Skip to main content
NCBI home page
MicrobiologyOpen logoLink to MicrobiologyOpen
. 2026 Feb 26;15(2):e70256. doi: 10.1002/mbo3.70256

Assessment of the Incidence of Vibrio spp. in Shrimp Farms Relative to Water Parameters and Their Molecular Detection in the Southwest Coastal Region of Bangladesh

M Sohidullah 1, Bidyut Matubber 1, Md Hamidur Rahman 2, Abu Sayeed 3, Sadia Rahman 3, Linta Yesmin 3, Md Jannat Hossain 1, Md Imran Chowdhury 4, Muhammad Ashiqul Alam 1,✉
PMCID: PMC12936711  PMID: 41744032

ABSTRACT

In aquatic ecosystems, the incidence of Vibrio spp. is rising continually due to changes in water parameters. The study was undertaken to assess the incidence of Vibrio spp. in shrimp farms relative to water parameters and to perform their molecular detection. Maintaining three replications of each sample, overall, 360 shrimp, 360 water, and 360 sediments were randomly collected from the experimental units of 30 ponds in Khulna and Satkhira districts in each of the rainy and winter seasons. Temperature, ammonium, nitrite, pH, iron, and salinity were measured from water samples. The groEL gene of Vibrio cholerae, and toxR, trh, and tdh genes of Vibrio parahaemolyticus were identified through real‐time polymerase chain reaction assay. Shrimp showed the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season. In the rainy season, shrimp represented 42.5%, water 17.5%, and sediment 19.16% Vibrio spp., whereas in the winter season, these were 38.33%, 14.16%, and 15.83%, respectively. Temperature and pH were at the highest average levels in the rainy and winter seasons, respectively. There was no significant relation between the incidence of Vibrio spp. and water parameters, except ammonium in the winter season. Here, 48.02% (85/177) isolates were positive for V. cholerae, 51.97% (92/177) for V. parahaemolyticus, 15.21% (14/92) for the trh gene, and 6.52% (6/92) for the tdh gene. None of the relations between water parameters and trh‐positive V. parahaemolyticus was significant, except pH in the rainy season. The occurrence of Vibrio spp. in shrimp farms should be a burning issue for sustainable production.

Keywords: genes, replications, season, shrimp, Vibrio spp., water parameters

There was no significant relation between the incidence of Vibrio spp. and water parameters, except ammonium in the winter season. In this study, 48.02% (85/177) isolates were positive for Vibrio cholerae, 51.97% (92/177) for Vibrio parahaemolyticus, 15.21% (14/92) for trh gene, and 6.52% (6/92) for tdh gene.

graphic file with name MBO3-15-e70256-g002.jpg

1. Introduction

Shrimp is regarded as one of the favorite food items in the world, and Bangladesh is no exception. From very early times, various kinds of shrimps and prawns have certainly been a source of protein for human intake (Patel et al. 2018). By participating in the global economy, shrimp farming has become one of the major aquaculture industries (Naylor et al. 2021; Yu et al. 2023). According to Bangladesh Economic Review (2023a, 2023b), shrimp farming contributes around 2.84 lakh metric tonnes (mt) of shrimp production and fishing contributes to around 2.41% of the agricultural gross domestic product in Bangladesh. However, with the improvement of extremely dense shrimp aquaculture systems, shrimp production is undergoing a potential threat from microbes, such as bacteria, especially from the Vibrio spp. around the world (El‐Saadony et al. 2022; Villarreal and Juarez 2022). The presence of bacteria in shrimp can occur because of inappropriate and unhealthy conditions at the time of cultivation, processing, preservation, and storage (Bedane et al. 2022).

Vibrio spp. are very common aquatic bacteria, and they can act as opportunistic human and fish pathogens (Grimes 2020; Costa et al. 2022). Vibrio spp. are Gram‐negative, halophilic, facultative anaerobic, non‐spore‐forming, curved, or straight rod‐shaped bacteria that are motile with a single flagellum (Baker‐Austin et al. 2020; Abioye et al. 2021; Sampaio et al. 2022). Vibrio cholerae and Vibrio parahaemolyticus are the most commonly reported zoonotic pathogens among pathogenic Vibrio species, where they are responsible for causing septicemia, acute gastroenteritis, and cholera (M. T. Rahman, Sobur, et al. 2020; Dutta et al. 2021; W. Wang et al. 2021).

Different environmental parameters such as water temperature, salinity, pH, turbidity, organic matter (dissolved organic carbon and dissolved organic nitrogen), inorganic nutrients (ammonium [NH4 +], nitrite + nitrate [NO2 − + NO3 −], and phosphate [PO4 3−]), plankton densities, dissolved oxygen, and total dissolved solids are known to influence the incidence and abundance of Vibrio spp. in aquatic ecosystems (Brumfield et al. 2023; Wong et al. 2024). Though, Vibrio spp. are eurythermic, they like warm water (> 18°C) and warmer periods and seasons. In temperate and cold climatic areas, the density of Vibrio spp. is higher in summer than in winter (Möller et al. 2021). Iron is an essential and lifesaving element for the distribution of Vibrio spp. (Payne et al. 2016).

Though, in Bangladesh, numerous studies have been carried out regarding shrimp and shrimp products, most of them were focused on the identification of the genus Vibrio quantification of their numbers, and performing their antibiogram study (Chakma et al. 2018; Talukder et al. 2019; Al‐Amin et al. 2020; M. S. Rahman, Eshik, et al. 2020). However, a few studies on the detection of Vibrio spp. from shrimp and shrimp environments, and the assessment of different water parameters influencing their distribution in shrimp farms have been performed in Bangladesh (Jahan et al. 2017; Alam and Rahman 2018; Sarker et al. 2019; Siddique et al. 2021) and other countries (Bauer et al. 2021; Fleischmann et al. 2022; Brumfield et al. 2023; Sacheli et al. 2023; Dayang Najwa et al. 2024). In addition, in our previous study (Sohidullah et al. 2025), we have detected antibiotic resistance genes in V. parahaemolyticus and performed spectrophotometry for the assessment of heavy metals in shrimp muscles. To the best of our knowledge, none of the previous studies in Bangladesh has been performed targeting the assessment of the incidence of Vibrio spp. in shrimp farms in relation to water parameters in each of the rainy and winter seasons, along with their molecular detection in the Southwest Coastal Region of Bangladesh.

Concerning the previous facts, the present study was conducted both in the rainy and winter seasons at four different areas of Khulna and Satkhira districts in Bangladesh: (1) To assess the incidence of Vibrio spp. in shrimp farms in relation to different water parameters, such as temperature, ammonium, nitrite, pH, iron, and salinity. (2) To detect Vibrio spp. from shrimp and shrimp environments using real‐time polymerase chain reaction (PCR) assay.

This study will certainly help shrimp farmers to be informed about the incidence of Vibrio spp. in relation to water parameters, and eventually inspired to execute a constructive management plan to hinder the incidence of Vibrio spp. in shrimp and shrimp environments.

