4‐(5‐Chloro‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide: A Novel Polypharmacology Agent to Target Carbonic Anhydrase IX and XII With Improved Selectivity, Wnt/β‐Catenin Signaling Pathway, and P‐Glycoprotein

Abstract

We synthesized novel pyrrole (5–11) and indole (12–16) derivatives based on a polypharmacology approach aimed to obtain inhibitors of human carbonic anhydrase (hCA) with improved selectivity toward the IX and XII isoforms, Wnt/β‐catenin pathway, and P‐glycoprotein (P‐gp). Inspection of the binding sites of the hCA I, II, IX, and XII isoforms highlighted small but significant differences of cavity volumes that guided the introduction of small substituents at Position 4 of the 3‐phenyl ring of the pyrrole and at Position 5 of the indole. Compound 15 exhibited potent and selective inhibition of both hCA IX and XII isoforms compared to the parent compound. It inhibited the Wnt/β‐catenin pathway abrogating the association of β‐catenin with TCF‐4 and the multidrug‐resistant P‐gp‐expressing cancer cells. Compound 15 showed strong inhibition of viability of SW620, SW480, and HCT116 CRC and TNBC cell lines, restored the sensitivity to doxorubicin (DOX) in HT29/DX P‐gp‐overexpressing cells, and showed medium metabolic stability in both human and mouse microsomes and acceptable predicted oral bioavailability. Compound 15 is a robust lead compound for the development of new antitumor agents based on the polypharmacology approach.

Polypharmacology is expected to produce higher therapeutic efficacy and lower cytotoxic and side effects. Compound 15 exhibited strong inhibition of the human carbonic anhydrase isoforms IX and XII and selectivity toward the adverse isoforms I and II. It inhibited strongly the Wnt/β‐catenin pathway and the multidrug‐resistant P‐gp‐expressing cancer cells. Compound 15 showed potential as a new polypharmacology antitumor agent.

1. Introduction

Polypharmacology is a promising emerging strategy in anticancer drug discovery. In fact, a polypharmacology therapy is expected to achieve better efficacy compared to single or multidrug treatments and lower cytotoxicity avoiding unwanted effects likely arising from drug–drug interactions [1].

Eight different classes of carbonic anhydrase (CA, EC 4.2.1.1) metalloenzymes (α, β, γ, δ, ζ, η, θ, and ι) have been identified that reversibly convert carbon dioxide and water to monohydrogen carbonate and hydrogen ion [2, 3]. Only the α‐class can be found in mammals. The α‐class comprises several genetically distinct human CA (hCA) isoforms [4]. They are (i) cytosolic (I–III, VII, and XIII), (ii) mitochondrial (VA and VB), (iii) membrane‐bound (IV, IX, XII, XIV, and XV), and (iv) secreted (VI) proteins. hCA IV and XV are bound to the membrane through a glycosylphosphatidylinositol linker, whereas hCA IX, XII, and XIV are characterized by a transmembrane domain [5, 6]. The hCA enzymes are expressed throughout organs and tissues of the human body where they catalyze key physiological processes, such as respiration, transport of carbon dioxide and monohydrogen carbonate, homeostasis, electrolyte secretion, metabolite biosynthesis, biosynthetic reactions, cell proliferation, and tumorigenesis [7, 8].

Dysregulation and/or abnormality of the hCA functionality are responsible of several pathologies [9]. The cytosolic hCA I and II are ubiquitously present in the human body. The hCA I is involved retinal and cerebral edema [10]. The hCA II plays a relevant role in some type of cancer, such as urothelial carcinoma [11], glaucoma [12], epilepsy [13], and Parkinson′s disease [14]. The membrane‐bound hCA IX and XII catalyze the hydration of carbon dioxide in the extracellular space. In many tumors, both the hCA IX and XII isoforms are overexpressed as hypoxia‐inducible factor 1 (HIF‐1) dependent downstream targets [15, 16]. hCA IX is overexpressed in various tumors, including colorectal cancer (CRC), breast, glioblastoma, lung, and bladder cancer [17]; hCA XII is overexpressed in breast [18], non‐small cell lung [19], and brain tumors [20, 21, 22]. A mutation in hCA XII has been associated to cystic fibrosis‐like syndrome and hyponatremia [23]. Overexpression of the hCA II and XII isoforms has been considered as prognostic factor to CRC patients with poor prognosis [24].

Recently, we described pyrrole derivative 1 that showed effective multitargeting inhibition of hCA, Wnt/β‐catenin signaling pathway, and drug‐resistant P‐gp‐overexpressing cancer cells [25]. Dual‐target inhibition of CA IX and VEGFR‐2 has been reported as potential treatment for solid tumors [26]. The lack of isoform selectivity, in particular toward the broadly distributed hCA I and II [27], is a crucial issue for potential clinical applications. In fact, targeting the hCA I and II isoforms that are widely expressed in red blood cells, an anticancer agent, alters efficacy and blood pH [28] and decreases its bioavailability for the on‐target isoforms [29]. Inhibition of the hCA II can lead to significant alteration of the homeostasis, and in the treatment of glaucoma can cause eye irritation, watering, blurred vision, taste changes, constipation and diarrhea [30]. The low selectivity resides in sequence identity and structural homology among the hCA isoforms. Efforts to improve CA II and IX selectivity were conducted by Aggarwal, correlating varied binding affinities of α‐CA inhibitors [31]; Bhatt described benzenesulfonamide‐based CA IX and XII inhibitors selective for the CA I, but not for the CA II [29]. Huwaimel described a chromene‐3‐carboxamide with limited selectivity between CA isoforms XII/I and CA IX/II [32].

The catalytic site of CAs can be conceptually divided into two regions: (i) a highly conserved zinc‐binding core shared among all isoforms and (ii) a more variable upper portion showing subtle differences in amino acid composition and pocket geometry [33]. Sequence and structural alignments revealed that seven out eleven binding‐site residues are conserved among the CA I, II, IX, and XII isoforms, while the other four residues show small but significant differences (Figure S1). These differences can be easily appreciated by comparing the cavity volumes: CA I, the smallest (≈170 ų); CA II, slightly larger (≈180 ų); and CA IX and XII, substantially larger (≈228 and 213 ų, respectively).

We aimed to improve compound selectivity for the hCA IX and XII isoforms over the hCA I and II ones while maintaining the valuable inhibition of Wnt/β‐catenin signaling pathway and P‐gp exhibited by 1 [25]. Based on estimation of the cavity volumes, we hypothesized that the introduction of small substituents at Position 4 of the 3‐phenyl ring of 1 and at Position 5 of the indole ring of 2 could afford the desirable selectivity (Figure 1). Thus, we synthesized novel pyrrole (5–11) and indole (12–16) derivatives (Table 1) to reduce the affinity for hCA I and hCA II, but not for hCA IX and hCAXII, resulting in improved selectivity. Compound 15 exhibited potent inhibition of hCA IX and XII with superior selectivity for these isoforms compared to compound 1. It inhibited strongly the Wnt/β‐catenin signaling pathway and the multidrug‐resistant P‐gp‐expressing cancer cells and abrogated the association of β‐catenin with TCF‐4. Compound 15 inhibited the SW620 and SW480. HCT116 CRC cell was remarkably more potent than 1 and reference SLC‐0111 against the TNBC and restored the sensitivity to doxorubicin (DOX) in HT29/DX P‐gp‐overexpressing cells.

FIGURE 1.

Structures of reference compounds 1 and 2 and new derivatives 5–16. See Table 1 for R substituents.

TABLE 1.

Inhibition data of human CA isoforms I, II, IX, and XII of compounds 5–16 and references [1, 2, 3, 4].

Compda	R	hCA K i, nM				hCA fold selectivity
		I	II	IX	XII	I/IX	II/IX	I/XII	II/XII
5	4‐CH3	352.5	41.8	8.5	9.3	38.3	5.2	35.0	4.5
6	4‐OCH3	510.3	40.8	17.8	14.2	28.7	2.3	35.9	2.9
7	4‐N(CH3)2	428.3	36.7	25.8	9.2	16.6	1.4	46.6	4.0
8	4‐F	285.3	38.1	15.8	4.7	18.1	2.4	60.7	8.1
9	4‐Cl	475.3	59.4	28.0	24.6	17.0	2.1	19.3	2.4
10	4‐ CF3	471.2	59.2	8.3	56.8	7.1	41.3	5.2	56.8
11	4‐NO2	726.1	89.8	18.4	39.5	4.9	117.1	14.5	39.5
12	5‐CH3	573.8	120.8	30.1	19.1	4.0	38.3	8.1	19.1
13	5‐OCH3	800.4	102.7	18.4	43.5	5.6	35.0	2.4	43.5
14	5‐F	551.2	55.3	6.3	87.5	8.8	47.9	4.8	87.5
15	5‐Cl	883.7	115.8	5.8	7.8	152.4	20.0	113.3	14.8
16	5‐Br	1152	162.9	36.4	31.6	4.5	25.9	3.7	31.6
1	H	272.1	33.6	24.1	6.8	11.3	1.4	40.0	4.9
2	H	446.4	67.8	7.3	16.5	61.1	9.3	27.0	4.1
3 b	—	62.0	86.2	9.2	25.4	6.7	9.4	2.4	3.4
4 c	—	250.0	12.0	25.0	5.7	10	0.48	43.9	2.1

^a Mean from three different assays by a stopped flow technique (standard errors were in the range of ±5%–10% of the reported values).

^b 4′‐(4‐Aminobenzoyl)‐[1,1′‐biphenyl]‐4‐sulfonamide [34].

^c AAZ, N‐(5‐sulfamoyl‐1,3,4‐thiadiazol‐2‐yl)acetamide.

2. Results and Discussion

2.1. Chemistry

2.1.1. Synthesis

Pyrrole derivatives 5–11 bearing different substituents at Position 4 of the 3‐phenyl ring were synthesized by reaction of 3‐aryl‐4‐aroylpyrroles 17–23 with 4‐bromo‐N,N‐bis((2‐(trimethylsilyl) ethoxy)methyl)‐benzenesulfonamide [2‐(trimethylsilyl)ethoxymethyl (SEM) protected 4‐bromobenzenesulfonamide] (24) in the presence of copper(I) iodide, cesium carbonate, and 1,10‐phenanthroline under microwave irradiation at 210°C, 200 W for 40 min to give SEM protected 4‐(3‐aryl‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)sulfonamides 25–31. The preparation of compounds 17–23 is reported in the Supporting Information. The SEM‐protected bromophenylsulfonamide 24 was prepared as previously reported from 4‐brombenzenesulfonamide with trimethylsilinethoxymethyl chloride in the presence of sodium hydride in N,N‐dimethylformamide at room temperature for 50 min under an argon stream [25]. Removal of the the SEM protecting groups was achieved by heating 25–31 in tetrahydrofuran (THF) at reflux for 4 h in the presence of tetrabutylammonium fluoride (TBAF) to give the desired sulfonamide derivatives 5–11 (Scheme 1).

