Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2026 Feb 26.
Published in final edited form as: Chem Phys Lipids. 2023 Oct 17;257:105350. doi: 10.1016/j.chemphyslip.2023.105350

Saturation of fatty acids in phosphatidic acid uniquely alters transthyretin stability changing morphology and toxicity of amyloid fibrils

Abid Ali a, Kiryl Zhaliazka a, Tianyi Dou a, Aidan P Holman a,b, Dmitry Kurouski a,c,*
PMCID: PMC12935472  NIHMSID: NIHMS2141826  PMID: 37858615

Abstract

Transthyretin (TTR) is a small, β-sheet-rich tetrameric protein that transports thyroid hormone thyroxine and retinol. Phospholipids, including phosphatidic acid (PA), can uniquely alter the stability of amyloidogenic proteins. However, the role of PA in TTR aggregation remains unclear. In this study, we investigated the effect of saturation of fatty acids (FAs) in PA on the rate of TTR aggregation. We also reveal the extent to which PAs with different length and saturation of FAs altered the morphology and secondary structure of TTR aggregates. Our results showed that TTR aggregation in the equimolar presence of PAs with different length and saturation of FAs yielded structurally and morphologically different fibrils compared to those formed in the lipid-free environment. We also found that PAs drastically lowered the toxicity of TTR aggregates formed in the presence of this phospholipid. These results shed light on the role of PA in the stability of TTR and transthyretin amyloidosis.

Keywords: Transthyretin, Phosphatidic acid, AFM-IR, Toxicity, Oligomers, Fibrils

1. Introduction

Abrupt aggregation of misfolded proteins is the expected underlying cause of numerous pathologies, including Alzheimer’s and Parkinson’s diseases (Braak and Braak, 1991; Cherny et al., 1999; Chiti and Dobson, 2017; Knowles et al., 2014). As a result, proteins form highly toxic oligomers that exhibit a large variety of shapes and forms (Hardy and Selkoe, 2002; Nelson and Eisenberg, 2006b). These aggregates can further propagate into amyloid fibrils, long β-sheet structures that propagate microns in length (Eisenberg and Sawaya, 2017; Gallardo et al., 2020; Ghosh et al., 2021; Nelson and Eisenberg, 2006a, b). A growing body of evidence indicates that lipids can uniquely alter protein stability (Galvagnion et al., 2016; Galvagnion et al., 2015). Specifically, zwitterionic lipids strongly inhibited aggregation of insulin and lysozyme, whereas anionic lipids, such as phosphatidylserine (PS) and cardiolipin (CL), on the opposite, accelerated the aggregation of these proteins (Zhaliazka and Kurouski, 2022). In addition to the charge of their polar head groups, the length and saturation of fatty acids in lipids could play an important role in the stability of amyloidogenic proteins (Matveyenka et al., 2022b, c, d). Specifically, Matveyenka and co-workers demonstrated that the presence of unsaturated FAs in CL resulted in a much greater acceleration of insulin aggregation compared CL that possessed fully saturated FAs (Matveyenka et al., 2022d; Matveyenka et al., 2023). It was also found that insulin fibrils formed in the presence of CL with saturated and unsaturated FAs had drastically different secondary structure. As a result, these two types of protein aggregates exerted drastically different cell toxicity (Matveyenka et al., 2022b, 2022c, 2022d).

Phosphatidic acid (PA) is a unique anionic phospholipid that has no head group, whereas sn-1 and sn-2 positions in PA are typically esterified to saturated and unsaturated FAs (Stace and Ktistakis, 2006). PA is present in plasma membranes where it controls membrane fusion and fission, highly important steps in vesicle trafficking (McMahon and Gallop, 2005). PA is also involved in the activation of lipid-gated ion channels.(Bader and Vitale, 2009; Tanguy et al., 2019) This lipid is also the major constituent of lung surfactant (Fitzner et al., 2020; Mizuno et al., 2017). Recently reported results by Matveyenka and co-workers suggest that PA can uniquely alter insulin stability (Matveyenka et al., 2022c). The researchers found that the effect was dictated by the length and saturation of FAs in PAs (Matveyenka et al., 2022c). For instance, PA that possessed palmitic acids (saturated FAs with 16 carbons C16:0, PA-C16:0) strongly inhibited protein aggregation, whereas PAs that had stearic (18 carbons C18:0 FAs, PA-C18:0) and oleic acids (unsaturated FAs with one double bond C18:1 FAs, PA-C18:1), on the opposite, accelerated insulin fibrillization. It was also found that insulin fibrils formed in the presence of PA-C16:0 had drastically different secondary structures compared to insulin fibrils grown in the presence of PA-C18:0 and PA-C18:1 (Matveyenka et al., 2022c). This information was revealed using nano-Infrared spectroscopy, also known as atomic force microscopy Infrared (AFM-IR) spectroscopy (Kurouski et al., 2020; Rizevsky et al., 2022; Ruggeri et al., 2020). In AFM-IR, the scanning probe can be positioned directly at the sample of interest (Centrone, 2015; Dazzi and Prater, 2017; Dou et al., 2020). Next, the sample is illuminated by pulsed tunable IR light, which causes thermal expansions in the protein aggregates.(Ramer et al., 2018; Ruggeri et al., 2018a; Ruggeri et al., 2018b; Ruggeri et al., 2016) These thermal expansions, which are equivalent to the IR fingerprint of the sample, are then recorded by the scanning probe (Chae et al., 2017; Chae et al., 2016; Latour et al., 2016; Mayet et al., 2008; Ruggeri et al., 2020). Results reported by Matveyenka and co-workers showed that insulin aggregates that had different secondary structures exerted a dramatically different cell toxicity to N27 rat dopaminergic cells (Matveyenka et al., 2022a, b, c, d; Matveyenka et al., 2023; Matveyenka et al., 2022e). The same conclusions were made by Zhaliazka and co-workers for amyloid β1–42 (Aβ1–42) oligomers and fibrils (Zhaliazka and Kurouski, 2023). Specifically, it was found that secondary structure and toxicity of Aβ1–42 aggregates could be uniquely altered by CL and cholesterol (Zhaliazka and Kurouski, 2023).

