, has been widely used in clinical general anesthesia in recent years because of its advantages, such as fast induction, low solubility, rapid absorption and clearance, rapid recovery, easy adjustment of the depth of anesthesia, and light circulation inhibition, compared with other inhalation anesthetics.1

During resuscitation after hemorrhagic shock, local vascular hyperreactivity (vasospasm) or oxidative stress due to the sudden return of oxygenation of cells after ischemia may occur as blood flow recovers, which can lead to further cell and tissue damage and a more severe form of brain injury caused by blood flow recovery.2,3 The condition is called cerebral ischemia–reperfusion injury (CIRI).4 Brain tissue, especially the hippocampus, is hypersensitive to ischemia and hypoxia and is susceptible to hemorrhagic shock and resuscitation (HSR) damage, which often leads to postoperative cognitive dysfunction.5,6 The administration of sevoflurane either before or after CIRI can directly or indirectly increase brain tolerance to ischemia.7 Since Zhang et al.8 reported that sevoflurane postconditioning (SPC) has a protective effect on the brains of rats after CIRI, relevant studies in recent years have focused mainly on how SPC reduces mitochondrial oxidative stress and endoplasmic reticulum stress and improves autophagy.9,10,11 However, how SPC regulates the ability of hippocampal neurons to alleviate learning and memory impairments caused by CIRI is unknown.

Silent information regulatory factor 1 (SIRT1), a niacinamide adenine dinucleotide-dependent histone deacetylase, is a member of SIRT family. After CIRI, increased expression of SIRT1 can reduce cerebral infarction size, alleviate neuronal degeneration, and improve cognitive function.12 Many studies have demonstrated that SIRT1 plays a critical role in ischemic brain injury.13,14,15 SIRT1 can deacetylate acetyllysine in histone and nonhistone substrates, such as P53 and forkhead box O.16 SIRT1 regulates various biological activities, such as glucose and lipid metabolism, the inflammatory response, cell aging and apoptosis, oxidative stress, and tumor formation, which can alleviate brain injury after stroke.17

The hypoxia-inducible factor (HIF) family is a member of the basic helix loop helix period/aryl hydrocarbon receptor nuclear translocator/single-minded transcription factor superfamily. To date, three family members have been identified: HIF-1, HIF-2, and HIF-3, which are composed of α and β subunits with transcriptional activity.18 The expression of these genes is regulated by oxygen abundance and is barely expressed under normal oxygen conditions. However, their expression is significantly upregulated under hypoxic stress.19,20 A previous study has shown that posttreatment with sevoflurane can improve myocardial mitochondrial respiratory function by upregulating HIF-1α, thus alleviating myocardial ischemia–reperfusion injury.21

Studies have shown that CIRI is a complex pathological process involving an inflammatory cascade, and the NOD-like receptor protein 3 (NLRP3) inflammasome is the primary mediator of the inflammatory response to ischemic brain injury.22,23 The upregulation of the NLRP3 inflammasome can activate pro-cysteine-aspartate specific cysteine protease-1 and further promote the maturation of the inflammatory cytokines, such as interleukin-1β (IL-1β) and interleukin-18 (IL-18).24 Another result of cysteine-aspartate specific cysteine protease-1 (caspase-1) activation is pyroptosis, a typical inflammation-dependent programmed cell death that plays a key role in CIRI.25 Inhibition of the expression of the NLRP3 inflammasome may improve the prognosis after ischemic brain injury. Studies have shown that HIF-1α is closely related to promoting pyroptosis. For example, HIF-1α small interfering RNA (siRNA) improved pyroptosis in fibroblast-like synoviocytes mediated by the NLRP3 inflammasome.26

While above studies have indicated that SIRT1, HIF-1α and NLRP3 were critically involved in the pathogenesis of ischemia–reperfusion injury, the role of the SIRT1/HIF-1α/NLRP3 signaling in SPC and its potential to alleviate CIRI caused by HSR has not been clearly illustrated. Therefore, we established an oxygen–glucose deprivation/reoxygenation (OGD/R) model of mouse hippocampal neurons and a HSR model in mice to simulate CIRI in vitro and in vivo, observed the protective effects of SPC on hippocampal cells, and explored whether the protective effect was related to the activation of SIRT1/HIF-1α/NLRP3 signaling.

Methods

Animals

Healthy male C57BL/6 mice (specific pathogen free grade, 8–10 weeks old, weighing 25–30 g) were purchased from the Animal Experiment Center of Anhui Medical University (animal license No. SYXK (Wan) 2017-006). To minimize the confounding effects of hormonal fluctuations associated with the estrous cycle in females, only male mice were employed in the present study. The mice were raised in the specific pathogen free animal room of Anhui Medical University under a standard 12-hour light/dark cycle at a controlled temperature (22 ± 2°C) and humidity (50 ± 10%) with free access to food and water. Before the experiment, the mice were allowed a 1-week acclimatization period. All experimental protocols complied with the principles of laboratory animal welfare and were approved by the Experimental Animal Ethics Committee (approval No. LLSC20241947) on July 20, 2024. The mice were randomly assigned into three groups: Sham, HSR and SPC groups (Figure 1).

Figure 1.

Figure 1

Experimental flowchart.

HSR: Hemorrhagic shock and resuscitation; OGD/R: oxygen–glucose deprivation/reoxygenation; SPC: sevoflurane postconditioning.

Hemorrhagic shock and resuscitation and sevoflurane postconditioning

The mice were fasted for 12 hours with free access to water before surgery. Each mouse was anesthetized with pentobarbital sodium (50 mg/kg; Sigma–Aldrich (Shanghai) Trading Co. Ltd., Shanghai, China) via intraperitoneal injection. In the HSR group, hemorrhagic shock was induced by withdrawing 40% of the total blood volume (7% of body weight through a two-way automatic infusion pump (Kent Scientific Corporation, Torrington, CT, USA)).27 Blood withdrawal was performed steadily over 30 minutes via the right carotid artery, followed by a 60-minute shock maintenance period. The withdrawn blood was subsequently reinfused via the left jugular vein over 30 minutes. In the Sham group, the right carotid artery and left jugular vein of the mice were catheterized without blood withdrawal or reinfusion. In the SPC group, the mice were exposed to sevoflurane (AbbVie, Chicago, IL, USA) after the hemorrhagic shock model was established. Sevoflurane was delivered into a glass chamber (30 cm × 20 cm × 20 cm) via a gas mixture (70% O2 + 30% CO2). The sevoflurane vaporizer (Abbott, Chicago, IL, USA) was adjusted to maintain an end-tidal sevoflurane concentration of 2.4%. Sevoflurane inhalation began immediately at the start of blood reinfusion and lasted for 30 minutes.28

Hemodynamics and arterial lactate monitoring

During the HSR, the catheter of the right carotid artery was connected with a pressure transducer (AD Instruments, Dunedin, New Zealand) to monitor the mean arterial pressure at a 10-minute interval. The heart rate was similarly monitored and recorded. Before bleeding (baseline), 30, 90, and 120 minutes later, the arterial lactate in the blood from right carotid artery were measured.