SCHEME 1.

Synthesis of pyrrolylsulfonamides 5–11. R: CH₃, 5, 17, 25; OCH₃, 6, 18, 26; N(CH₃)₂, 7, 19, 27; F, 8, 20, 28; Cl, 9, 21, 29; CF₃, 10, 22, 30; NO₂, 11, 23, 31. Reagents and reaction conditions: (a) CuI, Cs₂CO₃, 1,10‐phenantroline, 1,4‐dioxane, MW, closed vessel, 210°C, 200 W, 40 min, average yield 48%–88%, 11 7%; (b) TBAF, THF, reflux, 4 h, average yield 17%–55%. The preparation of compounds 17–23 is reported in the Supporting Information.

Similarly, were prepared indoles 12–16 by reaction of 3‐(3,4,5‐trimethoxybenzoyl)indoles 32–36 with 24 to give the SEM protected 4‐(3‐(3,4,5‐trimethoxybenzoyl)indol‐1H‐yl)sulfonamides 37–41 and subsequent removal of the SEM protecting group. The preparation of compounds 32–36 is reported in the Supporting Information (Scheme 2).

SCHEME 2.

Synthesis of indolylsulfonamides 12–16. R: CH₃, 12, 32, 37; OCH₃, 13, 33, 38; N(CH₃)₂, 14, 34, 39; F, 15, 35, 40; Cl, 16, 36, 41. Reagents and reaction conditions: (a) CuI, Cs₂CO₃, 1,10‐phenantroline, 1,4‐dioxane, MW, closed vessel, 210°C, 200 W, 40 min, average yield 27%–68%; (b) TBAF, THF, reflux, 4 h, average yield 10%–77%. The preparation of compounds 32–36 is reported in the Supporting Information.

2.1.2. Molecular Modeling

The crystal structures were downloaded from the Protein Data Bank (PDB): hCA I (PDB ID: 7Q0D) [35], hCA II (PDB ID: 5E2R) [34], hCA IX (PDB ID: 5FL4) [36], and hCA XII (PDB ID: 6G7A) [37]. We divided the binding poses proposed by docking in three sections: (i) the benzenesulfonamide group, (ii) the central pyrrole or indole core, and (iii) the trimethoxyphenyl group. (i) The pivotal benzenesulfonamide group conserved the binding interactions in all studied hCA isoforms. The sulfonamide nitrogen atom coordinated the catalytic zinc cation; the oxygen atom formed a H‐bond with Thr199, while the phenyl ring was stabilized by hydrophobic interactions with Leu198 and Val121 (Ala121 in hCA I). (ii) The pyrrole and indole rings formed hydrophobic contacts with four residues: 202 and 198, which were conserved in all the studied isoforms, and 131 and 204 (residue numeration relative to hCA II). The different steric hindrance of the latter residues dramatically affected the binding mode. The isoforms I and II exhibited subpockets containing bulkier residues (Leu131 and Tyr204 for hCA I and Phe131 and Leu204 for hCA II) compared to the isoforms IX and XII (Val131 and Ala204 for hCA IX and Phe131 and Asn204 for hCA XII). The 5‐chloroindole ring of 15 well fitted this subpocket receiving proper stabilization and driving selectivity. Smaller (H, 1) or bulkier substituents (methoxy, 13, and bromine, 16) at Position 5 of the indole caused drop of selectivity. The pyrrole derivatives showed lower selectivity compared to the indoles due to the reduced size of the heteroaromatic ring and the different placement of the substituents at Position 4 of the 3‐phenyl ring which were less affected by the steric hindrance of the surrounding residues. (iii) The 3,4,5‐trimethoxyphenyl group was solvent exposed in the hCA I and II isoforms due to the binding conformation of central ring and formed few hydrophobic contacts. In the hCA IX and XII isoforms, they formed hydrophobic contacts with Leu135 and Pro202 (hCAIX) or stabilizing polar interactions with Ser132 and Asn133 (hCAXII) (Figure 2). The surface of cavity volumes of the hCA I, II, IX, and XII variable regions and the proposed binding mode of derivative 15 are shown in Figure S2.

FIGURE 2.

Proposed binding modes of derivatives 9 (magenta) and 15 (cyan). Enzymes are reported as colored cartoon: left panel, hCA IX, gray; right panel, hCA XII, sky blue. Zinc atom is depicted as a green sphere; residues involved in interactions are reported as white stick; H‐bonds are depicted as yellow dot lines. For the sake of clarity, residue numbering has been referred to hCA II.

2.2. Biology

2.2.1. Inhibition of hCA I, hCA II, hCA IX, and hCA XII Isoforms

The ability of sulfonamides 5–16 to inhibit the hCA I, II, IX, and XII isoforms was measured by a stopped flow CO₂ hydrase assay [38]. Table 1 shows the K _i values of 5–16 along with their calculated fold selectivity. The previously reported sulfonamides 1, 2 [25], 4′‐(4‐aminobenzoyl)‐[1,1′‐biphenyl]‐4‐sulfonamide (3) [34], and acetazolamide (AAZ) (N‐(5‐sulfamoyl‐1,3,4‐thiadiazol‐2‐yl)acetamide) (4) were used as reference compounds (Table 1). AAZ is a CA inhibitor medication approved by the FDA to treat glaucoma, idiopathic intracranial hypertension, congestive heart failure, altitude sickness, periodic paralysis, and epilepsy. However, 4 can induce a broad range of general and specific adverse effects and, among contraindications, decreases the clearance of ammonia and interacts with several medications [39].

Previous structure–activity relationship studies [25] suggested to keep fixed the sulfonamide at Position 4 of the 1‐phenyl ring and the 3,4,5‐trimethoxy substitution at the aroyl group [40]. Herein, we evaluated the effect of substituents, both electron‐withdrawing and ‐donating groups, at Position 4 of the 3‐phenyl of the 4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide and at Position 5 of the 3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide.

As inhibitors of hCA I, compounds 5–16 showed K _i values in the nanomolar range, from 285.5 (8) to 1152 (16) nM. The most active compound 8 was at the level of reference compounds 1 and 4, more potent than 2 and less potent than 3. Against the hCA II, the K _i values ranged from 38.1 (8) to 162.9 (16) nM. The most potent derivative 8 was equipotent to 1, superior to 2 and 3, but less potent than 4. Four compounds inhibited the hCA IX at single‐digit nanomolar concentration, 5 (K _i = 8.5 nM), 10 (K _i = 8.3 nM), 14 (K _i = 6.3 nM), and 15 (K _i = 5.8 nM). Compound 15, the most potent inhibitor within the series, was superior to the references 1–4. As inhibitors of the kCA XII, five derivatives, 5 (K _i = 9.3 nM), 7 (K _i = 9.2 nM), 8 (K _i = 4.7 nM), 11 (K _i = 6.2 nM), and 15 (K _i = 7.8 nM) were comparable to 1 and 4. Compound 15 was the strongest inhibitor of both hCA IX and XII isoforms with K _i values of 5.8 and 7.8 nM, respectively. This is in view of the relatively high K _i values achieved for the hCA I and II isoforms. The calculated selectivity indexes of 15 for the CA IX and XII isoforms were CA I/IX = 152.4, CA II/IX = 20.0, CA I/XII = 113.3, and CA II/XII = 14.8. These fold selectivities were the highest values within the series 5–16 and references 1–4.

2.2.2. Inhibition of Wnt/β‐Catenin Signaling Pathway

We tested the inhibitory activity of compound 15 on the Wnt/β‐catenin signaling pathway in HEK‐293T cells. To address this hypothesis, we used the commercially available M50 Super 8x TOPFlash reporter (TOP) containing eight repeats of TCF/LEF‐binding sites and its negative control M51 Super 8x FOPFlash (FOP). After transfection, cells were treated with lithium chloride (LiCl), a GSK3β inhibitor, to activate the Wnt signaling and treated with increasing concentrations of compound 15. As shown in Figure 4, the compound specifically inhibits the TOP luciferase activity without affecting the negative control FOP, demonstrating a functional inhibition of β‐catenin transcriptional activity (Figure 3).

FIGURE 4.

Compound 15 suppresses the expression of Wnt/β‐catenin target genes. Quantitative real‐time PCR showing MYC mRNA levels normalized on β‐actin mRNA levels (A) and immunoblotting showing MYC protein levels (B). Vinculin is used as loading control. Data are represented as the mean ± SD of three independent experiments, each performed in triplicate. *p < 0.05, **p < 0.01, ns not significant as determined by analysis of variance (ANOVA).

FIGURE 3.

Compound 15 inhibits Wnt/β‐catenin activity luciferase assay in HEK‐293T cells transfected with M50 Super 8x TOPFlash (TOP) or its mutated version M51 Super 8x FOPFlash (FOP) used as negative control. Cells were induced with LiCl (50 mM) and treated with the indicated concentrations of 15 for 24 h. Data are represented as the mean ± SD of three independent experiments, each performed in triplicate. *p < 0.05, **p < 0.01, ***p < 0.005, ns not significant as determined by analysis of variance (ANOVA).

To further confirm the ability of compound 15 to inhibit the β‐catenin‐mediated transcriptional program, we measured the expression of three well‐known β‐catenin target genes: MYC, FGF‐20, and SALL‐4. We first activated the signaling pathway by treating CRC cells with LiCl; then, we administered increasing concentrations of 15. Compound 15 caused a dose‐dependent marked inhibition the proto‐oncogene MYC in HCT116 CRC cells (Figure 4A,B). Furthermore, compound 15 significantly reduced the expression of FGF20 (fibroblast growth factor 20) (Figure 5A) and SALL4 (spalt‐like transcription factor 4) (Figure 5B) proteins whose expression is regulated by the Wnt/β‐catenin signaling pathway. FGF20 mRNA was found in CRC SW480, lung carcinoma (LX‐1) and gastric carcinoma (NCI‐N87) cell lines [41]. An aberrant expression and deregulated functions of SALL4 have been reported in several solid tumors, including CRC and in hematological malignancies [42].

FIGURE 5.

Quantitative real‐time PCR showing FGF‐20 (A) and SALL‐4 (B) mRNA levels in HCT116 cells pretreated with LiCl (50 mM) then exposed to the indicated concentrations of 15. Data are normalized on β‐actin mRNA levels. Data are represented as the mean ± SD of three independent experiments, each performed in triplicate. *p < 0.05, **p < 0.01, ns not significant as determined by analysis of variance.