Expanding upon this, we investigate the extent to which the aggregation rate of transthyretin (TTR), a small tetrameric protein that transports thyroid hormone thyroxine and retinol, can be altered by PA-C16:0, PA-C18:0 and PA-C18:1. A progressive aggregation of this protein in various organs and tissues causes transthyretin amyloidosis, a severe pathology that affects thousands of people around the world (Blake et al., 1978; Kanda et al., 1974; Saraiva et al., 2012; Yee et al., 2019). One can expect that during such aggregation, misfolded TTR can interact with PA present in the lipid bilayers (Matsuzaki et al., 2017; Reixach et al., 2004). This can alter the stability of protein molecules accelerating or decelerating the rate of TTR aggregation. Using size-exclusion chromatography (SEC), we isolated TTR monomer that was further aggregated at acidic pH (3.0) (Colon and Kelly, 1992; Kelly et al., 1997; Lai et al., 1996). We also utilize atomic force microscopy (AFM) and AFM-IR to examine the morphology and secondary structure of TTR aggregates formed in the presence of different PAs. Finally, we employ cell toxicity assays to examine the extent to which changes in the secondary structure of TTR aggregates correlate with their toxicity.

2. Results and discussion

2.1. The length and saturation of FAs in PA uniquely altered the TTR aggregation rate

We utilized a thioflavin T (ThT) assay to investigate the extent to which PA-C16:0, PA-C18:0, and PA-C18:1 could alter the rate of TTR aggregation. In the absence of protein aggregates, ThT has very little if any fluorescence. However, when ThT binds to protein aggregates, this changes relative orientation of aromatic rings in the molecule, which results in the strong fluorescence at ~480 nm. Our results showed that at pH 3.0, TTR aggregation had a well-defined lag-phase (tlag) that was followed by a rapid increase in ThT fluorescence, Fig. 1. This indicates a rapid aggregation of monomeric protein into amyloid fibrils. We found that both PA-C16:0 and PA-C18:0 significantly decelerated protein aggregation if were present at equimolar concentrations. Specifically, tlag was found to increase from 2.72 ± 0.13 h (TTR) to 3.6 ± 0.08 h and 3.6 ± 0.35 h for TTR:PA-C16:0 and TTR:PA-C18:0, respectively, Fig. 1. At the same time, we found that the presence of one double bond in the PA FAs resulted in the drastic acceleration of TTR aggregation. Specifically, in the presence of PA-C18:1, TTR aggregated much faster (tlag=1.19 ± 0.13 h) than in the lipid-free environment. ThT assay also revealed differences in the overall intensities of ThT fluorescence of TTR fibrils formed in the presence and absence of lipids. One can expect that such differences can be due to the presence of PAs on the surface of the aggregates.

Fig. 1.

Fig. 1.

Open in a new tab

Length and saturation of FAs in PAs uniquely alter TTR aggregation rate. ThT kinetics (top) and a histogram of tlag (bottom) of TTR aggregation in lipid-free environment (blue), as well as in the presence of PA-C18:0 (red), PA-C18:1 (green) and PA-C16:0 (purple) at 37 °C. All kinetic measurements were made in triplicates. ANOVA test was used to determine statistical significance; *P < 0.05; * *P < 0.01;* **P < 0.001.

2.2. Morphological examination of protein aggregates

We utilized AFM to investigate the morphology of TTR aggregates formed in the lipid-free environment as well as in the presence of PA-C18:0, PA-C18:1, and PA-C16:0, Fig. 2. We found that in the absence of PAs, TTR formed thin fibrils that were 6–9 nm in height. Morphologically similar aggregates were formed in the presence of PA-C18:0. These fibrils also had relatively narrow height distributions ranging from 4 to 8 nm. At the same time, we observed much shorter fibrils in TTR:PA-C16:0. We also observed a large number of small spherical oligomers present with these fibrils. Furthermore, we found that most of such oligomers were surrounded by a thin substance that was likely to have lipid origin, Fig. S1, shown by red arrows. Thus, one can expect that large unilamellar vesicles of PA-C16:0 templated TTR aggregation. Both TTR:PA-C16:0 oligomers and fibrils had similar heights that ranged from 3 to 7 nm. However, we found that in the presence of PA-C18:1, TTR formed drastically different aggregates. Specifically, we observed much thicker (10–19 nm) fibrils that stretched for microns in length. Based on these results, we can conclude that both saturation and length of FAs alter the morphology of TTR aggregates formed in their presence.