Behavioral test

Novel object recognition test

The novel object recognition test was conducted 10–14 days after HSR surgery. The experiment consisted of three phases: habituation, training, and testing, with 24-hour intervals between each phase. To minimize stress responses, the mice were placed in the testing room to acclimate to the environmental changes 30 minutes before each phase. During the habituation phase, the mice were placed in a grey experimental chamber for 5 minutes and were allowed to explore freely. In the training phase, two identical objects were placed in adjacent corners of the chamber. The mice were introduced from a fixed entry point and allowed to explore for 5 minutes. During the testing phase, one of the familiar objects was replaced with a novel object (differing in shape and color). The mice were again placed into the chamber from the same entry point and allowed to explore for 5 minutes.29 The exploration times for both the familiar object (tO) and the novel object (tN) were recorded using the Panlab Smart 3.0 tracking system (Panlab, Barcelona, Spain), with the recognition index (%) calculated as tN/(tN + tO) × 100.

Elevated plus maze test

The elevated plus maze test was conducted on the 14th day after HSR surgery to evaluate changes in anxiety-related behaviors in the mice.30 The apparatus consisted of open and closed arms (5 cm wide, 35 cm long), with the closed arms having a height of approximately 15 cm, and the elevated plus maze was approximately 40–55 cm above the ground. The mice were allowed to move freely for 10 minutes in the elevated plus maze (RWD Life Science, Shenzhen, China), and their movement was monitored using the Panlab Smart 3.0 tracking system. The distance travelled and time spent in the open/closed arms were recorded and analyzed.

Barnes maze test

The experiment was conducted 10–14 days after HSR surgery. On day 1 of the test, the mice were placed at the center of the platform, covered with an opaque box for 3 minutes, and then transferred to the escape box for 3 minutes to become familiar with the environment. On days 2–4, the mice were placed at the platform center and covered with the box for 15 seconds, after which the box was removed to observe whether the mice could locate the escape box. If a mouse failed to find the escape box within 4 minutes, it was reintroduced to the box for 30 seconds. On day 5, the mice were placed directly at the platform center without restriction of the box, and the time taken to locate the escape box was recorded.31 The Panlab Smart 3.0 monitoring system was used to observe and record the movement of the mice. The time to find the escape box and the movement trajectories were exported after the experiment.

Infarct volume assessment

After the behavioral tests, the mice were anesthetized by pentobarbital sodium (50 mg/kg) and then euthanized through cervical dislocation. Their whole brains were rapidly frozen at −20°C for 20 minutes. Then, 1-mm-thick coronal slices were serially sectioned and incubated in 2% 2,3,5-triphenyltetrazolium chloride (Sigma–Aldrich) at 37°C for 30 minutes. Subsequently, the brain slices were fixed in 4% paraformaldehyde for 24 hours and digitally scanned into a computer using ImageJ software (version 1.53k; National Institutes of Health, Bethesda, MD, USA) for analysis32: infarction volume (%) = (infarction area × 1 mm)/(total brain area × 1 mm) × 100.

Oxygen–glucose deprivation/reoxygenation and sevoflurane postconditioning

The mouse hippocampal neuronal cell line (HT22; Procell, Wuhan, China, #CL-0697; RRID: CVCL_0321) was cultured in high-glucose Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum at 37°C with 5% CO2. The original medium was discarded, and the cells were incubated with glucose-free and serum-free Dulbecco’s modified Eagle’s medium to simulate ischemia. The culture dish was then placed in a hypoxia chamber filled with 95% N2 + 5% CO2 to mimic hypoxia for further cultivation for 4 hours.27,33 Afterwards, the medium was replaced with ordinary high-glucose Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum. For the OGD/R group, the cells were returned to the incubator for further culture for 24 hours. For the SPC group, the hypoxia chamber was placed in a cell incubator at 37°C with 5% CO2, and 2% sevoflurane was introduced into the hypoxia chamber during the first hour of reoxygenation.33 Finally, the cells were returned to the incubator for 23 hours of cultivation (Figure 1). Different concentrations (1%, 2%, and 3%) of sevoflurane were applied in the SPC group to determine which concentration of sevoflurane had the most protective impact on cell viability.

Cell viability detection

Cells in the logarithmic growth phase were seeded in a 96-well culture plate at a density of 5000 cells per well (100 µL/well), with six replicate wells for each group. Four wells were randomly selected for each group, 10 µL of methylthiazolyldiphenyl-tetrazolium bromide solution (5 g/L; BeyoTime Biotechnology, Shanghai, China) was added to each well after treatment, and the plate was incubated at 37 °C in a 5% CO2 incubator for an additional 4 hours. Then, 100 µL of dimethyl sulfoxide was added, and the plate was shaken at room temperature for 10 minutes. The optical density at a wavelength of 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). The cell viability was reflected by the ratio of the optical density of each group to the optical density of the control group.

Apoptosis detection

Cells in the logarithmic growth phase were seeded on climbing slides and subjected to the corresponding treatments. Four wells of cells from each group were randomly selected for TdT-mediated dUTP nick-end labeling (TUNEL) staining. The climbing slides were fixed with 4% paraformaldehyde for 30 minutes and then incubated with phosphate-buffered saline containing 0.3% Triton X-100 at room temperature for 5 minutes. Afterwards, each slide was incubated with 50 μL of TUNEL reagent (BeyoTime Biotechnology) at 37°C in the dark for 60 minutes. Finally, the cells were mounted with antifade mounting medium containing 4′,6-diamidino-2-phenylindole and observed under a fluorescence microscope (Carl Zeiss LSM 880, Jena, Germany).