2.2.3. Compound 15 Disrupts the Association of β‐Catenin With TCF4

β‐Catenin association with TCF‐4 is a crucial step in the transcriptional activation of the downstream target genes. Small molecules block the interactions between β‐catenin and TCF4, cut off this activation, and show potential to act as anticancer drugs [43]. Fang reported a 4‐thioureido‐benzenesulfonamide that suppressed tumorigenesis by interfering with β‐catenin/TCF4 interaction in a dose‐dependent manner [44]. We wondered if compound 15 could exert its repressing activity on the pathway by preventing the formation of β‐catenin/TCF‐4 complex. To this end, HEK293T cells were transfected with FLAG‐tagged β‐catenin and MYC‐tagged TCF‐4 expression vectors, treated with LiCl to activate signaling, and subsequently exposed to 15. As documented in Figure 6, administration of LiCl enhanced the interaction between the two transcription factors, as expected, while compound 15 abrogated the association of β‐catenin with its partner TCF‐4. Taken together, these findings highlight the ability of compound 15 to significantly inhibit the Wnt/β‐catenin pathway by preventing β‐catenin interaction with TCF‐4, hence impeding its transcriptional activity and suppressing the expression of β‐catenin target genes, including MYC.

FIGURE 6.

Compound 15 inhibits the β‐catenin/TCF‐4 interaction. A coimmunoprecipitation assay was performed in HEK293T cells transiently transfected with FLAG‐tagged β‐catenin (β‐catenin^FLAG) and MYC‐tagged TCF‐4 (TCF‐4^MYC). Cells were treated with 50 mM LiCl and 60 μM 15 for 24 h. β‐Catenin^FLAG was immunoprecipitated from total protein extracts using anti‐FLAG‐conjugated agarose beads (left panel; IP: immunoprecipitation). Coimmunoprecipitated proteins were analyzed by Western blotting using an anti‐MYC‐tag antibody to detect TCF‐4^MYC (left panel; IB: immunoblot). Input shows the levels of TCF‐4^MYC and β‐catenin^FLAG in 5% whole‐cell lysates before immunoprecipitation (right panel).

2.2.4. Inhibition of P‐gp

We used a doxorubicin (DOX)‐sensitive colon cancer HT29 cell line expressing low levels of P‐gp to assess the efficacy of compound 15, along with its corresponding DOX‐resistant cell line HT29/DX expressing high level of P‐gp, which was stepwise selected in media containing increasing concentrations of DOX [45]. The HT29 and HT29/DX couple owning important translational potential as cancer model has been widely used to characterize the DOX resistance and pharmacological efficacy by our group. Beside ABC transporters, the HT29/DX cells express also MRP1, MRP2, MRP3, MRP5, and BCRP transporters [46]. Hence, to shed light the effect of compound 15 on the P‐gp, we used in parallel canine kidney MDCK cells, a cell line that is devoid of any transporter, and the corresponding MDCK/P‐gp cell line overexpressing human P‐gp only [47].

Preliminarily, we measured the cytotoxicity of compound 15 alone. Compound 15 reduced in a dose‐dependent manner cell viability in all the four cell lines tested, suggesting that there was neither cell‐dependent effect nor different behavior between DOX‐sensitive and DOX‐resistant cell lines. The viability was >75% with 15 in the concentration range of 1–100 nM (Figure S3). Hence, in the subsequent experiments, we worked in the 1–100 nM range of concentrations to avoid any bias related to the intrinsic cytotoxicity induced by 15.

We first measured the intracellular accumulation of DOX, a typical substrate of P‐gp, in order to assess the impact of compound 15. As expected, HT29 cells showed basal DOX accumulation superior to the drug‐resistant counterpart HT29/DX cells. Similarly, in MDCK cells, the intracellular accumulation of DOX was significantly higher than in MDCK/P‐gp cells (Figure S4). The effect of 15 on the amount of DOX retained in HT29 or MDCK/P‐gp cells was negligible. The higher accumulation of DOX in MDCK/P‐gp cells than in HT29 cells can be ascribed to other ABC transporters (such as low levels of MRP1) present in HT29 cells that can efflux DOX. Different to the sensitive cells, 100 nM 15 yielded a strong dose‐dependent DOX accumulation in HT29/DX cells, al the same level of the sensitive HT29 cells, likely due to higher levels of the ABC transporters, the putative targets of compound 15. Increasing DOX accumulation was observed in 15‐treated MDCK/P‐gp cells, owing only P‐gp transporters, indicating that the effect observed in the HT29/DX cells was partly mediated by the P‐gp. DOX accumulation was not fully restored by 15 to MDCK cells, devoid of P‐gp, likely due to superior catalytic efficiency of the proteins in MDCK/P‐gp and HT29/DX cells, and possible targeting of other ABC transporters in HT29/DX cells, but not in MDCK/P‐gp cells.

We investigated the ability of compound 15 to inhibit the catalytic cycle of the P‐gp, in order to determine the DOX resistance. The rate of ATP hydrolysis, a crucial step necessary of the DOX efflux and considered an index of P‐gp activity [48], was measured on immunopurified proteins from HT29/DX and MDCK/P‐gp cell lines (Table S1). In both cell lines, compound 15, starting at 10 nM, reduced the P‐gp activity. The protein extracted from MDCK/P‐gp cells was more active than that from HT29/DX cells (Figure S5). These findings indicated that compound 15 behaved as a P‐gp inhibitor.

The potential of compound 15 to reverse resistance to DOX was evaluated in terms of cytotoxicity by cell viability in cells coincubated with both 15 and DOX at 5 µM, which is a concentration already used to discriminate sensitive versus resistant cells [49, 50]. In sensitive HT29 and MDCK cells, DOX reduced the viability to <30% but did not affect cell viability of the resistant HT29/DX and MDCK/P‐gp cell lines. Compound 15 did not provoke further reduction of cell viability in HT29 and MDCK cells, compared with DOX alone, indicating a negligible increase in the intracellular DOX retention. On the contrary, 15 reduced in a dose‐dependent manner the viability of HT29/DX and MDCK/P‐gp cells and restored the sensitivity to DOX. In the HT29/DX model, a 100 nM 15 and 5 µM DOX drug combination reduced the cell viability at the level achieved by DOX alone in the corresponding chemo sensitive cells; this setting proved to fully overcome the resistance to DOX (Figure 7).

FIGURE 7.

Viability of HT29 and HT29/DX (A) and MDCK and MDCK/P‐gp (B) cells incubated with fresh medium (ctrl), 5 µM DOX (dox), alone or co‐incubated with 1, 10, or 100 nM of 15 for 72 h, measured with a spectrophotometric assay. Data are means ± SD (n = 4). ***p < 0.001: versus untreated HT29 or MDCK cells (“ctrl”); °°°p < 0.001: versus untreated HT29/DX or MDCK/P‐gp cells (“ctrl”); ###p < 0.001: versus dox‐treated HT29/DX or MDCK/P‐gp cells.

2.2.5. Inhibition of CRC, HepG2, and CC‐2509 Cell Growth

The ability of 15 to inhibit the SW620, SW480, and HCT116 human colon cancer cells as well as in HepG2 human hepatocytes and CC2509 nontumor human fibroblasts was assessed at eight increasing compound concentrations, from 1 nM to 10 μM, using 3‐[4,5‐dimethylthiazol‐2‐yl]‐2,5 diphenyl tetrazolium bromide (MTT) reduction [51]. Compound 15 was a potent inhibitor of the SW620 (IC₅₀ = 0.34 μM), SW480 (IC₅₀ = 0.41 μM), and HCT116 cells (IC₅₀ = 0.39 μM) CRC cells (Table 2). Compound 15 showed potent and specific inhibition of the CRC cells compared to the human liver HepG2 (selectivity indexes ranging from 301.5 to 250.0) and fibroblast CC‐2509 (selectivity indexes ranging from 30.0 to 24.5) cell lines.

TABLE 2.

Inhibition of SW620, SW480, and HCT116 colon cancer, HepG2 human liver, and CC2509 fibroblast cell lines by compound 15.

Compda	IC50, μMb
	SW620c	SW480d	HCT116e	HepG2f	CC‐2509g
15	0.34	0.41	0.39	102.5	10.2
HepG2 SIh	301.5	250.0	262.8	—	—
CC‐2509 SIi	30.0	24.5	26.2	—	—

^a Experiments were performed in duplicate or triplicate.

^b Half‐maximal inhibitory concentration (IC₅₀); standard errors were in the range of ±2%–10% of the reported IC₅₀ values.

^c Inhibition of growth of SW620 colon cancer cells.

^d Inhibition of growth of SW480 colon cancer cells.

^e Inhibition of growth of HCT colon cancer cells.

^f Inhibition of growth of HepG2 human liver cell line.

^g Inhibition of growth of CC2509 nontumor human fibroblast cell line.

^h HepG2 SI: selectivity indexes between IC50's of HepG2 and the indicated cell line.

ⁱ CC‐2509 SI: selectivity indexes between IC50's of CC‐2509 and the indicated cell line.

2.2.6. Compound 15 Induces Apoptosis in HCT116 CRC Cells

To assess whether the antiproliferative effect of compound 15 could be associated to induction of programmed cell death, we tested increasing concentrations of 15 in HCT116 cells, a well‐established in vitro model of CRC. We tested two different markers whose cleavage is associated with increased cell death: caspase‐3 [52] and its target poly(ADP‐ribose) polymerase (PARP) [53]. PARP is cleaved by caspase‐3 to obtain two fragments: an 89 kDa C‐terminal fragment that contains the catalytic domain and a 24 kDa N‐terminal fragment containing the DNA‐binding domain which inhibits DNA repair and ADP‐ribose formation, stimulating apoptosis [54]. Treatment with compound 15 promotes both caspase‐3 and PARP cleavage with accumulation of the proapoptotic fragments in a dose‐dependent manner (Figure 8), indicating its ability to induce programmed cell death.

FIGURE 8.

Compound 15 induces programmed cell death. Immunoblotting showing full length (FL) and cleaved (CL) PARP and cleaved caspase‐3 protein levels in HCT116 cells after a 24‐h treatment with increasing concentrations of compound 15. Vinculin is used as loading control.

2.2.7. Inhibition of TNBC Cancer Cells

Chemotherapy remains the standard treatment for triple‐negative breast cancer (TNBC). The patient's poor prognosis can be aggravated by the emergence of resistance to conventional drugs. MDA‐MB 231 and BT‐549 cancer cells are representative of highly aggressive TNBC subtypes. Compound 15 exerted a potent antiproliferative effect on MDA‐MB 231 cells (Figure 9A). Its activity was significantly superior to the reference compound SLC‐0111, an ureido‐substituted benzenesulfonamide inhibitor of CA IX ongoing Phase 1 trials in patients with advanced solid tumors [55] (Figure 9B). Likewise, 15 significantly inhibited the growth of BT‐549 cells (Figure 9C) and was superior to SLC‐0111 (Figure 9D). Most importantly, cell growth inhibition of both cell lines by 15 was almost complete al 10 μM, whereas the previously reported compound 1 achieved the same effects at 30 μM concentrations [25].