Fig. 2.

Fig. 2.

Open in a new tab

Length and saturation of FAs in PA uniquely alter the morphology of TTR aggregates. AFM images with the corresponding height histograms (bottom) of TTR aggregated in the lipid-free environment and in the presence of PA-C18:0 (red), PA-C18:1 (green) and PA-C16:0 (purple) at 37 °C. Scale bars are 500 nm. Oligomers are identified by green arrows.

2.3. Elucidation of the secondary structure of TTR aggregates formed in the presence of PA-C16:0, PA-C18:0, and PA-C18:1

We first used Fourier-Transformed Infrared (FT-IR) spectroscopy to investigate the secondary structure of TTR aggregates formed in the lipid-free environment and in the presence of PA-C16:0, PA-C18:0, and PA-C18:1. We found that IR spectra acquired from all samples exhibited amide I and amide II bands centered around 1632 cm−1 and 1540 cm−1, respectively, Fig. S2. This indicates the predominance of parallel β-sheet in the structure of TTR fibrils (Zhaliazka and Kurouski, 2022; Zhou and Kurouski, 2020). However, it should be noted that conventional FT-IR probes the bulk volume of the analyzed samples. To overcome this limitation and examine the secondary structure of TTR aggregates, we utilized nano-IR, Fig. 3.

Fig. 3.

Fig. 3.

Open in a new tab

Averaged nano-IR spectra (A) acquired from TTR fibrils formed in the presence of PAs, as well as in the lipid-free environment. A bar graph (B) that summarizes the distribution of protein secondary structure in the protein aggregates according to the fitting of the amide I band. Parallel β-sheet (1632 cm−1) in dark blue, α-helix and random coil (1660 cm−1) in light blue, β-turn in grey and anti-parallel β-sheet (1695 cm−1) in yellow. One-way ANOVA with Tukey ad-hoc test was used to determine statistical significance; *P < 0.05; * **P < 0.001; NS-non-statistical significance.

Nano-IR revealed drastic differences in the secondary structure of TTR fibrils formed in the presence of PA-C18:0 and PA-C16:0 compared to the TTR fibrils formed in the presence of PA-C18:1 and fibrils formed in the lipid-free environment. Specifically, both TTR:PA-C18:0 and TTR:PA-C16:0 aggregates possessed significantly lower amount of parallel β-sheets compared to TTR and TTR:PA-C18:1 fibrils. These results demonstrated that PA-C18:0 and PA-C16:0 drastically altered the secondary structure of TTR fibrils. However, the presence of PA-C18:1 had very little if any effect on the secondary structure of fibrils formed in the presence of this PA. It should be noted that acquired AFM-IR spectra did not exhibit vibrational bands that originated from C=O vibration of lipids, Fig. 3 (Matveyenka et al., 2022c). These results demonstrated that, unlike in the case of insulin, lipids were not present in the structure of TTR fibrils (Matveyenka et al., 2022c).

2.4. Toxicity of TTR aggregates formed in the presence of PA with different lengths and saturations of FAs

The question to ask is whether observed structural differences between TTR, TTR:PA-C18:0, TTR:PA-C18:1, and TTR:PA-C16:0 have any biological significance. To answer this question, we investigate the extent to which these protein aggregates exert cell toxicity to rat midbrain N27 cell line using lactate dehydrogenase assay (LDH), Fig. 4. LDH assay revealed a drastic difference between the toxicity exerted by TTR fibrils formed in the presence of PAs and TTR aggregates that were grown in the lipid-free environment. We also found that TTR:PA-C18:0 fibrils exerted higher cell toxicity compared to TTR:PA-C16:0 fibrils. These results showed that the length of FAs in PAs uniquely altered the secondary structure and consequently toxicity of TTR aggregates. It should be noted that lipids themselves exert insignificant cell toxicity to N27 rat neuronal cell line (Matveyenka et al., 2022c).

Fig. 4.

Fig. 4.

Open in a new tab

A Histogram of the LDH assay reveals differences between cell toxicity of TTR, TTR:PA-C18:0, TTR:PA-C18:1 and TTR:PA-C16:0. One-way ANOVA with Tukey ad-hoc test was used to analyze the data. Black asterisks (*) indicate statistical significance between samples and the control; green * indicate statistical significance between TTR and TTR formed in the presence of lipids. *P < 0.05; * ** *P < 0.0001, NS- non-statistical significance.