Quantitative polymerase chain reaction

Total RNA was extracted from HT22 cells using an RNA extraction kit (Takara, Kusatsu, Japan). In accordance with the instructions of the complementary DNA reverse transcription kit (Vazyme, Nanjing, China), the reaction system was prepared and incubated at 37°C for 15 minutes, followed by heating at 85°C for 5 seconds to synthesize complementary DNA. The reaction mixture for quantitative polymerase chain reaction (qPCR) was subsequently prepared following the SYBR qPCR Master Mix reagent (Vazyme) protocol. The amplification conditions were as follows: pre-denaturation at 95°C for 30 seconds (1 cycle) and 40 cycles of denaturation at 95°C for 10 seconds and annealing/extension at 60°C for 30 seconds. Glyceraldehyde-3-phosphate dehydrogenase was used as the internal reference, and the relative mRNA expression levels were analyzed using the StepOne™ Software (version 2.3, Applied Biosystems, Carlsbad, CA, USA) based on the melting curve. The specific primer sequences utilized in the qPCR reactions are detailed in Table 1.

Table 1.

Primers in quantitative polymerase chain reaction

Gene Primer sequence (5ʹ→3ʹ)
SIRT1 F: GTTCTGACTGGAGCTGGGGT
R: ATGGCTTGAGGATCTGGGAG
HIF-1α F: CATCCATGTGACCATGAGGAAA
R: AATATGGCCCGTGCAGTGAAG
NLRP3 F: CCAGGTTCAGTGTGTTTCC
R: CGGTTGGTGCTTAGACTTGA
GSDMD F: TGTCAACCTGTCAATCAAGGA
R: AGCCAAAACACTCCGGTTC
Caspase-1 F: TGGTCTTGTGACTTGGAGGAC
R: AGAAACGTTTTGTCAGGGTCA
IL-1β F: GCCCATCCTCTGTGACTCAT
R: AGGCCACAGGTATTTTGTCG
GAPDH F: CCTCGTCCCGTAGACAAAATG
R: TGAGGTCAATGAAGGGGTCGT

caspase-1: Cysteine-aspartate specific cysteine protease-1; F: forward primer; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GSDMD: gasdermin D; HIF-1α: hypoxia-inducible factor 1β; IL-1β: interleukin-1β; NLRP3: NOD-like receptor protein 3; R: reverse primer; SIRT1: silent information regulatory factor 1.

Western blot assay

Total protein was extracted from HT22 cells via lysis with radioimmunoprecipitation assay buffer (BeyoTime Biotechnology). Protein quantification was performed using a bicinchoninic acid protein assay kit (BeyoTime Biotechnology). The proteins were separated by 10% or 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to polyvinylidene fluoride membranes (Merck, Darmstadt, Germany). The membranes were blocked with 5% skim milk for 2 hours and incubated with specific primary antibodies, including mouse anti-SIRT1 (1:1000, CST, Boston, MA, USA, Cat# 8469, RRID:AB_10999470), rabbit anti-HIF-1α (1:1000, absin, Shanghai, China, Cat# 120168, RRID:AB_3676379), rabbit anti-NLRP3 (1:1000, Affinity, Changzhou, China, Cat# DF7438, RRID:AB_2839376), rabbit anti-gasdermin D (GSDMD; 1:1000, Affinity, Cat# AF4012, RRID:AB_2846776), rabbit anti-Caspase-1 (1:1000, Affinity, Cat# AF5418, RRID:AB_2837902), mouse anti-IL-1β (1:1000, Affinity, Cat# BF8021, RRID:AB_3713524), and mouse anti-GAPDH (1:10,000, Proteintech, Wuhan, China, Cat# 60004-1-Ig, RRID:AB_2107436), overnight at 4°C. After incubation with the corresponding secondary antibodies: goat anti-rabbit IgG (H + L) (1:10,000, Thermo Fisher Scientific, Cat# 31460, RRID:AB_228341) and goat anti-mouse IgG (H + L) (1:10,000, Thermo Fisher Scientific, Cat# 31430, RRID:AB_228307) at 25°C for 1 hour with gentle shaking, the immunoreactive bands were visualized via chemiluminescence in Tanon full-automatic imaging system (Tanon, Shanghai, China). The grey intensities of the bands were quantified using ImageJ software.

Cell transfection

To inhibit SIRT1 expression, siRNA transfection was performed 24 hours before OGD/R with or without SPC. siRNAs targeting SIRT1 (si-SIRT1) and its negative control were obtained from GenePharma (Shanghai, China). HT22 cells were inoculated at a density of 5 × 104 cells/mL in a 6-well plate (2 mL/well), and transfection was performed when the cell confluence reached 50%. The transfection complexes were prepared by dissolving 5 μL of siRNA in 200 μL of buffer and adding 4 μL of jetPRIME transfection reagent (Polyplus-Transfection, Strasbourg, France). After the mixture was incubated at room temperature for 10 minutes, 2 mL of fresh medium was added for further incubation. At 24 hours posttransfection, the cells were processed according to the cell experiment method mentioned above. The siRNA sequence for mouse SIRT1 was 5’-GCA CUA AUU CCA AGU UCU ATT-3’, and the negative control sequence was 5’-UUC UCC GAA CGU GUC ACG UTT-3’.

Statistical analysis

A priori power analysis was conducted using G*Power (https://www.psychologie.hhu.de/arbeitsgruppen/allgemeine-psychologie-und-arbeitspsychologie/gpower)34 to determine sample sizes, based on an expected mean difference effect size, to achieve 80% power at a significance level of α = 0.05. No animals died accidentally during the experiment. All the statistical analyses were conducted using SPSS software (version 26.0, IBM, Armonk, NY, USA) and were performed by two authors who were blinded to grouping. The normality of continuous variables was examined by the Shapiro–Wilk test. Data with a normal distribution are presented as the mean ± standard deviation (SD). Multiple comparisons of more than two groups were analyzed by one-way analysis of variance followed by the Tukey post hoc test. Hemodynamics and arterial lactate at different time points were analyzed by repeated measures of variance followed by Bonferroni post hoc analysis. P < 0.05 was considered statistically significant.

Results

Anesthetic gas sevoflurane postconditioning does affect the hemodynamics and arterial lactate in mice with hemorrhagic shock and resuscitation

To determine whether SPC affects the hemodynamics and arterial lactate in mice with HSR, we monitored the mean arterial pressure, heart rate and arterial lactate. All monitoring outcomes at baseline had no statistical difference among all groups (P > 0.05; Figure 2). Compared with the baseline, the hemodynamics and arterial lactate in the sham group were not significantly changed during the entire experimental period (P > 0.05; Figure 2). The mean arterial pressure and heart rate values of the HSR and SPC groups were significantly decreased compared with the baseline values, starting from the first 10 minutes following bleeding till the first 10 minutes following reperfusion (P < 0.05; Figure 2A and B). There were no significant differences of hemodynamics between HSR and SPC groups during the phase of hemorrhagic shock (P > 0.05; Figure 2A and B). Similarly, the lactate levels of the HSR and SPC groups were significantly decreased at 30 and 90 minutes compared with the baseline (P < 0.05; Figure 2C).