FIGURE 9.

(A) Inhibition of MDA‐MB 231 TNBC cell growth by compound 15. (B) Inhibition of MDA‐MB 231 TNBC cell growth by reference compound SLC‐0111. (C) Inhibition of BT‐549 TNBC cell growth by compound 15. (D) Inhibition of BT‐549 TNBC cell growth by reference compound SLC‐0111.

2.2.8. Metabolic Stability

The metabolic stability of compound 15 to Phase I oxidative metabolism was assessed using human and mouse liver microsomes with 7‐ethoxycoumarin and beta‐blocker propranolol as control compounds (Table 3). After incubation with mouse liver microsomes, compound 15 showed medium intrinsic clearance value of 23.2 µL/min/mg protein and t _1/2 of 63.6 min; in human liver microsomes, 15 showed medium values of 15.2 µL/min/mg protein and t _1/2 of 91.3 min. The metabolic stability values observed in both human and mouse liver microsome enzymes fell within the medium Cli range (Table 4). These findings indicate that compound 15 displays an acceptable metabolic stability profile, suggesting that it could be suitable for preliminary in vivo proof‐of‐concept studies, and more broadly support the potential of this class of compounds for further optimization and preclinical development as of novel anticancer agents. Liquid chromatography tandem mass spectroscopy (LC‐MS/MS) analyses were carried out using an ESI (+) interface in multiple reaction monitoring (MRM) mode. Conditions and MRM transitions applied to the compounds are described in Table 5.

TABLE 3.

In vitro determination of the metabolic stability after incubation with mouse and human liver microsomes.

Compda	Mouse liver microsomes (MLM)		Human liver microsomes (HLM)
	Cli ± SD, μL/min/mg protein	t 1/2 ± SD, min	Cli ± SD, μL/min/mg protein	t 1/2 ± SD, min
15	23.2 ± 8.0	63.6 ± 21.9	15.2 ± 1.2	91.3 ± 7.4
7‐ECb	80.7 ± 2.9	17.2 ± 0.6	104.1 ± 2.0	13.3 ± 0.252
Pro.c	38.6 ± 10.7	37.3 ± 10.3	84.4 ± 10.9	16.6 ± 2.1

^a Results are expressed as the mean ± SD, n = 2.

^b 7‐EC, 7‐ethoxycoumarin.

^c Pro., propranolol. The standard compounds 7‐EC and Prop. showed metabolic stability in agreement with the literature and internal validation data.

TABLE 4.

In vitro clearance classification.

Classificationa	Cli, µL/min/mg
	Low Cli	Medium Cli	High Cli
Mouse	≤2.5	2.5–66	>66
Human	≤1.8	1.8–48	>48

^a Data obtained from Lit [56, 57, 58].

TABLE 5.

Compound MRM transitions and conditions.

Compd	Parent iona	Product ionb	DP, Vc	CE, eVd
15	501.0	333.1	70	42
7‐EC	190.9	163.0	56	23
Pro.	260.4	183.2	40	25

^a Ion of the entire molecule.

^b Fragment generated from the parent ion.

^c Declustering potential (V) applied to the ion source.

^d Collision energy, energy (eV) passed to the parent ion in the collision cell.

2.2.9. Drug‐Like Properties

Prediction of drug‐like properties of 15 by the SwissADME server [59] indicated acceptable bioavailability after oral administration according to the Lipinski's [60] and Veber's rules [61] with marginal violation of the Lipinski's rule of five (Table 6) and low likelihood of in vivo toxicological outcome (3/75 rule) [65] (Figure S6).

TABLE 6.

Drug‐like properties of compound 15.

Comp	LogPa	MWb	LSwc	tPSAd	HBAe	HBDf	Rotg	Liph	Veberi	3/75j
15	4,11	500.95	−5.53	118.23	7	1	7	1	0	Low

^a Logarithm of the partition coefficient between n‐octanol and water computed by XLOGP3 method [62].

^b Molecular weight.

^c LogSw (aqueous solubility) value represents the logarithm of compound water solubility computed by the ESOL method. LogSw values predicted compounds likely to be >−10, insoluble; >−6, poorly soluble; >−4, moderately soluble; >−2, soluble; and >0, high soluble [63].

^d Molecular polar surface area, this parameter has been shown to correlate with human intestinal absorption (<140 Ų) [64].

^e Number H‐bond acceptors.

^f Number H‐bond donors.

^g Number of rotatable bonds.

^h Violation of the Lipinski rule of five (MW < 500; logP < 5; HBD ≤ 10; HBA ≤ 5) [60].

ⁱ Veber's rule matching (Rot < 10 and tPSA < 140 Ų [61].

^j 3/75 rule: LogP < 3; tPSA > 75 [65].

3. Conclusions

Polypharmacology is a promising emerging strategy to improve efficacy of anticancer treatments. Continuing our previous studies, we designed novel pyrrole (5–11) and indole (12–16) derivatives starting from the previously described compounds 1 and 2 [25] with the aim to improve selectivity of the hCA IX and XII isoforms while maintaining a valuable inhibition of Wnt/β‐catenin pathway and P‐gp. In fact, inhibition of the broadly distributed hCA I and II isoforms reduces the efficacy of the cancer treatment and causes unwanted effects [27]. The drug design was based on the observation that four out eleven binding‐site residues among the hCA I, II, IX, and XII isoforms showed small but significantly different cavity volumes; we hypothesized that the introduction of small substituents at Position 4 of the 3‐phenyl ring of pyrrole and at Position 5 of the indole could reduce the affinity for hCA I and hCA II, but not for hCA IX and hCAXII. Among tested compounds, 15 exhibited potent hCA and Wnt/β‐catenin signaling pathway inhibition, superior selectivity for both hCA IX and XII isoforms compared to the parent compounds 1 and 2, and strong inhibition of the multidrug‐resistant P‐gp‐expressing cancer cells. Compound 15 abrogated the association of β‐catenin with TCF‐4 in HEK293T cells transfected with FLAG‐tagged β‐catenin and MYC‐tagged TCF‐4. Compound 15 showed specific inhibition of the viability of the SW620, SW480, and HCT116 CRC cell lines at submicromolar concentrations, was remarkably more potent than 1 [25] and SLC‐0111 [55] against the TNBC, and restored the sensitivity to doxorubicin (DOX) in HT29/DX P‐gp‐overexpressing cells. Compound 15 showed medium metabolic stability in both human and mouse microsomes and acceptable predicted oral bioavailability. These findings indicate 15 as potential drug candidate for cancer treatment and suggest further development of this antitumor class based on the polypharmacology approach.

4. Experimental Section

4.1. Synthesis

All reagents and solvents were handled according to the material safety data sheet of the suppliers and used as purchased without further purification. Organic solutions were dried over anhydrous sodium sulfate. Evaporation of solvents was carried out on a Büchi Rotavapor R‐300 equipped with a Büchi I‐300 Pro vacuum controller, Büchi V‐300 vacuum pump, and chiller F‐305. Column chromatography was performed on columns packed with silica gel from the Macherey‐Nagel (70–230 mesh), or using the Interchim PuriFlash 5.250 chromatograph. Silica gel thin‐layer chromatography (TLC) cards from Macherey‐Nagel (silica gel‐precoated aluminum cards with a fluorescent indicator visualizable at 254 nm) were used for TLC. Developed plates were visualized with a Spectroline ENF 260C/FE UV apparatus. Melting points (mp) were determined on a Stuart Scientific SMP1 apparatus and are uncorrected. Infrared (IR) spectra were recorded on a PerkinElmer Spectrum 100 FT‐IR spectrophotometer equipped with a universal attenuated total reflectance accessory, and IR data were acquired and processed by PerkinElmer Spectrum 10.03.00.0069 software. Band position and absorption ranges are given in cm^–1. Proton nuclear magnetic resonance (¹H NMR) and carbon‐13 nuclear magnetic resonance (¹³C NMR) spectra were recorded with a Bruker Avance (400 MHz for ¹H and 100 MHz for ¹³C) spectrometer in the indicated solvent, and the corresponding fid files were processed with MestreLab Research SL MestreReNova 14.0.0‐23239 software. Chemical shifts of ¹H and ¹³C NMR are expressed in δ units (ppm) from tetramethylsilane (δ = 0). High‐resolution mass spectrometry (HRMS) analyses were performed using a microTOF‐QIII (Bruker Daltonik, Germany) mass spectrometer equipped with atmospheric pressure chemical ionization (APCI) in positive mode, capillary 4000 V, end plate offset −500 V, corona needle 3000 nA, source temperature 400°C, dry gas: N₂ at 350°C/4 L/min, nebulizer N₂, 1 Bar, m/z 80–1500, collision RF 300 Vpp, and calibration at low conc. Tuning Mix ESI/APCI (Agilent Technologies). Both monoisotopic/100% calcd and found values are reported. Ionization technique APCI⁺.

Compound purity was checked by high‐performance liquid chromatography (HPLC). The HPLC system used (Dionex UltiMate 3000, Thermo Fisher Scientific Inc.) consisted of SR‐3000 solvent rack, LPG‐3400SD quaternary analytical pump, TCC‐3000SD column compartment, DAD‐3000 diode array detector, and analytical manual injection valve with a 20 μL loop. The sample was dissolved in acetonitrile (1 mg/mL). HPLC analysis was performed using an Acclaim 120 C18 column (5 mm, 4.6 mm × 250 mm, Thermo Fisher Scientific Inc.) at 25 ± 1°C with an appropriate solvent gradient (water + 0.1% trifluoroacetic acid/acetonitrile +0.1% trifluoroacetic acid), flow rate of 1.000 mL/min, and signal detector at 206, 230, 254, and 365 nm. Chromatographic data were acquired and processed by Chromeleon 6.80 SR15b Build 4981 software (Thermo Fisher Scientific Inc.).