Summarizing, we can conclude that PA drastically alters stability of TTR monomers. We found that if present at equimolar concentration with the protein, PA could uniquely alter TTR aggregation rate. ThT assay used in this work revealed that the effect was directly determined by the length and saturation of FAs in PA. Specifically, the presence of double bonds in FAs resulted in the strong acceleration of TTR aggregation. At the same time, we found that PAs with fully saturated 16 and 18 carbon atom long FAs decelerated the rate of TTR aggregation. We also found that unsaturation of FAs in PA has a strong effect on the morphology of TTR fibrils formed in the presence of such lipid. Specifically, we observed much thicker fibrils formed by TTR in the presence of PA-C18:1 that were observed neither for TTR itself nor for TTR:PA-C16:0 and TTR:PA-C18:0. Elucidation of the secondary structure of TTR fibrils formed in the PA-free environment, as well as in the presence of PAs revealed drastic differences in the secondary structure of TTR:PA-C18:0 and TTR:PA-C16:0 compared to TTR and TTR:PA-C18:1 fibrils. Specifically, TTR:PA-C18:0 and TTR:PA-C16:0 fibrils possessed much higher amounts of parallel β-sheets compared to TTR and TTR:PA-C18:1 fibrils. These findings indicate that a significantly longer lag-phase of TTR:PA-C16:0 and TTR:PA-C18:0 has a direct correlation with the amount of parallel β-sheet in these aggregates. These results demonstrated that the length and saturation of FAs in PAs have a strong effect on the secondary structure of protein aggregates.

One may expect that hydrogen binding between the PAs and TTR could play an important role in the discussed above differences in TTR aggregation rate, as well as morphology and the secondary structure of mature TTR amyloid fibrils. Hydrogen bonds can be developed between the aliphatic FAs of PA and hydrophobic amino acid residues of TTR. Our results suggest infer that small differences in the hydrogen bonding between PA-C18:0 and PA-C18:1 with TTR can alter the thermodynamics of lipid:protein complex. This results in the structural and morphological differences between TTR:PA-C18:0 and TTR:PA-C18:1 fibrils. Differences in the thermodynamics of the lipid:protein complexes can also explain the discussed above differences between the secondary structure of TTR:PA-C16:0 and TTR:PA-C18:0 fibrils. Two CH2 groups drastically alter the melting points of such lipids and consistently alter the thermodynamics of the TTR:PA interactions. Although the elucidation of the thermodynamic properties of TTR:PA-C16:0, TTR:PA-C18:0, and TTR:PA-C18:1 complexes is the subject of a separate study, this hypothesis is confirmed by the previously reported results from our group (Matveyenka et al., 2022c). Specifically, Matveyenka and co-workers found that insulin did not aggregate in the presence of PA-C16:0. However, the presence of PA-C18:0 resulted in the acceleration of insulin aggregation, whereas a deceleration was observed for PA-C18:1. Thus, we can conclude that the same PA will have drastically different effects on the aggregation rate of different amyloidogenic proteins. The same conclusion can be made about the effect of PA on the toxicity of protein aggregates. We found that all tested PAs reduced the toxicity of TTR fibrils. However, this effect was observed only for PA-C16:0 in the same of insulin.

3. Experimental section

3.1. Materials

1,2-Dipalmitoyl-sn-glycero-3-phosphate (16:0/16:0-PA, (PA-C16:0)), 1,2-dioleoyl-sn-glycero-3-phosphate (18:1/18:1-PA, (PA-C18:1)), and 1,2-distealoyl-sn-3-phosphate (18:0/18:0-PA, (PA-C18:0)) were purchased from Avanti (Alabaster, AL, USA).

3.3. Liposome preparation

To prepare LUVs of PA-C16:0, PA-C18:0and PA-C18:1, 0.6 mg of each lipid was dissolved in 2.6 mL of phosphate buffered saline (PBS), pH 7.4. Next, solutions were heated ~50 °C for 30 min using a water bath. After that, samples were immersed into liquid nitrogen for 3–5 min. The thawing-heating cycle was repeated 10 times. To homogenize size of lipid vesicles, lipid solutions were passed through 100 nm membrane using extruder (Avanti, Alabaster, AL, USA). Finally, we utilized dynamic light scattering (DLS) to ensure that the size of the LUVs was within 100 ± 10 nm, Fig. S3.

3.4. Cloning of transthyretin (TTR)

The plasmid TTR-pcDNA3.1 + /C-(K) DYK with Accession No. NM_000371 was got from Gen Script USA. The TTR gene was cloned following the method by Ali et al. (2018). The plasmid pcDNA3.1 + /C-(K) amplified by using PCR with the following set of primers 5′ATATATAAGCTTATGGCTTCT CATCGTCTG-3′ with a 5′-Hin-dIII restriction site and 5′-ATATATCTCGAGTCATTC CTTGGGATTGG-3′ with 5′ XhoI restriction site. The PCR product that was associated with the TTR protein without the predicted signal sequence was amplified. The PCR product was double digested with HindIII and XhoI. The pET28b backbone (Gen Script) was also double digested with HindIII and XhoI. The ligation reaction occurred with Digested products (insert and backbone) by using the T4 DNA ligase. The ligated product followed the transform in the E. coli DH5α strain through the heat shock method. The plasmids were double digested with the same restriction enzymes HindIII and XhoI to confirm the positive Cloned. Final confirmation of the cloned by the Sanger sequence method (Eurofins).