2. Materials and Methods

2.1. Experimental Location

For sampling, shrimp culture ponds (n = 30), which are locally known as gher, were selected from four different areas, namely, Dumuria (n = 9), Debhata (n = 5), Kaliganj (n = 4), and Satkhira Sadar (n = 12) at Khulna and Satkhira districts (Figure 1). These areas were selected because of their reputation for having lots of shrimp farms and a great desire for shrimp and shrimp farming (Karim et al. 2019). Here, the average pond area was approximately 1012 m2 in Dumuria, 1619 m2 in Debhata, 1690 m2 in Kaliganj, and 1740 m2 in Satkhira Sadar. In addition, the average distance between the ponds was 200 m in each area, 45 km between the ponds of Dumuria and Satkhira Sadar, 35 km between the ponds of Kaliganj and Satkhira Sadar, and 22 km between the ponds of Satkhira Sadar and Debhata. For this study, a stocking density of 12 shrimp per square meter in each of the 30 ponds was maintained.

Figure 1.

Figure 1

Open in a new tab

Sampling areas, developed by ArcMap 10.5 (ArcGIS Enterprise, ESRI, Redlands, CA, USA).

2.2. Sampling

Maintaining 7 days interval in each sampling, four samplings were carried out from each of the 30 ponds both in the rainy and winter seasons in 2024. In Bangladesh, during June to October, the average temperature remains 25°C–35°C, which is more or less similar to the optimum temperature (28°C–32°C) for shrimp cultivation. As a consequence, the majority of the shrimp farmers remain busy with shrimp cultivation at this time, and the time from August to December is considered the peak harvesting time of shrimp in Bangladesh. In addition, farmers who stock their ponds early usually begin harvesting in August, which corresponds to the late rainy season, but those who stock later because of constraints such as pond preparation, postlarvae availability, and fluctuating prices typically harvest in December, representing the early winter season. Hence, sample collection was done from July 30 to August 30 in the rainy season and from November 30 to December 30 in the winter season. Three types of samples, such as shrimp, water, and sediment, were collected from the experimental unit of each of the 30 ponds. A total of 360 shrimp, 360 water, and 360 sediment samples were randomly collected in each of the rainy and winter seasons from the experimental units of 30 shrimp culture ponds, where three replications of each sample were maintained. Maintaining three replications of each sample, a total of 3 shrimp, 3 water, and 3 sediment samples were randomly collected from the experimental unit of each pond in each sampling. Per sampling per week, a total of 90 shrimp, 90 water, and 90 sediment samples were randomly collected from 30 shrimp culture ponds, where three replications of each sample were maintained. In this way, a total of 324 samples (108 shrimp, 108 water, and 108 sediment) from Dumuria, 180 samples (60 shrimp, 60 water, and 60 sediment) from Debhata, 144 samples (48 shrimp, 48 water, and 48 sediment) from Kaliganj, and 432 samples (144 shrimp, 144 water, and 144 sediment) from Satkhira Sadar were collected. In our country, sometimes fish farmers mix both healthy and unhealthy shrimps for selling purposes. Due to this reason, both healthy and unhealthy shrimps were randomly collected in this study. A cast net was used to collect shrimp samples, like our previous study (Sohidullah et al. 2025). To avoid cross contamination of shrimp samples, separate sterile plastic zipper bags like our previous study (Sohidullah et al. 2025) were used for each sample. Water and sediment samples were collected from three different locations of each pond at each sampling time to cover the maximum areas of the pond according to the American Public Health Association (APHA) (Federation and American Public Health Association 2005). In the case of a water sample, at first, sterile hand gloves were worn. Then, each water sample (50 mL) was collected from a depth of 0.5 m below the surface using a 50‐mL sterile falcon tube (Huang et al. 2021). For the sediment sample, a sterile, thin‐walled plastic pipe was marked at 5 cm and forced into the sediment at the middle of each pond to the 5‐cm mark and removed. Each 1‐g sediment sample was taken into a 15‐mL sterile falcon tube (Huang et al. 2021). Every time, labeling was done on all the sample collection equipment like our previous study (Sohidullah et al. 2025). After collection, samples were taken as soon as possible in an ice box where the internal temperature was 2°C–4°C, and brought to the Microbiology and Public Health Laboratory at Khulna Agricultural University, Khulna, right away for further processing and analysis. All the samples collected from 30 shrimp culture ponds were analyzed for microbiological investigations at each sampling interval in each of the rainy and winter seasons. Every time after sampling, the pond was indicated as positive for bacterial contamination if one of three samples tested positive for Vibrio spp.

2.3. Sample Processing

Shrimp samples were first washed with sterile 3% NaCl solution to remove surface microorganisms, debris, sand, and slime according to Siddique et al. (2021). Sterile scissors and forceps were used for dissecting shrimp samples (Sohidullah et al. 2025). Gill, muscle, hepatopancreas, and intestine were separated from the shrimp samples. Then, 5 g of each separated part was blended using mortar and pestle, and 45 mL of 0.1% peptone water was added to prepare the stock solution (M. J. Hossain et al. 2025). All the collected sediments were separated from the water samples through centrifugation at 3000 rpm for 1 min. Then, 25 mL of each water sample was kept in a test tube as a stock solution. In addition, the stock solution of 1 g of each sediment sample was prepared by adding 9 mL of 0.1% peptone water.

2.4. Isolation of Vibrio spp.

2.4.1. Cultural Characterization

The stock solution of each shrimp, water, and sediment sample was diluted by 10‐fold serial dilution using 0.1% peptone water up to 10−9 folds according to the APHA (Federation and American Public Health Association 2005). After that, thiosulfate‐citrate‐bile salts‐sucrose (TCBS) agar plate (HiMedia, India) was used to calculate colony‐forming unit (CFU) per mL of microbial suspension, where 0.1 mL of each serially diluted sample from 10−4–10−7 dilutions was spread by a sterile glass rod (Wong et al. 2024; M. J. Hossain et al. 2025). After overnight incubation, a TCBS plate containing 30–300 colonies was selected for the calculation of CFU (M. J. Hossain et al. 2025). For purification, a single colony of each sample was picked by a sterile inoculating loop, and streaking was done on a fresh TCBS agar plate, and the plates were incubated overnight at 37°C, as previously outlined (Sohidullah et al. 2025). Then, for further purification and obtaining well‐isolated, uniform colonies, 4–6 presumptive yellow and green colored colonies of 2–3 mm in diameter from each sample were subcultured onto a freshly prepared TCBS agar plate (Muthukrishnan et al. 2019; Siddique et al. 2021).

2.4.2. Morphological and Biochemical Characterization

The isolates of Vibrio spp. were morphologically and biochemically characterized by Gram staining, sugar fermentation test, indole test, methyl red test, catalase test, oxidase test, urease test, and nitrate reduction test (Bergey et al. 1974; Huang et al. 2022).

2.5. Analysis of Water Parameters

In each of the rainy and winter seasons, every water sample collected from 30 shrimp culture ponds was analyzed at each sampling interval. In this case, temperature was measured in situ at the sampling location, but the other water parameters, such as ammonium, nitrite, pH, iron, and salinity, were measured later in the laboratory.

2.5.1. Temperature

A mercury‐filled Celsius thermometer ranging 0°C–50°C was dipped into the water for 1 min, and the stable temperature final reading was recorded in a paper (Venkateswarlu et al. 2019).

2.5.2. Ammonium and Nitrite Test

The test was done according to the manufacturer's (AQUA‐VBC Test Kit) protocol. In the water sample, five drops of Solution A, one spoon of Powder B, and five drops of Solution C were added consecutively. It was then compared with the standard color chart to reach the level of ammonium ion (in ppm NH4 +) and nitrite (NO2) (Sitthi et al. 2024).