4.1.1. General Procedure for the Preparation of Compounds 5–16—Example: 4‐(3‐(4‐ Methylphenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (5)

Tetrabutylammonium fluoride (TBAF) (1.6 mL of solution 1.0 M in THF) was added dropwise to a solution of 4‐(3‐(4‐methylphenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐ (trimethylsilyl)ethoxy)methyl)‐benzenesulfonamide (25) (300 mg, 0.39 mmol) in anhydrous THF (8 mL). The mixture was stirred at reflux for 4 h. After cooling, the mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with brine, dried over anhydrous sodium sulfate, and filtered. Evaporation of solvent gave a residue that was purified by silica gel column chromatography (n‐hexane:ethyl acetate 1:1) to give 5 (88 mg, 45%), mp > 230°C (from ethanol). ¹H NMR (DMSO‐d ₆, 400 MHz): δ 2.29 (s, 3H), 3.74 (s, 3H), 3.79 (s, 6H), 7.11 (d, J = 8 Hz, 2H), 7.14 (s, 2H), 7.29 (d, J = 8 Hz, 2H), 7.44 (s, 2H), 7.83 (s, 1H), 7.92 (d, J = 8 Hz, 2H), 8.00 (d, J = 12 Hz, 2H), 8.05 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 20.7, 55.9, 60.1, 107.00 119.7, 119.9, 123.5, 126.3, 127.3, 128.1, 128.6, 131.1, 133.8, 135.5, 141.0, 141.1, 141.6, 152.5, 189.1 ppm. IR: ν 1180, 2956 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₇H₂₆N₂O₆S [M]⁺: 506.1506, found: 506.1501.

4.1.2. 4‐(3‐(4‐Methoxyphenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (6)

Was synthesized as 5 starting from 26. Yield 88%, mp 201°C–204°C (from ethanol). ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.74 (s, 3H), 3.75 (s, 3H), 3.79 (s, 6H), 6.87 (d, J = 8 Hz, 2H), 7.13 (s, 2H), 7.33 (d, J = 8 Hz, 2H), 7.44 (s, 2H), 7.80 (s, 1H), 7.91 (d, J = 8 Hz, 2H), 8.00 (d, J = 8 Hz, 2H), 8.05 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 55.1, 55.9, 60.1, 107.0, 113.4, 119.5, 119.9, 123.4, 126.3, 126.4, 127.3, 127.8, 129.4, 133.9, 141.0, 141.1, 141.6, 152.5, 158.0, 189.1 ppm. IR: ν 1165, 2981 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₇H₂₆N₂O₇S [M]^+: 522.1455, found: 522.1458.

4.1.3. 4‐(3‐(4‐(Dimethylamino)phenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (7)

Was synthesized as 5 starting from 27. Yield 51%, mp 215°C–218°C (from ethanol). ¹H NMR (DMSO‐d ₆ , 400 MHz): δ 2.88 (s, 6H), 3.73 (s, 3H), 3.78 (s, 6H), 6.66 (d, J = 8 Hz, 2H), 7.14 (s, 2H), 7.24 (d, J = 8 Hz, 2H), 7.44 (s, 2H), 7.73 (s, 1H), 7.91 (d, J = 8 Hz, 2H), 7.99 ppm (d, J = 8 Hz, 3H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 40.2, 55.9, 60.1, 107.0, 112.0, 118.6, 119.8, 121.9, 123.4, 126.0, 127.4, 128.4, 128.9, 133.9, 141.1, 141.4, 149.2, 152.5, 189.3 ppm. IR: ν 1119, 2981 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₈H₂₉N₃O₆S [M]⁺: 535.1771, found: 535.1775.

4.1.4. 4‐(3‐(4‐Fluorophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (8)

Was synthesized as 5 starting from 28. Yield 55%, mp 133°C–136°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.74 (s, 3H), 3.80 (s, 6H), 7.12 (d, J = 8 Hz, 2H), 7.15 (s, 2H), 7.45 (t, J = 4 Hz, 2H), 7.48 (s, 2H), 7.87 (s, 1H), 7.95 (d, J = 8 Hz, 2H), 8.01 (d, J = 8 Hz, 2H), 8.09 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.0, 60.2, 107.1, 114.7, 114.9, 120.2, 123.4, 126.7, 127.1, 127.5, 130.2, 130.3, 134.0 141.0, 141.3, 141.8, 152.6, 189.2 ppm. IR: ν 1128, 2897 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₆H₂₃FN₂O₆S [M]⁺: 510.1255, found: 510.1258.

4.1.5. 4‐(3‐(4‐Chlorophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (9)

Was synthesized as 5 starting from 29. Yield 47%, mp 221°C–224°C (from ethanol). ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.75 (s, 3H), 3.80 (s, 6H), 7.14 (s, 2H), 7.37 (d, J = 8 Hz, 2H), 7.42 (s, 2H), 7.45 (d, J = 4 Hz, 2H), 7.91 (s, 1H), 7.92 (d, J = 8 Hz, 2H), 8.01 (d, J = 8 Hz, 2H), 8.10 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.0, 60.1, 107.0, 120.1, 120.6, 123.3, 126.7, 126.8, 127.3, 127.9, 130.0, 131.0, 133.0, 133.8 140.9, 141.2, 141.8, 152.6, 189.0 ppm. IR: ν 1126, 2980 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₆H₂₃ClN₂O₆S [M]⁺: 526.0959, found: 526.0958.

4.1.6. 4‐(3‐(4‐(Trifluoromethyl)phenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (10)

Was synthesized as 5 starting from 30. Yield 60%, mp > 230°C (from ethanol). ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.74 (s, 3H), 3.81 (s, 6H), 7.17 (s, 2H), 7.46 (s, 2H), 7.62 (d, J = 8 Hz, 2H), 7.68 (d, J = 8 Hz, 2H), 7.93 (d, J = 12 Hz, 2H), 8.02–8.04 (m, 3H), 8.15 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.0, 60.1, 107.0, 120.2, 123.3, 124.8, 126.6, 127.4, 128.9, 133.7, 140.8, 141.3, 141.9, 151.2, 152.6, 161.0, 188.8 ppm. IR: ν 1120, 2901 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₇H₂₃F₃N₂O₆S [M]⁺: 560.1223, found: 560.1221.

4.1.7. 4‐(3‐(4‐Nitrophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)benzenesulfonamide (11)

Was synthesized as 5 starting from 31. Yield 7%, mp 218°C–222°C (from ethanol). ¹H NMR (CDCl₃, 400 MHz): δ 3.85 (s, 6H), 3.90 (s, 3H), 5.02 (br s, disappeared after treatment with D₂O, 2H), 7.14 (s, 2H), 7.38–7.39 (m, 1H), 7.54–7.60 (m, 2H), 7.61–7.62 (m, 3H), 8.06–8.08 (m, 2H), and 8.14–8.16 ppm (m, 2H). ¹³C NMR (CDCl₃, 100 MHz): 56.40, 61.03, 107.29, 120.48, 120.82, 123.61, 124.75, 126.73, 127.57, 128.79, 128.98, 133.70, 140.62, 140.73. 142.14, 142.39, 146.59, 153.00, 189.63 ppm. IR: ν 1125, 2904 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₆H₂₃N₃O₈S [M]⁺: 480.1349, found: 480.135.

4.1.8. 4‐(5‐Methyl‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide (12)

Was synthesized as 5 starting from 4‐(5‐methyl‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)‐benzenesulfonamide (37). Yield 17%, mp > 230°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 2.48 (s, 3H), 3.77 (s, 3H), 3.87 (s, 6H), 7.18–7.23 (m, 3H), 7.54–7.57 (m, 3H), 7.91 (d, J = 8 Hz, 2H), 8.03 (d, J = 8 Hz, 2H), 8.18 (s, 1H), 8.35 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 21.2, 56.1, 60.1, 106.3, 110.8, 116.1, 121.8, 124.9, 125.8, 127.4, 127.8, 132.3, 134.4, 135.2, 137.0, 140.4, 140.5, 142.8, 152.7, 189.0 ppm. IR: ν 1128, 2981 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₅H₂₄N₂O₆S [M]⁺: 480.1349, found: 480.135.

4.1.9. 4‐(5‐Methoxy‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide (13)

Was synthesized as 5 starting from 38. Yield 28%, mp 137°C–140°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.77 (s, 3H), 3.85 (s, 3H), 3.87 (s, 6H), 7.00–7.03 (m, 1H), 7.19 (s, 2H), 7.54 (s, 2H), 7.58 (d, J = 8 Hz, 1H), 7.89–7.92 (m, 3H), 8.02 (d, J = 8 Hz, 2H), 8.37 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 55.5, 56.1, 60.1, 104.0, 106.3, 112.1, 113.8, 116.1, 124.8, 127.4, 128.6, 130.9, 135.1, 137.1, 140.4, 140.4, 142.8, 152.7, 156.3, 189.0 ppm. IR: ν 1127, 2976 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₅H₂₄N₂O₇S [M]+: 496.1299, found: 496.1297.

4.1.10. 4‐(5‐Fluoro‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide (14)

Was synthesized as 5 starting from 39. Yield 29%, mp 132°C–135°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.76 (s, 3H), 3.86 (s, 6H), 7.19–7.25 (m, 3H), 7.56–7.67 (m, 3H), 7.93–8.03 (m, 5H), 8.50 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.0, 60.2, 107.1, 114.7, 114.9, 120.1, 123.4, 126.7, 127.1, 127.5, 130.2, 130.3, 134.0 141.0, 141.3, 141.3, 152.6, 189.2 ppm. IR: ν 1126, 2980 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₄H₂₁FN₂O6S [M]⁺: 484.1098, found: 484.1094.

4.1.11. 4‐(5‐Chloro‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide (15)

Was synthesized as 5 starting from 40. Yield 29%, mp 233°C–236°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.76 (s, 3H), 3.86 (s, 6H), 7.20 (s, 2H), 7.42 (dd, J = 8 Hz, 1H), 7.57 (s, 2H), 7.68 (d, J = 8 Hz, 1H), 7.93 (d, J = 8 Hz, 2H), 8.02 (d, J = 8 Hz, 2H), 8.35 (d, J = 2 Hz, 1H), 8.53 ppm (s, 1H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.1, 60.1, 106.4, 113.0, 115.8, 121.2, 124.4, 125.3, 127.4, 127.8, 128.7, 134.7, 138.3, 139.9, 140.7, 143.3, 152.7, 188.8 ppm. IR: ν 1124, 2980 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₄H₂₁ClN₂O₆S [M]⁺: 500.0803, found: 500.0799.

4.1.12. 4‐(5‐Bromo‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)benzenesulfonamide (16)

Was synthesized as 5 starting from 41. Yield 55%, mp 144°C–147°C. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 3.76 (s, 3H), 3.87 (s, 6H), 7.20 (s, 2H), 7.53 (d, J = 12 Hz, 1H), 7.56 (s, 2H), 7.63 (d, J = 12 Hz, 1H), 7.92 (d, J = 8 Hz, 2H), 8.03 (d, J = 8 Hz, 2H), 8.50 ppm (s, 2H). ¹³C NMR (DMSO‐d ₆, 100 MHz): δ 56.1, 60.1, 106.4, 113.4, 115.7, 115.9, 125.3, 127.0, 127.4, 129.3, 134.7, 135.0, 138.2, 139.9, 140.7, 143.3, 152.8, 188.9 ppm. IR: ν 1126, 2971 cm⁻¹. HRMS (APCI⁺), m/z calcd for C₂₄H₂₁BrN₂O₆S [M]⁺: 544.0298, found: 544.0296.