3.4. Protein expression and purification

TTR protein was overexpressed through Escherichia coli BL21 (DE3) strain using LB broth media according to the protocol described by Volles and Lansbury (Singh et al., 2013; Volles and Lansbury, 2007). We induced the culture with 1 mM IPTG at OD 0.8–1 at 600 nm. The induced culture pellet was lysed in lysis buffer (Tris HCl 50 mM, 10 mM EDTA, 150 mM NaCl, pH 8.0,) followed by protease inhibitor (Roche). The frozen lysed pellet was boiled in a water bath for 30 min followed by the sonication. Sonicated samples were centrifuged at 16,000 g for 40 min at 4 °C and the supernatants were collected. The supernatant was treated with streptomycin sulfate 10% (136 μL/mL) and glacial acetic acid (228 μL/mL) and incubated on the ice for 15 min. Centrifuged at 16,000 g for 40 min at 4 °C and the supernatants were collected, and precipitated by an equal volume of saturated ammonium sulfate. Precipitated samples were again treated with saturated ammonium sulfate solution (saturated ammonium sulfate and water, 1:1 v/v). The washed pellet was then treated with 100 mM ammonium acetate under constant stirring for 10 min followed by the addition of an equal volume of absolute ethanol and repeated twice at room temperature. The collected protein pellet was resuspended in 100 mM ammonium acetate and lyophilized overnight, and the powder was stored at −20 °C for further use.

3.5. Size Exclusion Chromatography (SEC)

Purified TTR protein powder was dissolved in PBS buffer, pH 7.4. First, the protein was digested with the thrombin protease to clave the HisTag at 4 °C in the dialysis bag. Cleaved His TAG TTR protein was centrifuged for 40 min at 15, 000 rpm using a benchtop microcentrifuge (Eppendorf centrifuge 5424 USA). Concentrated TTR protein 500 μL was injected in a Superdex 200 10/300 gel filtration column in AKTA pure (GE Healthcare) FPLC. A monomer of the TTR Protein was collected isocratically with a flow rate of 0.5 mL/min at 4 °C using the same PBS buffer (pH 7.4);1.5 mL fractions were collected according to the UV–VIS detection at 280 nm, Fig. S4.

3.6. Protein aggregation

In the lipid-free environment, 50 μM of TTR was dissolved in CH3COONa buffer that contained 1 M KCl. The sample pH was adjusted to pH 3.0 using concentrated HCl. For TTR:PA-C16:0, TTR:PA-C18:0, and TTR:PA-C18:1, 50 μM of TTR was mixed with an equivalent concentration of the corresponding PAs. Next, the pH of the final solution was adjusted to pH 3.0 using concentrated HCl. All samples were placed into a well-plate that was agitated for 24 h with 510 rpm, 37 °C (Tecan, Mannedorf, Switzerland). DLS measurements revealed that at pH 3.0 TTR starts aggregating forming ~5 times larger particles compared to TTR monomers observed at pH 7.4, Fig. S5. The same conclusion can be made about TTR:PA-18:0, TTR:PA-18:1, and TTR:PA-16:0. Specifically, we observed a drastic increase in the size of protein aggregates compared to the monomeric TTR that remained stable at pH 7.4. A substantially greater size of protein aggregates was observed by DLS in the protein samples incubated at 37 °C for 24 h, Fig. S5.

SEC revealed that at pH 7.4, PA LUVs triggered self-assembly of TTR monomers into tetramers, Fig. S6. We also observed broadening of TTR monomer peak (elution volume = ~17 min) in SEC of TTR:PA-18:0 and TTR:PA-16:0, which suggests that TTR interacts with PA-18:0 and PA-16:0. It should be noted that only a small amount of protein monomers and tetramers remained in the solution after incubation at 37 °C for 24 h, Fig. S7.

3.7. Atomic force microscopy (AFM) imaging

We used AIST-NT-HORIBA system (Edison, NJ) AFM system to perform morphological analysis of protein aggregates. For AFM imaging, silicon tapping-mode AFM probes Appnano (Mountain View, CA, USA) were used. Force constant was 2.7 N/m; resonance frequency was 50–80 kHz. For each measurement, an aliquot of the sample was diluted with DI water and placed on the surface of pre-cleaned glass coverslip. After 20–30 min exposition, the excess of solution was removed from the glass surface. Finally, coverslips were dried under the flow of dried nitrogen. Pre-processing of the collected AFM images was made using AIST-NT software (Edison, NJ, USA).

3.8. Attenuated total reflectance Fourier-transform Infrared (ATR-FTIR) spectroscopy

After 24 h of incubation at 37 °C, samples were placed onto ATR crystal of 100 FTIR spectrometer (Perkin-Elmer, Waltham, MA, USA) and dried at room temperature. Three spectra were collected from each sample.

3.9. Atomic force microscopy infrared spectroscopy

Protein samples (3–6 μL) were deposited on a 70 nm gold-coated silicon wafer. After the samples were exposed on the wafer surface for 15–20 min, the excess of solutions were removed; wafers were dried at room temperature. Next, wafer surface was rinsed with DI water, and again dried under N2 flow. AFM-IR imaging was conducted using a Nano-IR3 system (Bruker, Santa Barbara, CA, USA). The IR source was a QCL laser. Contact-mode AFM tips (ContGB-G AFM probe, Nano-AndMore) were used to acquire AFM-IR spectra. No evidence of the sample distortion was observed upon contact-mode AFM imaging. The contact-mode tip was optimized using a polymethyl methacrylate standard sample in 1400–1800 cm−1. Totally, 20 point measurements were taken from every analyzed sample. The spectra were zapped from 1648 to 1652 cm−1 to remove the artifact originating from the chip-to-chip transition. The spectra resolution is 2 cm−1/pt. Savitzky-Golay smoothing was applied to all spectra with 2 polynomial orders by using MATLAB.