Figure 2.

Figure 2

SPC does affect the hemodynamics and arterial lactate in mice with HSR.

(A) Mean arterial pressure during the HSR period. (B) Heart rate during the HSR period. (C) Lactate levels during the HSR period. The data are expressed as the mean ± SD (n = 8 per group). *P < 0.05, ***P < 0.001, ****P < 0.0001, vs. baseline (repeated measures of variance followed by Bonferroni post hoc analysis). HSR: Hemorrhagic shock and resuscitation; SPC: sevoflurane postconditioning.

Anesthetic gas sevoflurane postconditioning ameliorates the cognitive impairment and anxiety induced by hemorrhagic shock and resuscitation

To determine whether SPC ameliorates the cognitive impairment and anxiety in mice induced by HSR, we performed TTC staining on the brains of mice and conducted behavioral tests on them. On postoperative day 14, the HSR group presented a significantly greater infarct volume than the Sham group did (P < 0.05). SPC significantly reduced the infarct volume compared with that in the HSR group (P < 0.05; Figure 3A and B).

Figure 3.

Figure 3

SPC improves the cognitive impairments induced by HSR.

(A) Representative images of cerebral 2,3,5-triphenyltetrazolium chloride staining. The white regions represent the infarct area, whereas the red regions represent the non-infarct area. The HSR group showed a significant increase in infarct area compared with the sham and SPC groups. (B) The infarct volume after HSR without or with SPC. (C, D) In the novel object recognition test, a representative exploration route for two different objects and the discrimination index were recorded. The top one is the novel object and the bottom one is the familiar object. (E, F) In the elevated plus maze test, representative moving tracks in both the open and closed arms were traced, and the entry frequency and duration in the open arms were calculated. (G, H) In the Barnes maze test, representative movement trajectories, the time to identify the target box, and the number of errors were exported. The data in B (n = 6 per group), D, F, and H (n = 8 per group) are expressed as the mean ± SD. *P < 0.05, ***P < 0.001, ****P < 0.0001 (one-way analysis of variance followed by Tukey post hoc test). HSR: Hemorrhagic shock and resuscitation; SPC: sevoflurane postconditioning.

Compared with that of the Sham group, the recognition index of the HSR group indicated a reduction in the exploration of different objects (P < 0.05). SPC treatment increased the recognition index compared with that of the HSR group, suggesting that SPC enhanced the ability of the mice to discriminate between objects (P < 0.05; Figure 3C and D).

The mice exhibited reduced activity and increased anxiety-like behaviors, characterized by significantly fewer entries and less residence in the open arms after HSR (P < 0.05). Compared with the HSR group, the SPC group showed substantially more free movement in the open arms, with increased entries into and time spent in the open arms, indicating that SPC alleviated anxiety (P < 0.05; Figure 3E and F).

Compared with the sham group, the HSR group presented increased time to locate the escape box and a greater number of errors before finding it, indicating a significant decline in spatial memory ability (P < 0.05). Compared with the HSR group, the SPC group spent significantly less time locating the escape box and exhibited fewer errors before finding it, demonstrating that SPC improved the spatial memory ability of the mice after HSR (P < 0.05; Figure 3G and H).

Anesthetic gas sevoflurane postconditioning alleviates oxygen–glucose deprivation/reoxygenation-induced cell injury

To determine whether SPC alleviates OGD/R-induced cell injury, we evaluated cell viability, detected cell apoptosis, and measured the expression of related genes and proteins in HT22 cells. Compared with that in the control group, the cell viability in the OGD/R group was significantly lower, indicating that OGD/R caused cell injury (P < 0.05). Compared with that of the OGD/R group, the viability of the HT22 cells postexposure to different concentrations of sevoflurane (1%, 2%, and 3%) increased, with 2% SPC resulting in the most significant improvement in cell survival (P < 0.05; Figure 4A). Therefore, the 2% sevoflurane was applied in all subsequent cell experiments.

Figure 4.

Figure 4

SPC alleviates OGD/R-induced cell injury.

(A) During OGD/R, SPC increased the viability of HT22 cells treated with different concentrations of sevoflurane (1%, 2%, and 3%). (B, C) Images of TUNEL staining and quantitative analysis. The percentage of apoptotic cells (arrows) was significantly higher in the OGD/R group than those in the control and SPC groups. Scale bars: 50 μm. (D) The relative mRNA expression levels were analyzed after OGD/R with SPC. (E, F) The levels of related proteins in HT22 cells were detected after OGD/R with SPC. The data in A, C (n = 6 per group), D, and F (n = 4 per group) are expressed as the mean ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (one-way analysis of variance followed by Tukey post hoc test). caspase-1: Cysteine-aspartate specific cysteine protease-1; DAPI: 4’,6-diamidino-2-phenylindole; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GSDMD: gasdermin D; HIF-1α: hypoxia-inducible factor 1α; IL-1β: interleukin-1β; NLRP3: NOD-like receptor protein 3; OGD/R: oxygen–glucose deprivation/reoxygenation; Sevo: sevoflurane; SIRT1: silent information regulatory factor 1; SPC: sevoflurane postconditioning; TUNEL: TdT-mediated dUTP nick-end labeling.

The number of TUNEL-positive cells in the OGD/R group was greater than that in the Control group, indicating that OGD/R induced apoptosis in HT22 cells (P < 0.05). Compared with the OGD/R group, the SPC group presented a significant decrease in TUNEL-positive cells, suggesting that SPC could mitigate OGD/R-induced apoptosis (P < 0.05; Figure 4B and C).

Compared with those in the Control group, the OGD/R group presented decreased mRNA expression of SIRT1 but increased expression of HIF-1α, NLRP3, GSDMD, caspase-1, and IL-1β (P < 0.05). In contrast, compared with the OGD/R group, the SPC group presented increased SIRT1 mRNA expression and decreased HIF-1α, NLRP3, GSDMD, caspase-1, and IL-1β expression (P < 0.05; Figure 4D).

The expression of related proteins detected by western blot is shown in Figure 4E and F. The trends in protein expression were consistent with gene results.