2.5.3. pH Test

The test was done according to the manufacturer's (AQUA‐VBC Test Kit) protocol. Four drops of Solution A were mixed with the water sample, and the test vial was set on the color chart for matching with the pH value (Chaitanawisuti and Kritsanapuntu 1997).

2.5.4. Iron Test

The test was accomplished according to the manufacturer's (Hanna Test Kit) protocol. Mixing of one packet of reagent HI 3834‐0 with the water sample was done, and the solution was shifted into the color comparator cube for color matching (Jiménez‐Bambague et al. 2023).

2.5.5. Salinity Test

Salinity test was done by a refractometer (ATAGO, Japan). A few drops of water were placed onto the prism, and the eyepiece observation was done with the refractometer directed towards a light source (Sitthi et al. 2024).

2.6. Molecular Detection of Vibrio spp.

Presumably identified Vibrio spp. were detected at the species level by real‐time PCR assay. Here, two different Vibrio spp., namely, V. cholerae and V. parahaemolyticus, were targeted, since these are known as the most potential and emerging food‐borne pathogens responsible for having a negative impact on humans, marine animals, and aquaculture (Chen et al. 2022; Jantapaso et al. 2024; Liu et al. 2025). In addition, isolates of Vibrio spp. were selected for the PCR assay based on their DNA concentration (≥ 20 ng/µL) and purity level (1.7–1.9). For V. cholerae, the species‐specific groEL gene, which has been recommended as a competent marker for the detection of many bacteria, including Vibrio spp., was targeted (M. T. Hossain et al. 2012, 2013; Ren and Hill 2023) (Table 1). V. parahaemolyticus was detected by targeting the toxR gene, which is a reliable species‐specific molecular target (Kim et al. 1999; Croci et al. 2007) (Table 1). Virulence genes of V. parahaemolyticus, such as tdh and trh, responsible for causing hemolysis and cytotoxic activity in the host cell were also targeted (Meparambu Prabhakaran et al. 2020; Pazhani et al. 2021; El‐Zamkan et al. 2023; Stratev et al. 2023; Vandeputte et al. 2024) (Table 1).

Table 1.

Primers used for the characterization of Vibrio spp.

Sl. No. Isolate Target genes Primer sequence (5′ → 3′) Reference
1. Vibrio parahaemolyticus toxR

F: GAACCAGAAGCGCCAGTAGT

R: GCATGGTGCTTAACGTAGCG

 Kim et al. (1999) and D. Wang et al. (2013)
2. V. parahaemolyticus tdh

F: GTARAGGTCTCTGACTTTTGGAC

R: CTACAGAATYATAGGAATGTTGAAG

 Bej et al. (1999) and Ward and Bej (2006)
3. V. parahaemolyticus trh

F: CCATCMATACCTTTTCCTTCTCC

R: ACYGTCATATAGGCGCTTAAC

 Bej et al. (1999) and Ward and Bej (2006)
4. Vibrio cholerae groEL

F: GATCTTGACTGGCGGTGTTGTG

R: GTCACCCACCAGAGAAGAGAGT

 M. T. Hossain et al. (2013)
Open in a new tab

2.6.1. DNA Extraction

Extraction of genomic DNA from the isolates of Vibrio spp. was done by TIANamp Bacteria DNA Kit (Tiangen Biotech, China) following the manufacturer's protocol and stored at −20°C until use. To measure the concentration and purity level of DNA, a spectrophotometer (NanoDrop1000, Thermo Scientific, USA) was used. Absorbance readings were performed at a wavelength of 260 nm for the concentration and 260 nm and 280 nm for the purity of DNA (Olson and Morrow 2012).

2.6.2. Real‐Time PCR Assay

A 25‐µL PCR mixture containing 2X TB Green master mix (Takara Bio, Japan), 20 ng of genomic DNA, 10 pmol of each of the designated forward and reverse primers (Macrogen Inc., South Korea), and 5.5 µL of nuclease‐free water was employed for amplification. CFX96 Touch Real‐Time PCR Detection System (Bio‐Rad, Hercules, CA, USA) was used for amplification of the target sequence of DNA. For the groEL gene of V. cholerae, the PCR cycling conditions included a primary denaturation at 95°C for 10 min, followed by secondary denaturation at 95°C for 15 s, annealing and extension at 69°C for 1 min (Costa et al. 2022). For the species‐specific toxR gene, and for tdh and trh virulence genes of V. parahaemolyticus, the PCR cycling conditions included primary denaturation at 94°C for 5 min, followed by secondary denaturation at 94°C for 30 s, annealing and extension at 60°C for 1 min (D. Wang et al. 2013; Federici et al. 2018). The real‐time PCR assays of these genes of V. cholerae and V. parahaemolyticus were run separately, and increases in fluorescence after 40 cycles were regarded as negative. As a no‐template control, a DNA‐free PCR mixture was utilized.

2.7. Statistical Analysis

The binomial 95% confidence interval (CI) calculation was carried out by the statistical package for social sciences (IBM SPSS 26.0, Chicago, IL, USA) to become 95% confident that the incidence of Vibrio spp. in each of the rainy and winter seasons would lie within the lower and upper limits of the interval. To interpret the seasonal and locationwise variations in the existence of Vibrio spp. among various types of collected samples, Chi‐square (χ 2) test was performed by SPSS. Pearson correlation analysis was carried out, and a heat map was created by RStudio‐2023.03.0‐386 (Inc., Boston, MA, USA) and R version 4.2.2 (R Core Team 2023) to find out whether there are any significant influences of water quality parameters on the number of total Vibrio spp. both in the rainy and winter seasons. On the other hand, binary logistic regression analysis was performed by SPSS to observe the relationship between trh‐positive V. parahaemolyticus and different water parameters. The statistically significant p value was fixed at < 0.05.

3. Results

3.1. Total Load of Vibrio spp. in Shrimp, Water, and Sediment Samples

Table 2 shows the total load of Vibrio spp. (log CFU/mL) in the shrimp, water, and sediment samples. Among the collected samples, shrimps had the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season, whereas water samples collected in the winter season showed the lowest mean total Vibrio spp. count (9.28 ± 0.34 log CFU/mL). In the winter season, shrimps exhibited the second‐highest mean total Vibrio spp. count (9.36 ± 0.66 log CFU/mL) that was slightly lower than the count in shrimps in the rainy season. In the rainy season, water samples demonstrated a mean total Vibrio spp. count of 9.32 ± 0.36 log CFU/mL, which was slightly higher than the count in water samples in the winter season. The sediment samples collected in the rainy season showed the third‐highest mean total Vibrio spp. count (9.35 ± 0.42 log CFU/mL) that was slightly higher than the count of 9.34 ± 0.43 log CFU/mL in sediment samples in the winter season.

Table 2.

Total load of Vibrio spp. (log CFU/mL) with respect to shrimp, water, and sediment samples.

Isolate Season Shrimp (n = 360) (Mean ± SD) Water (n = 360) (Mean ± SD) Sediment (n = 360) (Mean ± SD)
Vibrio spp. Rainy 9.39 ± 0.34 9.32 ± 0.36 9.35 ± 0.42
Winter 9.36 ± 0.66 9.28 ± 0.34 9.34 ± 0.43
Open in a new tab

Abbreviations: CFU, colony‐forming unit; SD, standard deviation.