4.1.13. General Procedure for the Preparation of Compounds 25–31—Example: 4‐(3‐(4‐Methylphenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (25)

A mixture of 17 (292 mg, 0.8302 mmol), 24 (536 mg, 1.079 mmol), CuI (79 mg, 0.4151 mmol), Cs₂CO₃ (406 mg, 1.245 mmol), 1,10‐phenanthroline (15 mg, 0.083 mmol), and dioxane (6 mL) was charged in a microwave reaction vessel. The mixture was placed into the microwave cavity (close vessel mode, Pmax 200 PSI). Microwave irradiation of 50 W was used at first and then rose up 200 W. The temperature was ramped from 25°C to 210°C. Once it was reached, taking around 7 min, the mixture was held at this temperature for 40 min. After cooling, the mixture was diluted with water and extracted with ethyl acetate. The organic layer was washed with brine, dried on anhydrous sodium sulfate, and filtered. Removal of the solvent gave a residue that was purified by silical gel column chromatography (cyclohexane:ethyl acetate, 8:2) to give 25 (374 mg, 44%) as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.10 (s, 18H), 0.74 (t, J = 8 Hz, 4H), 2.27 (s, 3H), 3.36 (t, J = 8 Hz, 4H), 3.72 (s, 3H), 3.76 (s, 6H), 4.75 (s, 4H), 7.08–7.10 (m, 2H), 7.11 (s, 2H), 7.26 (d, J = 8 Hz, 2H), 7.83–7.84 (m, 1H), 7.93–7.95 (m, 2H), 8.01–8.04 ppm (m, 3H). R: ν 1129, 2848 cm⁻¹.

4.1.14. 4‐(3‐(4‐Methoxyphenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (26)

Was synthesized as 25 starting from 18. Yield 59% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.08 (s, 18H), 0.76 (t, J = 8 Hz, 4H), 3.38 (t, J = 12 Hz, 4H), 3.73 (s, 3H), 3.75 (s, 3H), 3.78 (s, 6H), 4.76 (s, 4H), 6.88 (d, J = 8 Hz, 2H), 7.12 (s, 2H), 7.32 (d, J = 8 Hz, 2H), 7.83–7.84 (m, 1H), 7.95 (d, J = 8 Hz, 2H), 8.02–8.04 ppm (m, 3H). IR: ν 1133, 2841 cm⁻¹.

4.1.15. 4‐(3‐(4‐Dimethylamino)phenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (27)

Was synthesized as 25 starting from 19. Yield 65% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.08 (s, 18H), 0.76 (t, J = 8 Hz, 4H), 2.88 (s, 6H), 3.37 (t, J = 8 Hz, 4H), 3.73 (s, 3H), 3.77 (s, 6H), 4.75 (s, 4H), 6.66 (d, J = 8 Hz, 2H), 7.12 (s, 2H), 7.23 (d, J = 8 Hz, 2H), 7.76–7.77 (m, 1H), 7.94 (d, J = 8 Hz, 2H), 8.02 ppm (d, J = 8 Hz, 3H). IR: ν 1129, 2890 cm⁻¹.

4.1.16. 4‐(3‐(4‐Fluorophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (28)

Was synthesized as 25 starting from 20. Yield 49% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.09 (s, 18H), 0.72–0.76 (m, 4H), 3.32–3.36 (m, 4H), 3.73 (s, 3H), 3.78 (s, 6H), 4.75 (s, 4H), 7.10 (s, 2H), 7.11–7.16 (m, 2H), 7.40–7.43 (m, 2H), 7.88–7.89 (m, 1H), 7.93–7.96 (m, 2H), 8.01–8.04 (m, 2H), 8.08 ppm (d, J = 4 Hz, 1H). IR: ν 1137, 2886 cm⁻¹.

4.1.17. 4‐(3‐(4‐Chlorophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (29)

Was synthesized as 25 starting from 21. Yield 27%, as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.10 (s, 18H), 0.72–0.76 (m, 4H), 3.33–3.39 (m, 4H), 3.73 (s, 3H), 3.78 (s, 6H), 4.74 (s, 4H), 7.11 (s, 2H), 7.35–7.42 (m, 4H), 7.93–7.96 (m, 3H), 8.02–8.04 (m, 2H), 8.08–8.09 ppm (m, 1H). IR: ν 1168, 2822 cm⁻¹.

4.1.18. 4‐(3‐(4‐(Trifluoromethyl)phenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (30)

Was synthesized as 25 starting from 22. Yield 68% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.08 (s, 18H), 0.76 (t, J = 8 Hz, 4H), 3.39 (d, J = 8 Hz, 4H), 3.74 (s, 3H), 3.80 (s, 6H), 4.76 (s, 4H), 7.15 (s, 2H), 7.61 (d, J = 8 Hz, 2H), 7.67 (d, J = 8 Hz, 2H), 7.97 (d, J = 8 Hz, 2H), 8.07 (d, J = 8 Hz, 3H), 8.15 ppm (s, 1H). IR: ν 1159, 2841 cm^{− 1}.

4.1.19. 4‐(3‐(4‐Nitrophenyl)‐4‐(3,4,5‐trimethoxybenzoyl)‐1H‐pyrrol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (31)

Was synthesized as 25 starting from 23. Yield 55% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.08 (s, 18H), 0.76 (t, J = 8.0 Hz, 4H), 3.37–3.39 (m, 4H), 3.75 (s, 3H), 3.81 (s, 6H), 4.76 (s, 4H), 7.17 (s, 2H), 7.67–7.70 (m, 2H), 7.98 (d, J = 8.0 Hz, 2H), 8.08 (d, J = 8.0 Hz, 2H) and 8.16–8.20 ppm (m, 4H). IR: ν 1164, 2830 cm⁻¹.

4.1.20. 4‐(5‐Methyl‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (37)

Was synthesized as 25 starting from 32. Yield 21% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.10 (s, 18H), 0.76 (t, J = 8 Hz, 4H), 2.48 (s, 3H), 3.41 (t, J = 8 Hz, 4H), 3.76 (s, 3H), 3.85 (s, 6H), 4.79 (s, 4H), 7.17 (s, 2H), 7.21 (d, J = 8 Hz, 1H), 7.54 (d, J = 4 Hz, 1H), 7.92 (d, J = 8 Hz, 2H), 8.06 (d, J = 8 Hz, 2H), 8.18 (s, 1H), 8.23 ppm (s, 1H). IR: ν 1142, 2888 cm⁻¹.

4.1.21. 4‐(5‐Methoxy‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (38)

Was synthesized as 25 starting from 33. Yield 54% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.08 (s, 18H), 0.76 (t, J = 8 Hz, 4H), 3.38 (t, J = 8 Hz, 4H), 3.76 (s, 3H), 3.85 (s, 3H), 3.86 (s, 6H), 4.76 (s, 4H), 7.00 (dd, J = 2 and 9 Hz, 1H), 7.12 (s, 2H), 7.56 (d, J = 9 Hz, 1H), 7.89 (d, J = 2 Hz, 1H), 7.92 (d, J = 9 Hz, 2H), 8.06 (d, J = 9 Hz, 2H), 8.25 ppm (s, 1H). IR: ν 1131, 2838 cm⁻¹.

4.1.22. 4‐(5‐Fluoro‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (39)

Was synthesized as 25 starting from 34. Yield 77% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.09 (s, 18H), 0.74–0.78 (m, 4H), 3.42 (t, J = 8 Hz, 4H), 3.76 (s, 3H), 3.86 (s, 6H), 4.79 (s, 4H), 7.19 (s, 2H), 7.22–7.28 (m, 1H), 7.54 (d, J = 4 Hz, 1H), 7.92 (d, J = 8 Hz, 2H), 8.06 (d, J = 8 Hz, 2H), 8.18 (s, 1H), 8.40 ppm (s, 1H). IR: ν 1158, 2890 cm⁻¹.

4.1.23. 4‐(5‐Chloro‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (40)

Was synthesized as 25 starting from 35. Yield 21% as an oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.02 (s, 18H), 0.84–0.89 (m, 4H), 3.55 (t, J = 8 Hz, 4H), 3.93 (s, 3H), 3.96 (s, 6H), 4.88 (s, 4H), 7.15 (s, 2H), 7.32–7.25 (m, 1H), 7.71–7.74 (m, 2H), 7.81 (d, J = 8 Hz, 1H), 7.83–7.85 (m, 2H), 8.15 (s, 1H), 8.45 (d, J = 3 Hz, 1H) ppm. IR: ν 1154, 2883 cm⁻¹.

4.1.24. 4‐(5‐Bromo‐3‐(3,4,5‐trimethoxybenzoyl)‐1H‐indol‐1‐yl)‐N,N‐bis((2‐(trimethylsilyl)ethoxy)methyl)benzenesulfonamide (41)

Was synthesized as 25 starting from 36. Yield 10% as oil. ¹H NMR (DMSO‐d ₆, 400 MHz): δ 0.09 (s, 18H), 0.73–0.78 (m, 4H), 3.38 (t, J = 8 Hz, 4H), 3.74 (s, 3H), 3.79 (s, 6H), 4.76 (s, 4H), 7.13 (s, 2H), 7.48–7.51 (m, 2H), 7.95–7.97 (m, 3H), 8.04–8.06 (m, 2H), 8.11 ppm (s, 1H). IR: ν 1162, 2850 cm⁻¹.