Inhibiting the expression of SIRT1 attenuates the protective effect of sevoflurane postconditioning against oxygen–glucose deprivation/reoxygenation-induced cell injury

To determine whether inhibiting the expression of SIRT1 attenuates the protective effect of SPC against OGD/R-induced cell injury, we performed siRNA transfection to knock down the expression of SIRT1. Compared with that of the Control group, the survival rate of the HT22 cells subjected to OGD/R significantly decreased, indicating that OGD/R caused cell damage (P < 0.05). Compared with that in the OGD/R group, cell viability in the SPC group significantly increased, suggesting that sevoflurane may have a cytoprotective effect (P < 0.05). Furthermore, compared with the SPC group, SIRT1 knockdown led to decreased cell viability, indicating that inhibiting SIRT1 expression attenuated the cytoprotective effect of sevoflurane (P < 0.05; Figure 5A).

Figure 5.

Figure 5

SIRT1 silencing reverses the effect of SPC on OGD/R-induced cell injury.

(A) Inhibiting the expression of SIRT1 attenuated the protective effect of SPC against the OGD/R-induced decrease in cell viability. (B, C) Images of TUNEL staining and quantitative analysis. The percentage of apoptotic cells (arrows) was significantly higher in the OGD/R group than in the control and SPC groups. Scale bars: 50 μm. The si-SIRT1 group showed significantly higher percentage of apoptotic cells than the SPC group. (D) The relative mRNA expression levels were analyzed after SPC with si-SIRT1 treatment. (E, F) The levels of related proteins in HT22 cells were detected after SPC with si-SIRT1 treatment. The nonsense sequence for SIRT1 was the negative control (NC). The data in A, C (n = 6 per group), D, and F (n = 4 per group) are expressed as the means ± SD. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 (one-way analysis of variance followed by Tukey post hoc test). caspase-1: Cysteine-aspartate specific cysteine protease-1; DAPI: 4’,6-diamidino-2-phenylindole; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GSDMD: gasdermin D; HIF-1α: hypoxia-inducible factor 1α; IL-1β: interleukin-1β; NC: negative control; NLRP3: NOD-like receptor protein 3; OGD/R: oxygen–glucose deprivation/reoxygenation; SIRT1: silent information regulatory factor 1; si-SIRT1: siRNAs targeting SIRT1; SPC: sevoflurane postconditioning; TUNEL: TdT-mediated dUTP nick-end labeling.

The antiapoptotic effect of SPC was weakened after SIRT1 expression was knocked down (P < 0.05; Figure 5B and C).

The ability of SPC to promote SIRT1 expression and its inhibitory effects on HIF-1α, NLRP3, GSDMD, caspase-1, and IL-1β were diminished after SIRT1 knockdown (P < 0.05; Figure 5D). These findings suggest that sevoflurane may exert its cytoprotective effect by promoting SIRT1 expression.

The protein expression levels detected by western blotting were consistent with the gene results (P < 0.05; Figure 5E and F).

Discussion

Our findings suggest that SPC attenuates HSR-induced cognitive impairment. This protective effect may be associated with activation of the SIRT1/HIF-1α/NLRP3 signaling pathway and suppression of the expression of the protein caspase-1, GSDMD, and IL-1β (Figure 6).

Figure 6.

Figure 6

Mechanism of sevoflurane postconditioning on cytoprotection for HSR.

Created with Adobe Illustrator 2023 (Adobe, San Jose, CA, USA). caspase-1: Cysteine-aspartate specific cysteine protease-1; GSDMD: gasdermin D; HIF-1α: hypoxia-inducible factor 1α; IL-1β: interleukin-1β; NLRP3: NOD-like receptor protein 3; SIRT1: silent information regulatory factor 1.

Cerebral ischemia results mainly from blockage of the arteries supplying blood. Thrombolysis and restoration of the tissue blood supply led to reperfusion injury, resulting in a sharp increase in the generation of reactive oxygen species, aggravating neuronal damage and neuronal death or apoptosis.35,36,37 There is an urgent need to find a practical and feasible method to alleviate CIRI. Our previous research group revealed that SPC improved spatial learning and memory disorders in rats with HSR injury by inhibiting cell apoptosis.38 In vitro experiments also confirmed that SPC could reduce DNA oxidative damage and apoptosis in HT22 cells after OGD/R, increasing SIRT1 protein expression.33 However, a previous study only revealed changes in SIRT1, and the specific mechanism of SPC related to the SIRT1 signaling pathway has not been studied. The present study revealed the protective effect of SPC and its mechanism in acute brain injury.

The characteristics of mouse hippocampal cells make them an ideal tool for studying neuronal development, the mechanism of nerve signal transmission, the processes of learning and memory, and related neurodegenerative diseases.27 In the present study, HT22 cells were used as in vitro research objects, and an OGD/R model was established to simulate ischemia–reperfusion injury in brain tissue. Under OGD/R conditions, HT22 cells exhibited significant changes, including cell body shrinkage and synapse rupture. The survival ability of the cells decreased while the proportion of apoptotic cells increased. However, the survival ability of HT22 cells improved after sevoflurane treatment. The number of apoptotic cells decreased, indicating that SPC protects against OGD/R injury to hippocampal cells.

SIRT1 regulates various biological activities, such as glucose and lipid metabolism, the inflammatory response, cell senescence and apoptosis, oxidative stress, and tumorigenesis. Especially, SIRT1 has a protective effect on brain damage after stroke.39,40,41 The present study revealed that SIRT1 expression in HT22 cells after OGD/R was downregulated. Moreover, SIRT1 expression was upregulated after SPC, which verified that SIRT1 participated in the protective effect of SPC on HT22 cell injury induced by OGD/R. It has been reported that CIRI can promote the inflammatory response and oxidative stress in the brain and the whole body, further destroying the structure and function of brain tissue and aggravating damage to brain tissue.22

As an essential transcription factor, HIF regulation involves hundreds of genes involved in different biological processes, mainly angiogenesis, vascular remodeling, erythropoiesis, glycolysis, cell proliferation, apoptosis, and aging.18 A previous study has found that modulating the SIRT1/HIF-1α pathway could alleviate hypoxia-induced cognitive impairment in offspring mice.42 Moreover, the inactivation of the HIF-1α subunit has been shown to promote learning disabilities, reduce neurogenesis, increase damage, and decrease the survival rate after cerebral ischemia; HIF-1α is also involved in cell regeneration, increasing its adaptation to ischemia and hypoxia; HIF-1α has neuroprotective effects by regulating vascular endothelial growth factor; and HIF-1α enhances erythropoiesis to increase transport and cerebral blood flow and protect cells from hypoxic damage by regulating the expression of erythropoietin.43