3.2. Percentages of Samples Positive for Vibrio spp.

Vibrio spp. were presumably identified based on their cultural, morphological, and biochemical characteristics both in the rainy and winter seasons.

In total, 285 (26.38%; 95% CI, 23.8%–29.1%) isolates of Vibrio spp. were identified from 1080 samples in the rainy season, and the associations of samples with the isolation of Vibrio spp. were highly significant (Table 3). The highest prevalence was observed in shrimp (42.5%; 95% CI, 37.3%–47.8%), followed by sediment (19.16%; 95% CI, 15.2%–23.6%) and water (17.5%; 95% CI, 13.7%–21.8%) (Table 3). In contrast, in the winter season, a total of 246 (22.77%; 95% CI, 20.3%–25.4%) isolates of Vibrio spp. were identified from 1080 samples, where the associations of the samples with the isolation of Vibrio spp. were also highly significant (Table 3). In this season, the highest prevalence was recorded in shrimp (38.33%; 95% CI, 33.3%–43.6%), followed by sediment (15.83%; 95% CI, 12.2%–20.0%) and water (14.16%; 95% CI, 10.7%–18.2%) (Table 3).

Table 3.

Percentages of samples (shrimp, water, and sediment) positive for Vibrio spp.

Isolate Season Shrimp (n = 360) N (%) (CI) Water (n = 360) N (%) (CI) Sediment (n = 360) N (%) (CI) p value Total (n = 1080) N (%) (CI)
Vibrio spp. Rainy 153 (42.5) (37.3–47.8) 63 (17.5) (13.7–21.8) 69 (19.16) (15.2–23.6) 0.000a 285 (26.38) (23.8–29.1)
Winter 138 (38.33) (33.3–43.6) 51 (14.16) (10.7–18.2) 57 (15.83) (12.2–20.0) 0.000a 246 (22.77) (20.3–25.4)
Open in a new tab

Note: Values differ significantly (p < 0.05) within the variable under assessment, CI = 95% confidence interval.

a

Correlation is significant at the 0.05 probability level (two‐tailed).

3.3. Percentages of Samples from Different Sampling Sites Positive for Vibrio spp.

In the rainy season, samples from Satkhira Sadar reported 29.16% (126/432; 95% CI, 24.9%–33.7%) isolates as Vibrio spp., whereas from the samples of Dumuria, Debhata, and Kaliganj, Vibrio spp. were recorded as 26.85% (87/324; 95% CI, 22.1%–32.0%), 21.66% (39/180; 95% CI, 15.9%–28.4%), and 22.91% (33/144; 95% CI, 16.3%–30.7%), respectively (Table 4). On the other hand, in the winter season, samples of Satkhira Sadar, Dumuria, Debhata, and Kaliganj reported 25.69% (111/432; 95% CI, 21.6%–30.1%), 24.07% (78/324; 95% CI, 19.5%–29.1%), 18.33% (33/180; 95% CI, 13.0%–24.8%), and 16.66% (24/144; 95% CI, 11.6%–24.6%) isolates as Vibrio spp., respectively (Table 4). In both seasons, samples from different sampling sites were not significantly associated with the isolation of Vibrio spp. (Table 4).

Table 4.

Percentages of samples (shrimp, water, and sediment) from different sampling sites positive for Vibrio spp.

Isolate Season Satkhira Sadar (n = 432) N (%) (CI) Dumuria (n = 324) N (%) (CI) Debhata (n = 180) N (%) (CI) Kaliganj (n = 144) N (%) (CI) p value Total (n = 1080) N (%) (CI)
Vibrio spp. Rainy 126 (29.16) (24.9–33.7) 87 (26.85) (22.1–32.0) 39 (21.66) (15.9–28.4) 33 (22.91) (16.3–30.7) 0.194 285 (26.38) (23.8–29.1)
Winter 111 (25.69) (21.6–30.1) 78 (24.07) (19.5–29.1) 33 (18.33) (13.0–24.8) 24 (16.66) (11.6–24.6) 0.170 246 (22.77) (20.3–25.4)
Open in a new tab

Note: Values differ significantly (p < 0.05) within the variable under assessment, CI = 95% confidence interval.

In addition, all the 30 ponds were marked as contaminated with bacteria in the rainy season, whereas in the winter season, 90% (27/30, 95% CI, 73.5%–97.9%) ponds were positive for bacteria.

3.4. Levels of Different Water Parameters

In the rainy season, the average levels of temperature, pH, ammonium, nitrite, iron, and salinity of water were recorded as 28.98°C ± 2.52°C, 7.56 ± 1.01, 0.17 ± 0.39 mg/L, 0.15 ± 0.32 mg/L, 2.08 ± 0.66 mg/L, and 7.49 ± 1.39 ppt, respectively (Table S1), whereas in the winter season, these were observed as 22.6°C ± 3.61°C, 7.60 ± 1.009, 0.13 ± 0.32 mg/L, 0.20 ± 0.40 mg/L, 2.08 ± 0.64 mg/L, and 7.58 ± 1.25 ppt, respectively (Table S1).

3.5. Correlation Between the Incidence of Vibrio spp. and Water Parameters

Pearson correlation analysis between the incidence of Vibrio spp. and different water parameters demonstrated that none of the linear relationships was significant at a 0.05 probability level, both in the rainy and winter seasons, except the relation between ammonium and the incidence of Vibrio spp. in the winter season (Table 5). In the rainy season, the incidence of Vibrio spp. showed extremely weak positive linear relationships with ammonium, nitrite, and iron but extremely weak negative linear relationships with temperature, pH, and salinity (Table 5). In contrast, the incidence of Vibrio spp. revealed a weak positive linear relationship with ammonium but extremely weak negative linear relationships with temperature, pH, nitrite, iron, and salinity in the winter season (Table 5). Two scatter plots for the rainy season (Figure 2) and the winter season (Figure 3) were developed to represent the linear relationships of the total number of Vibrio spp. with different water parameters.

Table 5.

Pearson correlation analysis between the incidence of Vibrio spp. (n = 285 in the rainy season and n = 246 in the winter season) and water parameters.

Water parameters Season Correlation coefficient p value
Temperature Rainy −0.040 0.659
Winter −0.006 0.939
pH Rainy −0.066 0.467
Winter −0.077 0.402
Ammonium Rainy 0.013 0.884
Winter 0.295 0.001a
Nitrite Rainy 0.0006 0.994
Winter −0.010 0.905
Iron Rainy 0.005 0.952
Winter −0.018 0.845
Salinity Rainy −0.0002 0.997
Winter −0.079 0.388
Open in a new tab

Note: Values differ significantly (p < 0.05) within the variable under assessment.

a

Correlation is significant at the 0.05 probability level (one‐tailed).

Figure 2.

Figure 2

Open in a new tab

Scatter plot representing the linear relationships of total number of Vibrio spp. with water parameters temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the rainy season.

Figure 3.

Figure 3

Open in a new tab

Scatter plot representing the linear relationships of the total number of Vibrio spp. with water parameters, temperature (A), pH (B), ammonium (C), nitrite (D), iron (E), and salinity (F) in the winter season.

3.6. Molecular Detection of V. cholerae and V. parahaemolyticus

From presumably identified isolates of Vibrio spp. (n = 531) in the rainy season (n = 285) and winter season (n = 246), 177 isolates (92 isolates from shrimp, 39 isolates from water, and 46 isolates from sediment) were selected for molecular detection at the species level.