3.10. Cell toxicity assays

To grow rat midbrain N27 cells, we used RPMI 1640 Medium (Thermo Fisher Scientific, Waltham, MA, USA) that contained 10% fetal bovine serum (FBS) (Invitrogen, Waltham, MA, USA). Cells were kept in 96 well-plate (5000 cells per well) at 37 °C, 5% CO2. After cells reached ~70% confluency, 100 μL of cell culture was removed. Next, 100 μL of RPMI 1640 Medium, 5% FBS that contained protein samples were added and incubated 24 h. Lactate dehydrogenase (LDH) assay (G1781, Promega, Madison, WI, USA) was used to determine toxicity of protein aggregates. Absorption measurements were taken in plate reader (Tecan, Mannedorf, Switzerland) at 490 nm. Every well was measured 25 times in different locations.

Supplementary Material

SI

Acknowledgment

We are grateful to the National Institute of Health for the provided financial support (R35GM142869).

Abbreviations:

TTR

transthyretin

FAs

fatty acids

PS

phosphatidylserine

CL

cardiolipin

PA

phosphatidic acid

LDH

lactate dehydrogenase

AFM-IR

atomic force microscopy Infrared spectroscopy

ThT

thioflavin T

Appendix A. Supporting information

Supplementary data associated with this article can be found in the online version at doi:10.1016/j.chemphyslip.2023.105350.

Footnotes

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability

Data will be made available on request.