The NLRP3 inflammasome is a large molecular complex assembled from various proteins closely related to immunity and the inflammatory response and is widely involved in central nervous system diseases.22 The NLRP3 inflammasome is mainly composed of NLRP3, apoptotic speck-like protein, and caspase-1.44,45 After receiving specific stimulation signals, such as metabolic disorders, loss of ion balance, production of reactive oxygen species, or infection by exogenous pathogens, NLRP3 begins to aggregate and recruit precursor caspase-1 through apoptotic speck-like protein. Once the precursor caspase-1 is activated, it is cleaved into functional caspase-1, which further catalyzes the cleavage of precursor IL-1β and IL-18, generates active IL-1β and IL-18, is secreted outside the cell to promote the production of other inflammatory cytokines, recruits immune cells, and increases the permeability of the blood–brain barrier to amplify the inflammatory response.24 The activation of the NLRP3 inflammasome not only leads to the release of inflammatory factors but is also associated with cell death types such as pyroptosis.46 Cai et al.47 have revealed that inhibition of Toll-like receptor 4/nuclear factor-κB/NLRP3 signaling in microglia could alleviate CIRI. To further elucidate the specific mechanism by which the SIRT1/HIF-1α/NLRP3 pathway protects against brain injury caused by SPC, the present study detected the expression of SIRT1, HIF-1α, and the NLRP3 inflammasome and related inflammatory factor proteins and mRNAs in HT2 cells. OGD/R increased the expression of HIF-1α, NLRP3, GSDMD, caspase-1, and IL-1β, indicating that OGD/R significantly promoted the inflammatory response of cells, whereas SPC inhibited this inflammation.

The siRNA fragments presented high sequence identity and complementary pairing with the same sequence of mRNA. When siRNA binds to a target mRNA, it guides the RNA-induced silencing complex to the corresponding mRNA, thereby mediating posttranscriptional gene silencing; that is, it blocks the process of specific gene information being translated into proteins from the mRNA.48 Because the mRNA is specifically degraded, the corresponding gene expression is also suppressed. After SIRT1 was silenced via siRNA transfection, the expression levels of HIF-1α, the NLRP3 inflammasome, and related inflammatory factors increased due to the downregulation of SIRT1. This suggests that after the protective factor SIRT1, which is conducive to neuronal survival, is silenced, the NLRP3 inflammasome, which exacerbates damage to brain tissue, is activated. A series of cascade inflammatory reactions is initiated, destroying the protective effect of SPC on hippocampal neurons.

Some previous studies have expounded on the mechanism of the brain-protective effect of SPC, such as via the phosphatidylinositol 3-kinase/protein kinase B pathway, activating the Janus kinase-signal transducer and activator of transcription pathway, and via the Toll-like receptor 4/myeloid differentiation factor 88/tumor necrosis factor receptor-associated factor 6 signaling pathway.49,50,51 Most of the experimental animals in these related studies were rats rather than mice. Since SIRT1 has been proved to play a crucial role in CIRI, we established an OGD/R model of mouse hippocampal neurons and a HSR model in mice to explore the SIRT1/HIF-1α/NLRP3 pathway. However, this study has several limitations. First, the sample sizes in the animal and cell experiments may have been insufficient, although we obtained favorable results. Second, we did not use specific inhibitors or agonists when studying the HIF-1α/NLRP3 signaling pathway, which suggests that whether the activation of NLRP3 depends on HIF-1α remains unclear. However, a previous study had indeed proved that the activation of NLRP3 was regulated by HIF-1α,52 which was consistent with our results. Third, there is a long way to go from the results of animal experiments to practical application in patients.

In summary, we performed simulated in vitro and in vivo experiments of CIRI by establishing OGD/R model in mouse hippocampal neurons and HSR model in mice. We found that SPC has a protective effect on hippocampal neuron injury in mice, and its mechanism may be related to activation of the SIRT1/HIF-1α/NLRP3 signaling pathway.

Acknowledgements:

We would like to thank American Journal Experts (AJE) for providing language editing.

Funding Statement

Funding: The study was supported by Natural Science Foundation of Anhui Province (No. 2408085MH212), the National Natural Science Foundation Incubation Program of The Second Affiliated Hospital of Anhui Medical University (No. 2020GQFY01), the Major Scientific Research Project of Natural Science in Universities of Anhui Province (No. KJ2021ZD0030), and the Key Research and Development Project of Anhui Province (No. 2022e07020045).

Footnotes

Conflicts of interest: We declare that we have no financial or personal relationships with other people or organizations that can inappropriately influence our work. No professional or other personal interest of any nature or kind in any product, service, or company could be construed as affecting the position presented in, or the review of, this manuscript.

Declaration of AI and AI-assisted technologies in the writing process: The authors declare that no Generative AI was used in the preparation of this.

Data availability statement:

Data will be made available on request.