In this study, 48.02% (85/177) isolates were positive for V. cholerae and 51.97% (92/177) isolates for V. parahaemolyticus. Among 92 isolates of V. parahaemolyticus, 14 (15.21%) isolates (9 from the rainy season and 5 from the winter season) showed positive results for the trh gene, and 6 (6.52%) isolates (5 from the rainy season and 1 from the winter season) were positive for the tdh gene.

3.7. Logistic Regression Analysis Between the Incidence of trh‐Positive V. parahaemolyticus and Water Parameters

A significant positive relation between pH and the incidence of trh‐positive V. parahaemolyticus was observed in the rainy season (Table 6). While the incidence of trh‐positive V. parahaemolyticus showed a positive relation with iron, ammonium, and salinity, it had a negative relation with temperature and nitrite in the rainy season (Table 6). In contrast, the incidence of trh‐positive V. parahaemolyticus exhibited a positive relation with iron and salinity but a negative relation with temperature, pH, ammonium, and nitrite in the winter season (Table 6).

Table 6.

Logistic regression analysis between trh‐positive Vibrio parahaemolyticus (n = 9 in the rainy season and n = 5 in the winter season) and water parameters.

Independent variable (water parameters) Season Dependent variable (trh‐positive V. parahaemolyticus)
Odds ratio (95% confidence interval) p value
Temperature Rainy 0.776 (0.565, 1.068) 0.119
Winter 0.991 (0.767, 1.281) 0.946
pH Rainy 2.305 (1.004, 5.292) 0.049a
Winter 0.595 (0.208, 1.697) 0.331
Ammonium Rainy 1.167 (0.203, 6.699) 0.862
Winter 0.316 (0.003, 32.792) 0.627
Nitrite Rainy 0.579 (0.049, 6.839) 0.664
Winter 0.119 (0.000, 214.862) 0.578
Iron Rainy 1.060 (0.318, 3.531) 0.925
Winter 1.338 (0.325, 5.514) 0.687
Salinity Rainy 1.068 (0.586, 1.946) 0.831
Winter 1.736 (0.756, 3.985) 0.193
Open in a new tab

Note: Values differ significantly (p < 0.05) within the variable under assessment.

a

Regression is significant at a 0.05 probability level (one‐tailed).

4. Discussion

This study aimed to assess the incidence of Vibrio spp. in shrimp farms in relation to water parameters in each of the rainy and winter seasons and identify Vibrio spp., namely, V. cholerae and V. parahaemolyticus, in the southwest coastal region of Bangladesh.

Among shrimp, water, and sediment samples collected from all the sampling sites, shrimp demonstrated the highest mean total Vibrio spp. count (9.39 ± 0.34 log CFU/mL) in the rainy season, whereas the lowest mean total Vibrio spp. count (9.28 ± 0.34 log CFU/mL) was recorded from water samples in the winter season (Table 2). Previously, Letchumanan et al. (2015) reported the highest mean total Vibrio spp. count (6.34 log CFU/mL) in the red prawn sample from wetmarket A in Malaysia. M. J. Hossain et al. (2025) reported the highest count of V. cholerae (5.93 ± 0.15 log CFU/mL) from poa fish in Khulna, Bangladesh.

In this study, out of 1080 samples, 26.38% samples in the rainy season were identified as Vibrio spp. based on their cultural, morphological, and biochemical characteristics (Table 3), whereas in the winter season, 22.77% samples were positive for Vibrio spp. (Table 3). In a previous study conducted in Peninsular Malaysia, 225 samples were recorded as positive for Vibrio spp. from 210 shrimp samples based on their cultural and biochemical characteristics (Haifa‐Haryani et al. 2022). Another study on shrimp and shrimp environments recorded 34% (51/150) samples as positive for Vibrio spp. in the southwestern regions of Bangladesh (Haque et al. 2023). In addition, in our previous study on shrimp and shrimp environments, 30% (39/130) samples were recorded as positive for V. parahaemolyticus (Sohidullah et al. 2025).

Temperature and salinity play a vital role in affecting the distribution of Vibrio spp. worldwide (Venkateswarlu et al. 2019). Vibriosis in shrimp generally rises at the time of summer and fall when surface water is relatively warm (Venkateswarlu et al. 2019; Sampaio et al. 2022). The higher prevalence of Vibrio spp. in the rainy season and the lower prevalence in the winter season support the findings of these previous studies (Table 3). A study carried out in Brazil revealed that the incidence of Vibrio spp. in oysters was higher in warm water (Yeung and Thorsen 2016). Brumfield et al. (2023) reported a higher incidence of Vibrio spp. in warm water of the Chesapeake Bay, MD, USA.

Vibrio spp. generally prefer alkaline conditions (pH 6.5–9.0) and the highest MPN values of Vibrio spp. were recorded in samples with high pH (~ 8.2) (Percival and Williams 2014; Siddique et al. 2021; Sampaio et al. 2022). In the present study, we also recorded the average level of pH of pond water as alkaline as 7.56 ± 1.01 in the rainy season and 7.60 ± 1.009 in the winter season (Table S1).

Nearly all Vibrio spp. are halophilic in nature, requiring salt (NaCl) in a concentration that differs (1%–12%) from species to species, except V. cholerae, Vibrio fluvialis, Vibrio furnissii, and Vibrio mimicus (Böer et al. 2013). They usually inhabit brackish and seawaters, where the salinity of brackish water ranges from 0.5 to 30 ppt, and seawater average salinity is 35 ppt (Castillo et al. 2018). We recorded the average level of salinity of pond water as 7.49 ± 1.39 ppt in the rainy season and 7.58 ± 1.25 ppt in the winter season (Table S1). Another study carried out in the southwest coastal areas of Bangladesh recorded salinity as 0.4–16.2 ppt (Siddique et al. 2021). However, it becomes evident that the salinities surpassing 2 ppt were aimed at most of the successful shrimp production (Praveen Joshi and Ramachadra Naik 2023).

Feces of shrimp and dead organisms can supply ammonia (NH3) and nitrite (NO2) to the pond water, which becomes ill‐suited for shrimp production (Iber et al. 2021). In this study, the average levels of ammonium of pond water were 0.17 ± 0.39 mg/L in the rainy season and 0.13 ± 0.32 mg/L in the winter season (Table S1), while the average levels of nitrite were recorded as 0.15 ± 0.32 mg/L in the rainy season and 0.20 ± 0.40 mg/L in the winter season (Table S1). These levels of ammonium and nitrite are not toxic to shrimp and are suitable for Vibrio spp., according to another study, where the levels of toxicity of nitrite in aquaculture wastewater were recorded at 0.2, 2, and 4 mg/L concentration (Iber et al. 2021). In a previous study, it was exhibited that the fluctuation of ammonia and nitrates can influence the distribution of Vibrio spp. in a shrimp rearing pond (Ulfiani et al. 2022).

A previous study demonstrated the importance of iron in the population growth of Vibrio alginolyticus (Norfolk et al. 2023). Joseph and Bhat (2000) reported that the effect of ferric oxide (Fe2O3) on survival was significant for V. cholerae O1 only. We recorded average levels of iron as 2.08 ± 0.66 mg/L in the rainy season and 2.08 ± 0.64 mg/L in the winter season (Table S1). Tan et al. (2022) reported the level of iron in shrimp rearing pond water as 74.19 ± 14.78 μmol/g in the low salinity pond and 45.04 ± 8.91 μmol/g in the high salinity pond.