References

  1. Ali A, Azam MW, Khan AU, 2018. Non-active site mutation (Q123A) in New Delhi metallo-beta-lactamase (NDM-1) enhanced its enzyme activity. Int. J. Biol. Macromol 112, 1272–1277. [DOI] [PubMed] [Google Scholar]
  2. Bader MF, Vitale N, 2009. Phospholipase D in calcium-regulated exocytosis: lessons from chromaffin cells. Biochim. Biophys. Acta 1791, 936–941. [DOI] [PubMed] [Google Scholar]
  3. Blake CC, Geisow MJ, Oatley SJ, Rerat B, Rerat C, 1978. Structure of prealbumin: secondary, tertiary and quaternary interactions determined by Fourier refinement at 1.8 A. J. Mol. Biol 121, 339–356. [DOI] [PubMed] [Google Scholar]
  4. Braak H, Braak E, 1991. Demonstration of amyloid deposits and neurofibrillary changes in whole brain sections. Brain. Pathol 1, 213–216. [DOI] [PubMed] [Google Scholar]
  5. Centrone A., 2015. Infrared imaging and spectroscopy beyond the diffraction limit. Annu. Rev. Anal. Chem 8, 101–126. [DOI] [PubMed] [Google Scholar]
  6. Chae J, An S, Ramer G, Stavila V, Holland G, Yoon Y, Talin AA, Allendorf M, Aksyuk VA, Centrone A, 2017. Nanophotonic Atomic Force Microscope Transducers Enable Chemical Composition and Thermal Conductivity Measurements at the Nanoscale. Nano Lett. 17, 5587–5594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chae J, Lahiri B, Centrone A, 2016. Engineering near-field SEIRA enhancements in plasmonic resonators. Acs Photonics 3, 87–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Cherny RA, Legg JT, McLean CA, Fairlie DP, Huang X, Atwood CS, Beyreuther K, Tanzi RE, Masters CL, Bush AI, 1999. Aqueous dissolution of Alzheimer’s disease Abeta amyloid deposits by biometal depletion. J. Biol. Chem 274, 23223–23228. [DOI] [PubMed] [Google Scholar]
  9. Chiti F, Dobson CM, 2017. Protein misfolding, amyloid formation, and human disease: a summary of progress over the last decade. Annu. Rev. Biochem 86, 27–68. [DOI] [PubMed] [Google Scholar]
  10. Colon W, Kelly JW, 1992. Partial denaturation of transthyretin is sufficient for amyloid fibril formation in vitro. Biochemistry 31, 8654–8660. [DOI] [PubMed] [Google Scholar]
  11. Dazzi A, Prater CB, 2017. AFM-IR: technology and applications in nanoscale infrared spectroscopy and chemical imaging. Chem. Rev 117, 5146–5173. [DOI] [PubMed] [Google Scholar]
  12. Dou T, Li Z, Zhang J, Evilevitch A, Kurouski D, 2020. Nanoscale Structural Characterization of Individual Viral Particles Using Atomic Force Microscopy Infrared Spectroscopy (AFM-IR) and Tip-Enhanced Raman Spectroscopy (TERS). Anal. Chem 92, 11297–11304. [DOI] [PubMed] [Google Scholar]
  13. Eisenberg DS, Sawaya MR, 2017. Structural studies of amyloid proteins at the molecular level. Annu. Rev. Biochem 86, 69–95. [DOI] [PubMed] [Google Scholar]
  14. Fitzner D, Bader JM, Penkert H, Bergner CG, Su M, Weil MT, Surma MA, Mann M, Klose C, Simons M, 2020. Cell-type- and brain-region-resolved mouse brain lipidome. Cell. Rep 32, 108132. [DOI] [PubMed] [Google Scholar]
  15. Gallardo R, Ranson NA, Radford SE, 2020. Amyloid structures: much more than just a cross-beta fold. Curr. Opin. Struct. Biol 60, 7–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Galvagnion C, Brown JW, Ouberai MM, Flagmeier P, Vendruscolo M, Buell AK, Sparr E, Dobson CM, 2016. Chemical properties of lipids strongly affect the kinetics of the membrane-induced aggregation of alpha-synuclein. Proc. Natl. Acad. Sci. U. S. A 113, 7065–7070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Galvagnion C, Buell AK, Meisl G, Michaels TC, Vendruscolo M, Knowles TP, Dobson CM, 2015. Lipid vesicles trigger alpha-synuclein aggregation by stimulating primary nucleation. Nat. Chem. Biol 11, 229–234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ghosh U, Yau WM, Collinge J, Tycko R, 2021. Structural differences in amyloidbeta fibrils from brains of nondemented elderly individuals and Alzheimer’s disease patients. Proc. Natl. Acad. Sci. U. S. A 118, e2111863118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hardy J, Selkoe DJ, 2002. The amyloid hypothesis of Alzheimer’s disease: progress and problems on the road to therapeutics. Science 297, 353–356. [DOI] [PubMed] [Google Scholar]
  20. Kanda Y, Goodman DS, Canfield RE, Morgan FJ, 1974. The amino acid sequence of human plasma prealbumin. J. Biol. Chem 249, 6796–6805. [PubMed] [Google Scholar]
  21. Kelly JW, Colon W, Lai Z, Lashuel HA, McCulloch J, McCutchen SL, Miroy GJ, Peterson SA, 1997. Transthyretin quaternary and tertiary structural changes facilitate misassembly into amyloid. Adv. Protein Chem 50, 161–181. [DOI] [PubMed] [Google Scholar]
  22. Knowles TP, Vendruscolo M, Dobson CM, 2014. The amyloid state and its association with protein misfolding diseases. Nat. Rev 15, 384–396. [DOI] [PubMed] [Google Scholar]
  23. Kurouski D, Dazzi A, Zenobi R, Centrone A, 2020. Infrared and Raman chemical imaging and spectroscopy at the nanoscale. Chem. Soc. Rev 49, 3315–3347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lai Z, Colon W, Kelly JW, 1996. The acid-mediated denaturation pathway of transthyretin yields a conformational intermediate that can self-assemble into amyloid. Biochemistry 35, 6470–6482. [DOI] [PubMed] [Google Scholar]
  25. Latour G, Robinet L, Dazzi A, Portier F, Deniset-Besseau A, Schanne-Klein MC, 2016. Correlative nonlinear optical microscopy and infrared nanoscopy reveals collagen degradation in altered parchments. Sci. Rep 6, 26344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Matsuzaki T, Akasaki Y, Olmer M, Alvarez-Garcia O, Reixach N, Buxbaum JN, Lotz MK, 2017. Transthyretin deposition promotes progression of osteoarthritis. Aging Cell 16, 1313–1322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Matveyenka M, Rizevsky S, Kurouski D, 2022a. Amyloid aggregates exert cell toxicity causing irreversible damages in the endoplasmic reticulum. Biochim. Biophys. Acta Mol. Basis. Dis 1868, 166485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Matveyenka M, Rizevsky S, Kurouski D, 2022b. The degree of unsaturation of fatty acids in phosphatidylserine alters the rate of insulin aggregation and the structure and toxicity of amyloid aggregates. FEBS Lett. 596, 1424–1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Matveyenka M, Rizevsky S, Kurouski D, 2022c. Length and Unsaturation of Fatty Acids of Phosphatidic Acid Determines the Aggregation Rate of Insulin and Modifies the Structure and Toxicity of Insulin Aggregates. ACS Chem. Neurosci 13, 2483–2489. [DOI] [PubMed] [Google Scholar]