References

  • 1.Patel SS, Goa KL. Sevoflurane. A review of its pharmacodynamic and pharmacokinetic properties and its clinical use in general anaesthesia. Drugs. 1996;51:658–700. doi: 10.2165/00003495-199651040-00009. [DOI] [PubMed] [Google Scholar]
  • 2.Cannon JW. Hemorrhagic shock. N Engl J Med. 2018;378:370–379. doi: 10.1056/NEJMra1705649. [DOI] [PubMed] [Google Scholar]
  • 3.Leech T, Chattipakorn N, Chattipakorn SC. The beneficial roles of metformin on the brain with cerebral ischaemia/reperfusion injury. Pharmacol Res. 2019;146:104261. doi: 10.1016/j.phrs.2019.104261. [DOI] [PubMed] [Google Scholar]
  • 4.Zhang Q, Jia M, Wang Y, Wang Q, Wu J. Cell Death mechanisms in cerebral ischemia-reperfusion injury. Neurochem Res. 2022;47:3525–3542. doi: 10.1007/s11064-022-03697-8. [DOI] [PubMed] [Google Scholar]
  • 5.Needham MJ, Webb CE, Bryden DC. Postoperative cognitive dysfunction and dementia: what we need to know and do. Br J Anaesth. 2017;119:i115–i125. doi: 10.1093/bja/aex354. [DOI] [PubMed] [Google Scholar]
  • 6.Sadeghzadeh J, Hosseini L, Mobed A, et al. The impact of cerebral ischemia on antioxidant enzymes activity and neuronal damage in the hippocampus. Cell Mol Neurobiol. 2023;43:3915–3928. doi: 10.1007/s10571-023-01413-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Zhang Y, Shan Z, Zhao Y, Ai Y. Sevoflurane prevents miR-181a-induced cerebral ischemia/reperfusion injury. Chem Biol Interact. 2019;308:332–338. doi: 10.1016/j.cbi.2019.06.008. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang Y, Zhang FG, Meng C, et al. Inhibition of sevoflurane postconditioning against cerebral ischemia reperfusion-induced oxidative injury in rats. Molecules. 2011;17:341–354. doi: 10.3390/molecules17010341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang J, Cai X, Zhang Q, et al. Hydrogen sulfide restores sevoflurane postconditioning mediated cardioprotection in diabetic rats: role of SIRT1/Nrf2 signaling-modulated mitochondrial dysfunction and oxidative stress. J Cell Physiol. 2021;236:5052–5068. doi: 10.1002/jcp.30214. [DOI] [PubMed] [Google Scholar]
  • 10.Xie A, Zhang X, Ju F, Zhou Y, Wu D, Han J. Sevoflurane impedes neuropathic pain by maintaining endoplasmic reticulum stress and oxidative stress homeostasis through inhibiting the activation of the PLCγ/CaMKII/IP3R signaling pathway. Aging (Albany NY) 2024;16:11062–11071. doi: 10.18632/aging.206001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Wu Z, Tan J, Lin L, Zhang W, Yuan W. Sevoflurane up-regulates miR-7a to protect against ischemic brain injury in rats by down-regulating ATG7 and reducing neuronal autophagy. Brain Res Bull. 2022;188:214–222. doi: 10.1016/j.brainresbull.2022.07.003. [DOI] [PubMed] [Google Scholar]
  • 12.Xie W, Zhu T, Zhang S, Sun X. Protective effects of Gypenoside XVII against cerebral ischemia/reperfusion injury via SIRT1-FOXO3A- and Hif1a-BNIP3-mediated mitochondrial autophagy. J Transl Med. 2022;20:622. doi: 10.1186/s12967-022-03830-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yang T, Liu X, Zhou Y, et al. Sanpian decoction ameliorates cerebral ischemia-reperfusion injury by regulating SIRT1/ERK/HIF-1α pathway through in silico analysis and experimental validation. J Ethnopharmacol. 2024;318:116898. doi: 10.1016/j.jep.2023.116898. [DOI] [PubMed] [Google Scholar]
  • 14.Lu H, Wang B. SIRT1 exerts neuroprotective effects by attenuating cerebral ischemia/reperfusion-induced injury via targeting p53/microRNA-22. Int J Mol Med. 2017;39:208–216. doi: 10.3892/ijmm.2016.2806. [DOI] [PubMed] [Google Scholar]
  • 15.Wei X, Guo H, Huang G, et al. SIRT1 Alleviates mitochondrial fission and necroptosis in cerebral ischemia/reperfusion injury via SIRT1-RIP1 signaling pathway. MedComm (2020) 2025;6:e70118. doi: 10.1002/mco2.70118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wang Z, Guo W, Yi F, et al. The regulatory effect of SIRT1 on extracellular microenvironment remodeling. Int J Biol Sci. 2021;17:89–96. doi: 10.7150/ijbs.52619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jia Z, Xu K, Li R, et al. The critical role of Sirt1 in ischemic stroke. Front Pharmacol. 2025;16:1425560. doi: 10.3389/fphar.2025.1425560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.McGettrick AF, O’Neill LAJ. The role of HIF in immunity and inflammation. Cell Metab. 2020;32:524–536. doi: 10.1016/j.cmet.2020.08.002. [DOI] [PubMed] [Google Scholar]
  • 19.Del Rey MJ, Valín Á, Usategui A, et al. Hif-1α knockdown reduces glycolytic metabolism and induces cell death of human synovial fibroblasts under normoxic conditions. Sci Rep. 2017;7:3644. doi: 10.1038/s41598-017-03921-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Majmundar AJ, Wong WJ, Simon MC. Hypoxia-inducible factors and the response to hypoxic stress. Mol Cell. 2010;40:294–309. doi: 10.1016/j.molcel.2010.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yang L, Xie P, Wu J, et al. Sevoflurane postconditioning improves myocardial mitochondrial respiratory function and reduces myocardial ischemia-reperfusion injury by up-regulating HIF-1. Am J Transl Res. 2016;8:4415–4424. [PMC free article] [PubMed] [Google Scholar]
  • 22.Duan WL, Wang XJ, Ma YP, et al. Therapeutic strategies targeting the NLRP3-mediated inflammatory response and pyroptosis in cerebral ischemia/reperfusion injury (Review) Mol Med Rep. 2024;29:46. doi: 10.3892/mmr.2024.13170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Shaik MG, Joshi SV, Akunuri R, et al. Small molecule inhibitors of NLRP3 inflammasome and GSK-3β in the management of traumatic brain injury: a review. Eur J Med Chem. 2023;259:115718. doi: 10.1016/j.ejmech.2023.115718. [DOI] [PubMed] [Google Scholar]
  • 24.Du G, Yang Z, Wen Y, et al. Heat stress induces IL-1β and IL-18 overproduction via ROS-activated NLRP3 inflammasome: implication in neuroinflammation in mice with heat stroke. Neuroreport. 2024;35:558–567. doi: 10.1097/WNR.0000000000002042. [DOI] [PubMed] [Google Scholar]
  • 25.Luo L, Liu M, Fan Y, et al. Intermittent theta-burst stimulation improves motor function by inhibiting neuronal pyroptosis and regulating microglial polarization via TLR4/NFκB/NLRP3 signaling pathway in cerebral ischemic mice. J Neuroinflammation. 2022;19:141. doi: 10.1186/s12974-022-02501-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hong Z, Zhang X, Zhang T, et al. The ROS/GRK2/HIF-1α/NLRP3 pathway mediates pyroptosis of fibroblast-like synoviocytes and the regulation of monomer derivatives of paeoniflorin. Oxid Med Cell Longev. 2022;2022:4566851. doi: 10.1155/2022/4566851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Xu A, Yuan K, Xue S, et al. Laminin-dystroglycan mediated ferroptosis in hemorrhagic shock and reperfusion induced-cognitive impairment through AMPK/Nrf2. Free Radic Biol Med. 2025;230:1–16. doi: 10.1016/j.freeradbiomed.2025.01.046. [DOI] [PubMed] [Google Scholar]