None of the linear relationships between water quality parameters and the incidence of Vibrio spp. was significant at a 0.05 probability level, both in the rainy and winter seasons, except the relation of ammonium with the incidence of Vibrio spp. in the winter season (Table 5 and Figures 2 and 3). These findings are somewhat analogous to the findings of another study conducted in shrimp pond culture systems in Sri Lanka, where none of the correlations of total Vibrio counts (TVCs) with water quality parameters was significant at a 0.05 probability level (Heenatigala and Fernando 2016). In the present study, the incidence of Vibrio spp. showed extremely weak positive linear relationships with ammonium, nitrite, and iron in the rainy season, whereas it had a weak positive linear relationship with ammonium in the winter season (Table 5 and Figures 2 and 3). Heenatigala and Fernando (2016) reported ammonia and salinity as having positive influences on TVC. Ulfiani et al. (2022) showed that decreased levels of nitrates in the shrimp culture pond water resulted in an increased number of Vibrio spp. Siddique et al. (2021) showed a significant positive relation of temperature and salinity with the incidence of V. parahaemolyticus but a significant negative association between salinity and the pathogenic V. parahaemolyticus. In this study, temperature, pH, and salinity had extremely weak negative linear relationships with the incidence of Vibrio spp., both in the rainy and winter seasons (Table 5 and Figures 2 and 3). Dayang Najwa et al. (2024) documented a stronger correlation of pH (6.14–7.64) with the growth of Vibrio spp. in a previous study. Böer et al. (2013) reported that there is no significant correlation between Vibrio spp. and salinity, and of all the Vibrio spp., only a few can live in low salinity, such as V. cholerae, V. fluvialis, V. furnissii, and V. mimicus.

Among 177 isolates of Vibrio spp., 48.02% (85/177) isolates showed a positive result for V. cholerae. These findings were relatively analogous to the findings of a previous study, where 24.7% (37/150) samples exhibited a positive result to V. cholerae (Haque et al. 2023). In the case of V. parahaemolyticus, we recorded 51.97% (92/177) isolates as positive and the observation was closely related to another study where 71.42% (5/7) isolates of V. parahaemolyticus from shrimp and prawn samples were recorded as positive (Patel et al. 2018). Among 92 isolates of V. parahaemolyticus, 15.21% isolates showed a positive result for the trh gene, and 6.52% isolates were positive for the tdh gene. A study carried out on marine shrimp samples in South Gujarat of Navsari District recorded 14.28% (1/7; 5 from shrimp and 2 from human samples) isolates as positive for the tdh gene, and none of the V. parahaemolyticus isolates was positive for the trh gene (Patel et al.2018). The findings of the present study were also comparable with the findings of another study where 5.26% (17/323) isolates were positive for the trh gene (Siddique et al. 2021). In a previous study conducted in South China on shrimp (Penaeus vannamei) breeding system, none of the isolates (n = 16) of V. parahaemolyticus was recorded as positive for tdh and trh genes (Yu et al. 2023). The differences between these findings and other findings might be because of changes in the geological distributions, environments, sample types and sizes, research techniques, and seasons.

A significant negative relation was observed between salinity and trh‐positive V. parahaemolyticus in a previous study (Siddique et al. 2021). In this study, though iron and salinity showed a positive relation, temperature and nitrite revealed a negative relation with the incidence of trh‐positive V. parahaemolyticus (Table 6).

5. Conclusions

The findings of this study highlight the assessment of the incidence of Vibrio spp. in shrimp farms in relation to water parameters in two different seasons and their molecular detection from shrimp and shrimp environments. Among the collected samples, shrimps had the highest mean total Vibrio spp. count in the rainy season, whereas water samples exhibited the lowest mean total Vibrio spp. count in the winter season. The isolation of Vibrio spp. was higher in the rainy season comparing to the winter season, and none of the water parameters showed significant relationships with the incidence of Vibrio spp. in both seasons, except ammonium in the winter season. In addition, most of the isolates of Vibrio spp. were positive for V. parahaemolyticus, and none of the water parameters demonstrated significant relationships with the incidence of trh‐positive V. parahaemolyticus, except pH in the rainy season. These findings provide a guideline necessary for future studies, both in the shrimp farming areas in Bangladesh and globally, to assess changes in the populations of Vibrio spp. relative to the changes in water parameters over time. Moreover, the findings of this study highly recommend a periodic surveillance program to be conducted for the confirmation and differentiation of the pathogenic strains of Vibrio spp., which would eventually allow for a constructive management plan to be executed to restrain the risk of the dissemination of vibriosis in shrimp farms.

Author Contributions

M. Sohidullah: conceptualization, investigation, methodology, writing – original draft, funding acquisition. Bidyut Matubber: conceptualization, methodology, writing – original draft. Md. Hamidur Rahman: data curation, formal analysis, writing – review and editing. Abu Sayeed: visualization, investigation. Sadia Rahman: visualization, investigation. Linta Yesmin: visualization, investigation. Md. Jannat Hossain: data curation, formal analysis, writing – review and editing. Md. Imran Hossain: methodology, data curation, formal analysis.

Ethics Statement

The present study followed World Organization for Animal Health (OIE) and institutional welfare standards for humane animal treatment and agreed to relevant legislation from “Ethical Standard of Research Committee, BAURES (BAURES/ESRC/78/FISH/2025/25.02.2025).”

Conflicts of Interest

The authors declare no conflicts of interest.

Supporting information

Supplementary Table S1: Analysis of water parameters (Mean ± SD) at each sampling interval collected from selected shrimp ponds (n = 30).

MBO3-15-e70256-s001.docx (18.3KB, docx)

Acknowledgments

The authors are very much thankful to the Ministry of Science and Technology (MoST), Government of the People's Republic of Bangladesh for supporting this research by providing fund (Grant Numbers [S.L. NO. 19] and [Reg. NO. 39]). The authors are also deeply indebted to the Fishtech laboratory for giving the opportunity to run molecular activities and all the shrimp farmers for giving consent to collect samples for this research.

Sohidullah, M. , Matubber B., Rahman M. H., et al. 2026. “Assessment of the Incidence of Vibrio spp. in Shrimp Farms Relative to Water Parameters and Their Molecular Detection in the Southwest Coastal Region of Bangladesh.” MicrobiologyOpen 15: e70256. 10.1002/mbo3.70256.