  30. Matveyenka M, Rizevsky S, Kurouski D, 2022d. Unsaturation in the fatty acids of phospholipids drastically alters the structure and toxicity of insulin aggregates grown in their presence. J. Phys. Chem. Lett 4563–4569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Matveyenka M, Rizevsky S, Pellois JP, Kurouski D, 2023. Lipids uniquely alter rates of insulin aggregation and lower toxicity of amyloid aggregates. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 1868, 159247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Matveyenka M, Zhaliazka K, Rizevsky S, Kurouski D, 2022e. Lipids uniquely alter secondary structure and toxicity of lysozyme aggregates. FASEB J. 36, e22543. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mayet C, Dazzi A, Prazeres R, Allot E, Glotin E, Ortega JM, 2008. Sub-100 nm IR spectromicroscopy of living cells. Opt. Lett 33, 1611–1613. [DOI] [PubMed] [Google Scholar]
  34. McMahon HT, Gallop JL, 2005. Membrane curvature and mechanisms of dynamic cell membrane remodelling. Nature 438, 590–596. [DOI] [PubMed] [Google Scholar]
  35. Mizuno S, Sasai H, Kume A, Takahashi D, Satoh M, Kado S, Sakane F, 2017. Dioleoyl-phosphatidic acid selectively binds to alpha-synuclein and strongly induces its aggregation. FEBS Lett. 591, 784–791. [DOI] [PubMed] [Google Scholar]
  36. Nelson R, Eisenberg D, 2006a. Recent atomic models of amyloid fibril structure. Curr. Opin. Struct. Biol 16, 260–265. [DOI] [PubMed] [Google Scholar]
  37. Nelson R, Eisenberg D, 2006b. Structural models of amyloid-like fibrils. Adv. Protein Chem 73, 235–282. [DOI] [PubMed] [Google Scholar]
  38. Ramer G, Ruggeri FS, Levin A, Knowles TPJ, Centrone A, 2018. Determination of Polypeptide Conformation with Nanoscale Resolution in Water. ACS nano 12, 6612–6619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Reixach N, Deechongkit S, Jiang X, Kelly JW, Buxbaum JN, 2004. Tissue damage in the amyloidoses: Transthyretin monomers and nonnative oligomers are the major cytotoxic species in tissue culture. Proc. Natl. Acad. Sci. U. S. A 101, 2817–2822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Rizevsky S, Zhaliazka M, Dou T, Matveyenka M, 2022. Characterization of Substrates and Surface-Enhancement in Atomic Force Microscopy Infrared (AFM-IR) Analysis of Amyloid Aggregates. J. Phys. Chem. C 126, 4157–4162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ruggeri FS, Benedetti F, Knowles TPJ, Lashuel HA, Sekatskii S, Dietler G, 2018a. Identification and nanomechanical characterization of the fundamental single-strand protofilaments of amyloid alpha-synuclein fibrils. Proc. Natl. Acad. Sci. U. S. A 115, 7230–7235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Ruggeri FS, Charmet J, Kartanas T, Peter Q, Chia S, Habchi J, Dobson CM, Vendruscolo M, Knowles TPJ, 2018b. Microfluidic deposition for resolving single-molecule protein architecture and heterogeneity. Nat. Commun 9, 3890. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Ruggeri FS, Mannini B, Schmid R, Vendruscolo M, Knowles TPJ, 2020. Single molecule secondary structure determination of proteins through infrared absorption nanospectroscopy. Nat. Commun 11, 2945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ruggeri FS, Vieweg S, Cendrowska U, Longo G, Chiki A, Lashuel HA, Dietler G, 2016. Nanoscale studies link amyloid maturity with polyglutamine diseases onset. Sci. Rep 6, 31155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Saraiva MJ, Magalhaes J, Ferreira N, Almeida MR, 2012. Transthyretin deposition in familial amyloidotic polyneuropathy. Curr. Med. Chem 19, 2304–2311. [DOI] [PubMed] [Google Scholar]
  46. Singh PK, Kotia V, Ghosh D, Mohite GM, Kumar A, Maji SK, 2013. Curcumin modulates alpha-synuclein aggregation and toxicity. ACS Chem. Neurosci 4, 393–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Stace CL, Ktistakis NT, 2006. Phosphatidic acid- and phosphatidylserine-binding proteins. Biochim. Biophys. Acta 1761, 913–926. [DOI] [PubMed] [Google Scholar]
  48. Tanguy E, Wang QL, Moine H, Vitale N, 2019. Phosphatidic acid: from pleiotropic functions to neuronal pathology. Front. Cell Neurosci 13, 2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Volles MJ, Lansbury PT Jr., 2007. Relationships between the sequence of alpha-synuclein and its membrane affinity, fibrillization propensity, and yeast toxicity. J. Mol. Biol 366, 1510–1522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Yee AW, Aldeghi M, Blakeley MP, Ostermann A, Mas PJ, Moulin M, de Sanctis D, Bowler MW, Mueller-Dieckmann C, Mitchell EP, Haertlein M, de Groot BL, Boeri Erba E, Forsyth VT, 2019. A molecular mechanism for transthyretin amyloidogenesis. Nat. Commun 10, 925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Zhaliazka K, Kurouski D, 2022. Nanoscale characterization of parallel and antiparallel beta-sheet amyloid beta 1-42 aggregates. ACS Chem. Neurosci 13, 2813–2820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Zhaliazka K, Kurouski D, 2023. Lipids uniquely alter the secondary structure and toxicity of amyloid beta 1-42 aggregates. FEBS J. 10.1111/febs.16738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Zhou L, Kurouski D, 2020. Structural characterization of individual alpha-synuclein oligomers formed at different stages of protein aggregation by atomic force microscopy-infrared spectroscopy. Anal. Chem 92, 6806–6810. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

SI
NIHMS2141826-supplement-SI.docx (4.9MB, docx)

Data Availability Statement

Data will be made available on request.

RESOURCES