4.2. Molecular Modeling

The molecular docking experiments were run on a 64 cores machine using Ubuntu 20.04 LTS. The crystal structures of the considered hCA isoforms in complex with sulfonamide inhibitors were downloaded from the PDB (https://www.rcsb.org/): hCA I (PDB ID: 7Q0D) [35], hCA II (PDB ID: 5E2R) [34], hCA IX (PDB ID: 5FL4) [36], and hCA XII (PDB ID: 6G7A) [37]. Protein preparation was accomplished by the addition of hydrogen atoms, missing side chains, and missing loops along with the removal of unnecessary chains, water molecules, and other solvents. Protonation states of the compounds were calculated at physiological pH and the resulting structures were energetically minimized using the OPLS4 force field. Maestro [66] was used for both protein and ligand preparation [67]. Structure of hCA II was selected as reference, and all prepared proteins were aligned to it by UCSF Chimera (default settings) [68]. The geometric center of its crystallized ligand was utilized as docking center, while grid box sizes were manually adjusted using AutoDockTools 1.5.7 [69]. Conversion of files into PDBQT format was executed by OpenBabel 3.0.1 [70]. The AutoDock4 scoring function and an exhaustiveness of 32 were applied during docking experiments with AutoDock Vina 1.2.3 [71] and AutoDock4Zn force field [72]. The latter was chosen because of its the charge‐independent approach to dock inhibitors whose zinc interaction is mediated by uncharged groups with electron lone pairs, like sulfonamide. Generation of the grid maps and execution of docking calculations were run automatically by an in‐house and virtual screening by a Python 2.7 code. RMSD values during validation re‐docking procedure was calculated by DockRMSD [73]. The volume of the studied isoform was computed by SiteMap of Schrodinger Suite [74]. The structures used for volume computation were chosen without inhibitors or with the smallest cocrystallized ligand to reduce induced fit modification of the site at the higher possible resolution: CA_I PDB ID: 1HCB [75], CA_II PDB ID: 1AM6 [76], CA_IX PDB ID: 6RQN [77], and CA_XII PDB ID: 1JCZ [78].

4.3. CA Inhibition Screening Assay

An applied photophysics stopped flow instrument was used for assaying the CA catalyzed CO₂ hydration activity [37]. Phenol red (at a concentration of 0.2 mM) was used as an indicator, working at the maximum absorbance of 557 nm, with 20 mM HEPES (pH 7.5) as buffer and 20 mM sodium sulfate (for maintaining constant ionic strength). The initial rates of the CA‐catalyzed CO₂ hydration reaction were followed for a period of 10−100 s. The CO₂ concentrations ranged from 1.7 to 17 mM for the determination of the kinetic parameters and inhibition constants. For each inhibitor, at least six traces of the initial 5%−10% of the reaction were used for determining the initial velocity. The uncatalyzed rates were determined in the same manner and subtracted from the total observed rates. Stock solutions of the inhibitor (0.1 mM) were prepared in distilled−deionized water, and dilutions up to 0.01 nM were carried out thereafter with distilled−deionized water. Inhibitor and enzyme solutions were preincubated together for 15 min at room temperature prior to assay to allow for the formation of the enzyme−inhibitor complex. The inhibition constants were obtained by nonlinear least‐squares methods using the Cheng−Prusoff equation and represent the mean from at least three different determinations. Standard deviations were in the range of ±5%−10% of the reported K _i values. CA isoforms were recombinant enzymes obtained in house as reported previously [79, 80, 81]. The enzyme concentrations in the assay system were as follows: hCA I, 13.2 nM; hCA II, 8.4 nM; hCA IX, 7.9 nM; and hCA XII, 15.2 nM.

4.4. Luciferase Assay

Wnt/β‐catenin reporter assay was performed as previously described [82]. HEK293T cells were transfected with M50 Super 8x TOPFlash (Addgene #12456) or the FOP control plasmid (M51 Super 8x FOPFlash Addgene #12457) in combination with TK Renilla (Promega #E2241) using DreamFect Gold (OZ Biosciences #DG80500) according to the manufacturer's instructions. After 24 h, cells were incubated with starvation media (Opti‐MEM reduced serum medium supplemented with 0.5% FBS, 1% penicillin/streptomycin, 1% sodium pyruvate, and 1% nonessential amino acids) for 8 h. After starvation, Wnt/β‐catenin signaling was activated by treating cells with 50 mM LiCl in starvation media for 24 h. The following day, cells were treated with 15 or vehicle (DMSO) for 24 h. At the end of the experiment, cells were lysed using Passive Lysis Buffer (Biotium #99912). D‐Luciferin (#10101 Biotium) was diluted in the noncommercial luciferase buffer [83] at a final concentration of 40 µg/ml. Coelenterazine (#S053 Synchem) was diluted in PBS with Ca²⁺ and Mg²⁺ at a final concentration of 0,75 µg/mL. Luminescence was measured using the GloMax Discover Microplate Reader (Promega).

4.5. Coimmunoprecipitation

HEK293T cells were transfected with pcDNA/Myc TCF‐4 (Addgene #16512) and human β‐catenin pcDNA3 (#16828 Addgene). The day after, cells were pretreated with starvation medium for 8 h as described above and then cotreated with 50 mM LiCl and DMSO or 60 μM compound 15 for 24 h. Cells were collected and lysed in a buffer containing 0.5% Triton X‐100, 0.5 mM EDTA, and 1 mM DTT supplemented with protease inhibitor cocktail (#S8820‐20TAB Sigma–Aldrich). Before immunoprecipitation, 5% of the whole protein extract was saved as Input. The remaining 95% was incubated with 30 μL of anti‐FLAG M2 affinity gel (#A2220 Sigma–Aldrich) and incubated overnight at 4°C. Complexes were washed and the FLAG‐tagged β‐catenin protein was eluted with reducing sample buffer. Western blot analysis was performed as described above.

4.6. Western Blot

Western blot was performed as previously described [84]. Briefly, cells were lysed in SDS‐urea buffer (50 mM Tris HCl, pH 7.8, and 2% SDS), 10% glycerol, 10 mM Na₄P₂O₇ (tetrasodium pyrophosphate), 100 mM NaF, 6 M urea, and 10 mM EDTA. Protein extracts were then sonicated and resolved via SDS‐PAGE before transferring to a nitrocellulose membrane (NBA085C001EA, PerkinElmer). Membranes were blocked with 5% milk in 0.1 M tris buffered saline with 0.1% Tween‐20 (TBS‐T) and incubated with primary antibodies overnight. The following day, the membranes were washed in TBS‐T and then incubated with secondary antibodies for 30 min. Detection of the horseradish peroxidase signal was performed using WesternBright ECL (#K‐12045‐D50, Advansta). The following antibodies were used: anti‐MYC (#9402 Cell Signaling 1:2000), anti‐PARP (#9542 Cell Signaling 1:1000), anticleaved caspase 3 (#9661 Cell Signaling 1:1000), antivinculin (#sc‐73614 Santa Cruz Biotechnology), anti‐FLAG‐HRP (#A8592 Sigma–Aldrich), and anti‐MYC‐Tag‐HRP (sc‐40HRP, Santa Cruz Biotechnology).

4.7. Quantitative Real‐Time PCR

Quantitative real‐time PCR was performed as previously described [85]. Briefly, total RNA was extracted using TRIzol reagent (#15596026, Thermo Fisher) according to the manufacturer's instructions. One microgram of total RNA was reverse‐transcribed with SensiFAST cDNA Synthesis Kit (#BIO‐65053, Meridian Bioscience). Real‐time PCR was performed using SensiFast Sybr Lo‐Rox Mix (#BIO‐94020, Meridian Bioscience), and transcript levels were quantified with a ViiA 7 Real‐Time PCR System 36 instrument (Applied Biosystems) using the following primers:

• •SALL‐4 fw: ATTTGTGGGACCCTCGACAT
• •SALL‐4 rev: TTAAGTTGCCTTTGGTGGTA
• •FGF‐20 fw: TAGAGGTGTGGACAGTGGTCTC
• •FGF‐20 rev: CTTCAAACTGCTCCCTAAAGATGC
• •MYC fw: CACCACCAGCAGCGACTCT
• •MYC rev: TTCCACAGAAACAACATCGATTTC
• •β‐Actin fw: CACCATTGGCAATGAGCGGTCGTTC
• •β‐Actin rev: AGGTCTTTGCGGATGTCCACGT

4.8. Intracellular DOX Accumulation

Cells were incubated 3 h with 5 µM DOX, alone or with compound 15 at 1, 10, or 100 nM, washed with PBS, trypsinized, centrifuged at 13,000 × g for 5 min, and resuspended in 0.5 mL of 1/1 solution ethanol/0.3 N HCl. A 50 µL aliquot was sonicated and used for the measurement of the protein content. The intracellular fluorescence of DOX was measured spectrofluorimetrically, using a Synergy HTX microplate reader. Excitation and emission wavelengths were 475 and 553 nm. Fluorescence was converted in nmol/mg cell proteins, using a calibration curve previously set.

4.9. ATPase Activity

The P‐gp ATPase activity was measured in membrane vesicles, extracted from HT29/DX or MDCK/P‐gp cells treated for 3 h with 1, 10, or 100 nM compound 15, as described previously [53]. Cells were washed with Ringer's solution (148.7 mM NaCl, 2.55 mM K₂HPO₄, 0.45 mM KH₂PO₄, and 1.2 mM MgSO₄; pH 7.4), lysed on crushed ice with lysis buffer (10 mM HEPES/Tris, 5 mM EDTA, 5 mM EGTA, and 2 mM dithiothreitol; pH 7.4) supplemented with 2 mM phenylmethylsulfonyl fluoride, 1 mM aprotinin, 10 μg/mL pepstatin, and 10 μg/mL leupeptin, and subjected to nitrogen cavitation at 1200 psi for 20 min. Samples were centrifuged at 300g for 10 min in the precentrifugation buffer (10 mM Tris/HCl, 25 mM sucrose; pH 7.5), overlaid on a sucrose cushion (10 mM Tris/HCl, 35% w/v sucrose, 1 mM EDTA; pH 7.5), and centrifuged at 14,000 g for 10 min. The interface was collected, diluted in the centrifugation buffer (10 mM Tris/HCl, 250 mM sucrose; pH 7.5), and subjected to a third centrifugation at 100,000 g for 45 min. The vesicle pellet was resuspended in 0.5 mL centrifugation buffer and stored at −80°C until use, after quantification of the protein content. One milligram of total protein was immunoprecipitated with the anti‐P‐gp or anti‐MRP1 antibody. One hundred micrograms of each immunopurified protein was incubated for 30 min at 37°C with 50 μL of the reaction mixture (25 mM Tris/HCl, 3 mM ATP, 50 mM KCl, 2.5 mM MgSO₄, 3 mM dithiothreitol, 0.5 mM EGTA, 2 mM ouabain, and 3 mM NaN₃; pH 7.0). The reaction was stopped by adding 0.2 mL of ice‐cold stopping buffer (0.2% w/v ammonium molybdate, 1.3% v/v H₂SO₄, 0.9% w/v SDS, 2.3% w/v trichloroacetic acid, and 1% w/v ascorbic acid). After 30‐min incubation at room temperature, the absorbance of the phosphate hydrolyzed from ATP was measured at 620 nm, using a Synergy HTX microplate reader. The absorbance was converted into nmoles hydrolyzed phosphate (Pi)/min/mg protein, according to the titration curve previously prepared.

4.10. Statistical Analysis

All data in the text and figures are provided as means ± SD. The results were analyzed by a one‐way analysis of variance (ANOVA), Student's t‐test, and Tukey's test. p < 0.05 was considered significant.