Equal contribution as first authors, M. Sohidullah and Bidyut Matubber.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

References

  1. Abioye, O. E. , Osunla A. C., and Okoh A. I.. 2021. “Molecular Detection and Distribution of Six Medically Important Vibrio spp. in Selected Freshwater and Brackish Water Resources in Eastern Cape Province, South Africa.” Frontiers in Microbiology 12: 617703. 10.3389/fmicb.2021.617703. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alam, M. W. , and Rahman M. M.. 2018. “Comparative Study of Salmonella and Vibrio spp. Distribution in the Karnafuly River Estuary at Bangladesh With Response to Microbial Pollution.” Indian Journal of Geo Marine Sciences 47, no. 5: 1075–1080. [Google Scholar]
  3. Al‐Amin, A. , Aktar Shipa S., Naser M. N., and Miah M. F.. 2020. “Surveillance of Vibrio spp. in Penaeus monodon Collected From Shrimp Pond of Satkhira, Bangladesh.” Journal of Zoological Research 2, no. 3: 1–8. 10.30564/jzr.v2i3.2087. [DOI] [Google Scholar]
  4. Baker‐Austin, C. , Trinanes J., and Martinez‐Urtaza J.. 2020. “The New Tools Revolutionizing Vibrio Science.” Environmental Microbiology 22, no. 10: 4096–4100. 10.1111/1462-2920.15083. [DOI] [PubMed] [Google Scholar]
  5. Bangladesh Economic Review . 2023a. Agriculture. Chapter 7, 103. Accessed June 1, 2023. https://mof.portal.gov.bd/sites/default/files/files/mof.portal.gov.bd/page/f2d8fabb_29c1_423a_9d37_cdb500260002/Chapter-7%20%28English-2023%29.pdf/. [Google Scholar]
  6. Bangladesh Economic Review . 2023b. GDP, Savings and Investment. Chapter 2, 15. Accessed June 1, 2023. https://mof.portal.gov.bd/sites/default/files/files/mof.portal.gov.bd/page/f2d8fabb_29c1_423a_9d37_cdb500260002/Chapter-2%20%28English-2023%29.pdf/. [Google Scholar]
  7. Bauer, J. , Teitge F., Neffe L., et al. 2021. “Impact of a Reduced Water Salinity on the Composition of Vibrio spp. in Recirculating Aquaculture Systems for Pacific White Shrimp (Litopenaeus vannamei) and Its Possible Risks for Shrimp Health and Food Safety.” Journal of Fish Diseases 44, no. 1: 89–105. 10.1111/jfd.13270. [DOI] [PubMed] [Google Scholar]
  8. Bedane, T. D. , Agga G. E., and Gutema F. D.. 2022. “Hygienic Assessment of Fish Handling Practices Along Production and Supply Chain and Its Public Health Implications in Central Oromia, Ethiopia.” Scientific Reports 12, no. 1: 13910. 10.1038/s41598-022-17671-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bej, A. K. , Patterson D. P., Brasher C. W., Vickery M. C. L., Jones D. D., and Kaysner C. A.. 1999. “Detection of Total and Hemolysin‐Producing Vibrio parahaemolyticus in Shellfish Using Multiplex PCR Amplification of tl, tdh and trh.” Journal of Microbiological Methods 36, no. 3: 215–225. 10.1016/s0167-7012(99)00037-8. [DOI] [PubMed] [Google Scholar]
  10. Bergey, D. H. , Buchanan R. E., and Gibbons N. E.. 1974. Bergey's Manual of Determinative Bacteriology. Williams & Wilkins. [Google Scholar]
  11. Böer, S. I. , Heinemeyer E. A., Luden K., et al. 2013. “Temporal and Spatial Distribution Patterns of Potentially Pathogenic Vibrio spp. at Recreational Beaches of the German North Sea.” Microbial Ecology 65: 1052–1067. 10.1007/s00248-013-0221-4. [DOI] [PubMed] [Google Scholar]
  12. Brumfield, K. D. , Chen A. J., Gangwar M., et al. 2023. “Environmental Factors Influencing Occurrence of Vibrio parahaemolyticus and Vibrio vulnificus .” Applied and Environmental Microbiology 89, no. 6: e00307‐23. 10.1128/aem.00307-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Castillo, A. M. , Sharpe D. M. T., Ghalambor C. K., and De León L. F.. 2018. “Exploring the Effects of Salinization on Trophic Diversity in Freshwater Ecosystems: A Quantitative Review.” Hydrobiologia 807: 1–17. 10.1007/s10750-017-3403-0. [DOI] [Google Scholar]
  14. Chaitanawisuti, N. , and Kritsanapuntu S.. 1997. “Laboratory Spawning and Juvenile Rearing of the Marine Gastropod: Spotted Babylon, Babylonia areolata Link 1807 (Neogastropoda: Buccinidae), in Thailand.” Oceanographic Literature Review 11: 232–233. [Google Scholar]
  15. Chakma, F. , Sabuj A. A. M., Haque Z. F., et al. 2018. “Isolation and Characterization of Vibrio sp. From Semi Processed Shrimp.” Journal of Research in Biology 8, no. 7: 2566–2573. [Google Scholar]
  16. Chen, Y. , Ai X., and Yang Y.. 2022. “ Vibrio cholerae: a Pathogen Shared by Human and Aquatic Animals.” Lancet Microbe 3, no. 6: e402. 10.1016/S2666-5247(22)00125-2. [DOI] [PubMed] [Google Scholar]
  17. Costa, C. , Ferreira G. D., Simões M., Silva J. L., and Campos M. J.. 2022. “Real‐Time PCR Protocol for Detection and Quantification of Three Pathogenic Members of the Vibrionaceae Family.” Microorganisms 10, no. 10: 2060. 10.3390/microorganisms10102060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Croci, L. , Suffredini E., Cozzi L., Paniconi M., Ciccaglioni G., and Colombo M. M.. 2007. “Evaluation of Different Polymerase Chain Reaction Methods for the Identification of Vibrio parahaemolyticus Strains Isolated by Cultural Methods.” Journal of AOAC International 90, no. 6: 1588–1597. [PubMed] [Google Scholar]
  19. Dayang Najwa, A. B. , Elexson N., Dalene L., and Teng S. T.. 2024. “ Vibrio Species and Cyanobacteria: Understanding Their Association in Local Shrimp Farm Using Canonical Correspondence Analysis (CCA).” Microbial Ecology 87, no. 1: 51. 10.1007/s00248-024-02356-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Dutta, D. , Kaushik A., Kumar D., and Bag S.. 2021. “Foodborne Pathogenic Vibrios: Antimicrobial Resistance.” Frontiers in Microbiology 12: 638331. 10.3389/fmicb.2021.638331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. El‐Saadony, M. T. , Swelum A. A., Abo Ghanima M. M., et al. 2022. “Shrimp Production, the Most Important Diseases That Threaten It, and the Role of Probiotics in Confronting These Diseases: A Review.” Research in Veterinary Science 144: 126–140. 10.1016/j.rvsc.2022.01.009. [DOI] [PubMed] [Google Scholar]
  22. El‐Zamkan, M. A. , Ahmed A. S., Abdelhafeez H. H., and Mohamed H. M. A.. 2023. “Molecular Characterization of Vibrio Species Isolated From Dairy and Water Samples.” Scientific Reports 13, no. 1: 15368. 10.1038/s41598-023-42334-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Federation, W. E. , and American Public Health Association . 2005. Standard Methods for the Examination of Water and Wastewater. American Public Health Association (APHA). [Google Scholar]