  • 28.Zhang M, Huang C, Zhang L, Huang L, Hu X. Phosphoinositide-3-kinase/Akt-endothelial nitric oxide synthase signaling pathway mediates the neuroprotective effect of sevoflurane postconditioning in a rat model of hemorrhagic shock and resuscitation. World Neurosurg. 2022;157:e223–e231. doi: 10.1016/j.wneu.2021.09.143. [DOI] [PubMed] [Google Scholar]
  • 29.Lueptow LM. Novel object recognition test for the investigation of learning and memory in mice. J Vis Exp. 2017:55718. doi: 10.3791/55718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Komada M, Takao K, Miyakawa T. Elevated plus maze for mice. J Vis Exp. 2008:1088. doi: 10.3791/1088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gawel K, Gibula E, Marszalek-Grabska M, Filarowska J, Kotlinska JH. Assessment of spatial learning and memory in the Barnes maze task in rodents-methodological consideration. Naunyn Schmiedebergs Arch Pharmacol. 2019;392:1–18. doi: 10.1007/s00210-018-1589-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Schneider CA, Rasband WS, Eliceiri KW. NIH Image to ImageJ: 25 years of image analysis. Nat Methods. 2012;9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Shu J, Huang X, Liao Q, et al. Sevoflurane improves hemorrhagic shock and resuscitation-induced cognitive impairments and mitochondrial dysfunctions through SIRT1-mediated autophagy. Oxid Med Cell Longev. 2022;2022:9771743. doi: 10.1155/2022/9771743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Faul F, Erdfelder E, Buchner A, Lang AG. Statistical power analyses using G*Power 3.1: tests for correlation and regression analyses. Behav Res Methods. 2009;41:1149–1160. doi: 10.3758/BRM.41.4.1149. [DOI] [PubMed] [Google Scholar]
  • 35.Yuan Q, Yuan Y, Zheng Y, et al. Anti-cerebral ischemia reperfusion injury of polysaccharides: a review of the mechanisms. Biomed Pharmacother. 2021;137:111303. doi: 10.1016/j.biopha.2021.111303. [DOI] [PubMed] [Google Scholar]
  • 36.Xu X, Wang X, Zhang L, et al. Nicotinamide adenine dinucleotide treatment confers resistance to neonatal ischemia and hypoxia: effects on neurobehavioral phenotypes. Neural Regen Res. 2024;19:2760–2772. doi: 10.4103/NRR.NRR-D-23-01490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Xu X, Chen Q, Li S, Xiong T. Peroxisome proliferator-activated receptors as biomarkers in cerebrovascular diseases: a narrative review. NeuroMarkers. 2025;2:100035. [Google Scholar]
  • 38.Zhang L, Huang L, Wang J, Zhang M, Zhang Y, Hu X. Sevoflurane postconditioning improves spatial learning and memory ability involving mitochondrial permeability transition pore in hemorrhagic shock and resuscitation rats. Brain Behav. 2020;10:e01501. doi: 10.1002/brb3.1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Zhu T, Xie WJ, Wang L, et al. Notoginsenoside R1 activates the NAMPT-NAD(+)-SIRT1 cascade to promote postischemic angiogenesis by modulating Notch signaling. Biomed Pharmacother. 2021;140:111693. doi: 10.1016/j.biopha.2021.111693. [DOI] [PubMed] [Google Scholar]
  • 40.Zhang L, Tan X, Song F, et al. Activation of G-protein-coupled receptor 39 reduces neuropathic pain in a rat model. Neural Regen Res. 2024;19:687–696. doi: 10.4103/1673-5374.380905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Cai Y, Wu Y, Guo Z, et al. Sevoflurane alleviates intestinal ischemia-reperfusion injury in aged mice. Med Gas Res. 2025;15:398–403. doi: 10.4103/mgr.MEDGASRES-D-24-00033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.He X, Cao Z, Chen X, et al. Resveratrol alleviates the prenatally intermittent hypoxia-induced cognitive impairment in male offspring mice through modulating the SIRT1/HIF-1α pathway. Brain Behav. 2025;15:e70413. doi: 10.1002/brb3.70413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Taylor CT, Scholz CC. The effect of HIF on metabolism and immunity. Nat Rev Nephrol. 2022;18:573–587. doi: 10.1038/s41581-022-00587-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Huang Y, Xu W, Zhou R. NLRP3 inflammasome activation and cell death. Cell Mol Immunol. 2021;18:2114–2127. doi: 10.1038/s41423-021-00740-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vajjhala PR, Mirams RE, Hill JM. Multiple binding sites on the pyrin domain of ASC protein allow self-association and interaction with NLRP3 protein. J Biol Chem. 2012;287:41732–41743. doi: 10.1074/jbc.M112.381228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Coll RC, Schroder K, Pelegrín P. NLRP3 and pyroptosis blockers for treating inflammatory diseases. Trends Pharmacol Sci. 2022;43:653–668. doi: 10.1016/j.tips.2022.04.003. [DOI] [PubMed] [Google Scholar]
  • 47.Cai Q, Zhao C, Xu Y, et al. Qingda granule alleviates cerebral ischemia/reperfusion injury by inhibiting TLR4/NF-κB/NLRP3 signaling in microglia. J Ethnopharmacol. 2024;324:117712. doi: 10.1016/j.jep.2024.117712. [DOI] [PubMed] [Google Scholar]
  • 48.Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000;404:293–296. doi: 10.1038/35005107. [DOI] [PubMed] [Google Scholar]
  • 49.Kim HC, Kim E, Bae JI, et al. Sevoflurane postconditioning reduces apoptosis by activating the JAK-STAT pathway after transient global cerebral ischemia in rats. J Neurosurg Anesthesiol. 2017;29:37–45. doi: 10.1097/ANA.0000000000000331. [DOI] [PubMed] [Google Scholar]
  • 50.Zhao Z, Li Y, Chi F, et al. Sevoflurane postconditioning ameliorates cerebral ischemia-reperfusion injury in rats via TLR4/MyD88/TRAF6 signaling pathway. Aging (Albany NY) 2022;14:10153–10170. doi: 10.18632/aging.204461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Wang JK, Yu LN, Zhang FJ, et al. Postconditioning with sevoflurane protects against focal cerebral ischemia and reperfusion injury via PI3K/Akt pathway. Brain Res. 2010;1357:142–151. doi: 10.1016/j.brainres.2010.08.009. [DOI] [PubMed] [Google Scholar]
  • 52.Shi ZM, Jing JJ, Xue ZJ, et al. Stellate ganglion block ameliorated central post-stroke pain with comorbid anxiety and depression through inhibiting HIF-1α/NLRP3 signaling following thalamic hemorrhagic stroke. J Neuroinflammation. 2023;20:82. doi: 10.1186/s12974-023-02765-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data will be made available on request.


Articles from Medical Gas Research are provided here courtesy of Wolters Kluwer -- Medknow Publications

RESOURCES