4.11. Cell Cultures

HEK293T and HCT116 cells were grown in DMEM (41965‐039, GIBCO) supplemented with 10% FBS (10270, GIBCO, Thermo Fisher Scientific), 1% v/v glutamine (G7513, Sigma–Aldrich) and 1% v/v pen/strep (15070‐063, GIBCO). All cell lines used were confirmed mycoplasma‐free via PCR using Mycoplasma PCR Detection Kit (#G238, Applied Biological Materials [ABM]) following the manufacturer's protocol. HT29 colon cancer cells were purchased from ATCC (Manassas, VA). These cells were cultured in RPMI 1640 medium supplemented with 10% v/v FBS, 1% v/v penicillin−streptomycin, and 1% v/v L‐glutamine. Human HT29/DX cells were generated by stepwise selection in medium with an increasing concentration of DOX, as described previously [53], and maintained in culture medium with a final concentration of 200 nM DOX. MDCK and MDCK/P‐gp (a gift of Prof. P. Borst, NKI‐AVL Institute, Amsterdam, The Netherlands) were grown in DMEM high glucose supplemented with 10% FBS, 1% penicillin, 1% v/v penicillin−streptomycin, and 1% v/v glutamine. All cell lines were authenticated by microsatellite analysis using the PowerPlex kit (Promega Corporation, Madison, WI; last authentication: January 2022). SW620, SW480, HCT116, HepG2, and CC2509 cells were obtained from the American Type Culture Collection (ATCC), Rockville, MD, and grown in DMEM supplemented with 10% FBS. Human MDA‐MB‐231 TNBC cells (ATCC HTB‐26) were grown in DMEM supplemented with 10% FCS, while TNBC cells BT‐549 (ATCC HTB‐122) were grown in RPMI plus 10% FBS and 1 μg/mL bovine insulin.

4.12. Cell Viability Assays

HT29, HT29/DX, MDCK, and MDCK/P‐gp cells were seeded in 96‐well plates. In the first experimental set, cells were incubated for 72 h with DMSO as a solvent or compound 15 at the following concentrations: 0.1, 1, 10, 100 nM, 1, and 10 μM. In the second experimental set, cells were incubated for 72 h with 5 μM DOX alone or with 15 at 1, 10, or 100 nM. Cell viability was evaluated using the WST‐1 assay (Sigma‐Merck), as per the manufacturer's instructions, using a Synergy HTX microplate reader (Bio‐Tek Instruments, Winooski, VT). The absorbance units of the untreated cells were considered 100%; the absorbance units of the other experimental conditions were expressed as a percentage versus the absorbance units of the untreated cells.

The MTT [86] assay, an index of early toxicity, was performed in the CRC SW620, SW480, HCT116, and HepG2 cell lines and in fibroblasts, seeded at a density of 2 × 10⁴ cells per well in round‐bottom 96‐well plates. After a 24‐h incubation, cells were treated for 72 h with the compounds at 100, 50, 10, and 1 μM, using compound vehicle DMSO at 1% as a control. After the incubation period, plates were washed with PBS and incubated for 4 h with 100 μL per well of 0.5 mg/mL MTT (Merck, Darmstadt, Germany). Then, formazan crystals were dissolved using DMSO (100 μL per well) with gentle rocking at room temperature for 1 h. Absorbance was measured at 570 and 630 nm. The assays were performed in triplicate. The half‐maximal inhibitory concentration (IC₅₀) value of compounds was determined by regression analysis, using “Quest GraphTM IC50 Calculator” from AAT Bioquest (www.aatbio.com).

Human MDA‐MB‐231 and BT‐549 TNBC cells were kept at low passage, returning to the original frozen stocks every 3−4 months. Hypoxic culture conditions were realized in the presence of 1% O₂ and 5% CO₂. The different cell lines were seeded 10,000 cells/well in 48‐well plates and treated in 1%FBS with increasing concentrations of compound 15 or reference SLC‐0111. After 72‐h of incubation at 37°C with 1% O₂ and 5%CO₂, cells were trypsinized, and cell counting was performed with the MACSQuant analyzer (Miltenyi Biotec) [87]. Potential toxicity on healthy cells was evaluated by treating human primary T lymphocytes from two healthy donors with 30 μM 15 or with a control vehicle (DMSO). Healthy donors’ peripheral blood mononuclear cells (PBMCs) were isolated by Lymphoprep (Nycomed) gradient centrifugation. T lymphocytes were negatively selected from PBMCs using magnetic Dynabeads Untouched Human T Cells Kit (Thermo Fisher Scientific) following the manufacturer's instructions. Apoptotic cell death was evaluated using APC Annexin‐V Apoptosis Detection Kit with PI (Thermo Fisher Scientific). Briefly, 1.5 × 10⁶/mL T cells were cultured in 48‐well plates, untreated or treated with 15 at 30 μM for 72 h. Cells were then stained using annexin‐V/APC and propidium iodide according to the manufacturer's instruction. Cell populations were acquired using a FACS Canto II flow cytometer (BD Biosciences). Flow cytometric analysis was performed using FlowJo Flow Cytometric Analysis Software.

4.13. In Vitro Oxidative Metabolic Stability

Intrinsic clearance of microsomes as measure of the metabolic capability of the liver [88]. Mouse (Sigma–Aldrich, CD‐1 male, pooled) and human (Sigma–Aldrich, human, pooled) microsomes at 0.5 mg/mL were preincubated for 10 min at 37°C with the test compound 15 dissolved in DMSO at 1 μM in 50 mM phosphate buffer (pH 7.4) containing 3 mM MgC_l2. The reaction was then started by adding the cofactor mixture solution (NADP, glucose‐6‐phosphate, glucose‐6‐phosphate dehydrogenase in 2% NaHCO₃). Samples were taken at 0,10, 30, 45, and 60 min and added to acetonitrile to stop the reaction. Samples were then centrifuged, and the supernatants were analyzed by LC‐MS/MS to quantify the amount of compound. A control sample without cofactor was always added to check the chemical stability of the test compound. Two reference compounds of known metabolic stability, 7‐EC and propranolol, were always used as controls. A fixed concentration of verapamil was added in every sample as an internal standard for LC‐MS/MS analyses. The percentage of the area of the test compound remaining at the various incubation times was calculated with respect to the area of the compound at time 0 min. The intrinsic clearance (Cli) was calculated by the following equation:

$$\mathrm{Cli}(\mathrm{L}/\min /\mathrm{mg})=k/\mathrm{microsomalconc}.\times 1000$$

where k is the rate constant (min⁻¹) and microsomal protein conc. = 0.5 mg protein/mL. The rate constant, k (min⁻¹) derived for the exponential decay equation (peak area/IS vs. time), was used to calculate the rate of Cli. Classification of in vitro stability is presented in Table 4.

4.14. LC−MS/MS Analytical Method

Samples were analyzed under the following conditions: UPLC Waters coupled with an API 3200 triple quadrupole (AB Sciex); eluents, (Phase A) 95% water and 5% acetonitrile +0.1% HCOOH, (Phase B) 5% water, 95% acetonitrile +0.1% HCOOH; flow rate, 0.3 mL/min; column, Gemini‐Nx 5 μm C18110A (50 × 2.00 mm) at 35°C; injection volume, 10 μL. Source conditions ESI positive: T 400°C, Gas 1 30, Gas 2 35, CUR 30, IS5500, CAD 5 [49, 89, 90, 91, 92].

Supporting Information

Additional Supporting Information can be found online in the Supporting Information section. Supporting Fig. S1: Fasta sequence of the CA_I, CA_II, CA_IX, and CA_XII. The asterisk (*) indicates conserved residue, colon (:) signifies a highly conserved residue, and period (.) denotes a semiconserved substitution. Binding‐site residues are reported with bold red character. Supporting Fig. S2: Proposed binding mode of derivative 15 (cyan). Enzymes are reported as colored cartoon: CA I, light blue; CA II, green; CA IX, gray; and CA XII, sand. Zinc atom is depicted as green sphere, and residues involved in interactions are reported as white lines. Residues 131 and 204 involved in selectivity are reported as white stick. H‐bonds are depicted as yellow dot lines. For clarity the residues numbers are to be referred to hCA II. Supporting Fig. S3: Dose‐dependent viability of HT29 and HT29/DX (A) and MDCK and MDCK/P‐gp (B) cells. The cells were incubated with increasing concentrations (0–10 µM) of compound 15 for 72 h, measured with a spectrophotometric assay. Data are means ± SD (n = 3). **p < 0.01 and ***p < 0.001: versus untreated cells (“0”). Supporting Fig. S4: Intracellular accumulation of DOX in HT29 and HT29/DX cells (A) and in MDCK and MDCK/P‐gp cells (B), incubated 3 h with 5 μM DOX, in the absence (“0”) or presence of compound 15 at 1, 10, or 100 nM. Intracellular drug retention was measured spectrofluorimetrically. Data are means ± SD (n = 3). ***p < 0.001: versus HT29 or MDCK cells treated with DOX alone; °°p < 0.01 and °°°p < 0.001: versus HT29/DX or MDCK/P‐gp cells treated with DOX alone. Supporting Fig. S5: P‐gp ATPase activity, measured spectrophotometrically on the protein immune‐purified from HT29/DX cells (A) or MDCK/P‐gp (B) cells, treated 3 h without (“0”) or with compound 15 at 1, 10, and 100 nM. Data are means + SD (n = 3). *p < 0.05 and ***p < 0.001: vs. untreated (“0”) cells. Supporting Fig. S6: Radar plot of drug‐like properties of compound 15. The green colored zone represents acceptable physicochemical properties for oral bioavailability. −1 < LogP < 5; 150 < MW < 500; <tPSA < 140 Ų; −10 < LogS < 0; 0 < HB D+A < 10; 0 < RotBonds < 10. The red line represents values for derivative 15. Supporting Table S1: Rate of ATP hydrolysis in HT29/DX and MDCK‐Pgp cells upon treatment with increasing concentrations of compound 15.^a

Funding

This work was supported by the Fondazione AIRC per la ricerca sul cancro ETS (24703, 25833, 29250, 23151), Fondazione Telethon (23151), Sapienza Università di Roma (23151, RM120172A7EAD07C, RG123188B4D193AE, RM12218167FD3A37, RG120172AD61BE52, RD12318AAC98A625, Progetti Avvio alla Ricerca), Ministero dell’Istruzione, dell’Università e della Ricerca (MUR PRIN 2022 2022TPPNTK, MUR PRIN 2022HMJLN, PRIN PNRR P202243FBL), Ministerio de Universidades (PID2022‐136654OB‐I00), and New Technologies for Translational Research in Pharmaceutical Sciences/NETPHARM (ID CZ.02.01.01/00/22_008/0004607).

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supplementary Material

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.