  24. Federici, S. , Serrazanetti D. I., Guerzoni M. E., et al. 2018. “Development of a Rapid PCR Protocol to Detect Vibrio parahaemolyticus in Clams.” Journal of Food Science and Technology 55, no. 2: 749–759. 10.1007/s13197-017-2986-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Fleischmann, S. , Herrig I., Wesp J., et al. 2022. “Prevalence and Distribution of Potentially Human Pathogenic Vibrio spp. on German North and Baltic Sea Coasts.” Frontiers in Cellular and Infection Microbiology 12: 846819. 10.3389/fcimb.2022.846819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Grimes, D. J. 2020. “The Vibrios: Scavengers, Symbionts, and Pathogens From the Sea.” Microbial Ecology 80, no. 3: 501–506. 10.1007/s00248-020-01524-7. [DOI] [PubMed] [Google Scholar]
  27. Haifa‐Haryani, W. O. , Amatul‐Samahah M. A., Azzam‐Sayuti M., et al. 2022. “Prevalence, Antibiotics Resistance and Plasmid Profiling of Vibrio spp. Isolated From Cultured Shrimp in Peninsular Malaysia.” Microorganisms 10, no. 9: 1851. 10.3390/microorganisms10091851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Haque, Z. F. , Islam M. S., Sabuj A. A. M., et al. 2023. “Molecular Detection and Antibiotic Resistance of Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio alginolyticus From Shrimp (Penaeus monodon) and Shrimp Environments in Bangladesh.” Aquaculture Research 2023: 1–11. 10.1155/2023/5436552. [DOI] [Google Scholar]
  29. Heenatigala, P. P. M. , and Fernando M. U. L.. 2016. “Occurrence of Bacteria Species Responsible for Vibriosis in Shrimp Pond Culture Systems in Sri Lanka and Assessment of the Suitable Control Measures.” Sri Lanka Journal of Aquatic Sciences 21, no. 1: 1–17. [Google Scholar]
  30. Hossain, M. T. , Kim E. Y., Kim Y. R., Kim D. G., and Kong I. S.. 2012. “Application of groEL Gene for the Species‐Specific Detection of Vibrio parahaemolyticus by PCR.” Letters in Applied Microbiology 54, no. 1: 67–72. 10.1111/j.1472-765X.2011.03174.x. [DOI] [PubMed] [Google Scholar]
  31. Hossain, M. T. , Kim E. Y., Kim Y. R., Kim D. G., and Kong I. S.. 2013. “Development of a groEL Gene–Based Species‐Specific Multiplex Polymerase Chain Reaction Assay for Simultaneous Detection of Vibrio cholerae, Vibrio parahaemolyticus and Vibrio vulnificus .” Journal of Applied Microbiology 114, no. 2: 448–456. 10.1111/jam.12056. [DOI] [PubMed] [Google Scholar]
  32. Hossain, M. J. , Rasin J. H., Altaib H., et al. 2025. “Prevalence and Antibiotic Resistance Patterns of Vibrio cholerae Isolated From Diverse Food Sources in Khulna, Bangladesh.” Food and Humanity 5: 100653. 10.1016/j.foohum.2025.100653. [DOI] [Google Scholar]
  33. Huang, Z. , Anokyewaa M. A., Wang J., Jian J., and Lu Y.. 2022. “Pathogenicity and Antibiotic Resistance Analysis of Vibrio Species Found in Coastal Water at Mainly Beach of Shenzhen, China.” Frontiers in Marine Science 9: 980593. 10.3389/fmars.2022.980593. [DOI] [Google Scholar]
  34. Huang, Z. , Hou D., Zhou R., et al. 2021. “Environmental Water and Sediment Microbial Communities Shape Intestine Microbiota for Host Health: The Central Dogma in an Anthropogenic Aquaculture Ecosystem.” Frontiers in Microbiology 12: 772149. 10.3389/fmicb.2021.772149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Iber, B. T. , Okomoda V. T., Rozaimah S. A., and Kasan N. A.. 2021. “Eco‐Friendly Approaches to Aquaculture Wastewater Treatment: Assessment of Natural Coagulants Vis‐a‐Vis Chitosan.” Bioresource Technology Reports 15: 100702. 10.1016/j.biteb.2021.100702. [DOI] [Google Scholar]
  36. Jahan, N. , Islam S., Evamoni F. Z., et al. 2017. “Assessment of Physicochemical and Bacteriological Quality of Different Surface Water Samples of Tangail District, Bangladesh.” Advances in Microbiology 7, no. 11: 769–789. 10.4236/aim.2017.711062. [DOI] [Google Scholar]
  37. Jantapaso, H. , Aksonkird T., and Mittraparp‐Arthorn P.. 2024. “Characteristics of Vibrio cholerae Isolates Obtained From Shrimp Supply Chains and Inhibitory Activities of Rambutan (Nephelium lappaceum L. cv. Rong Rian) Peel Aqueous Extract.” Food Control 158: 110231. 10.1016/j.foodcont.2023.110231. [DOI] [Google Scholar]
  38. Jiménez‐Bambague, E. M. , Madera‐Parra C. A., Rangel‐Delgado M. F., et al. 2023. “Photo‐Fenton and Electro‐Fenton Performance for the Removal of Pharmaceutical Compounds in Real Urban Wastewater.” Electrochimica Acta 442: 141905. 10.1016/j.electacta.2023.141905. [DOI] [Google Scholar]
  39. Joseph, S. , and Bhat K. G.. 2000. “Effect of Iron on the Survival of Vibrio cholerae in Water.” Indian Journal of Medical Research 111: 115–117. [PubMed] [Google Scholar]
  40. Karim, M. F. , Zhang X., and Li R.. 2019. “Dynamics of Shrimp Farming in the Southwestern Coastal Districts of Bangladesh Using a Shrimp Yield Dataset (SYD) and Landsat Satellite Archives.” Sustainability 11, no. 17: 4635. 10.3390/su11174635. [DOI] [Google Scholar]
  41. Kim, Y. B. , Okuda J., Matsumoto C., Takahashi N., Hashimoto S., and Nishibuchi M.. 1999. “Identification of Vibrio parahaemolyticus Strains at the Species Level by PCR Targeted to the toxR Gene.” Journal of Clinical Microbiology 37, no. 4: 1173–1177. 10.1128/jcm.37.4.1173-1177.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Letchumanan, V. , Yin W. F., Lee L. H., and Chan K. G.. 2015. “Prevalence and Antimicrobial Susceptibility of Vibrio parahaemolyticus Isolated From Retail Shrimps in Malaysia.” Frontiers in Microbiology 6: 33. 10.3389/fmicb.2015.00033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Liu, J. , Xiong R., Wu Q., et al. 2025. “Detection, Assessment, and Control Strategies for Managing Vibrio parahaemolyticus Risk in Seafood.” Food Quality and Safety 9: fyae051. 10.1093/fqsafe/fyae051. [DOI] [Google Scholar]
  44. Meparambu Prabhakaran, D. , Ramamurthy T., and Thomas S.. 2020. “Genetic and Virulence Characterisation of Vibrio parahaemolyticus Isolated From Indian Coast.” BMC Microbiology 20: 62. 10.1186/s12866-020-01746-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Möller, L. , Kreikemeyer B., Gerdts G., Jost G., and Labrenz M.. 2021. “Fish as a Winter Reservoir for Vibrio spp. in the Southern Baltic Sea Coast.” Journal of Marine Systems 221: 103574. 10.1016/j.jmarsys.2021.103574. [DOI] [Google Scholar]
  46. Muthukrishnan, S. , Defoirdt T., Ina‐Salwany M. Y., et al. 2019. “ Vibrio parahaemolyticus and Vibrio harveyi causing Acute Hepatopancreatic Necrosis Disease (AHPND) in Penaeus vannamei (Boone, 1931) isolated From Malaysian shrimp ponds.” Aquaculture 511: 734227. 10.1016/j.aquaculture.2019.734227. [DOI] [Google Scholar]
  47. Naylor, R. L. , Hardy R. W., Buschmann A. H., et al. 2021. “A 20‐year Retrospective Review of Global Aquaculture.” Nature 591, no. 7851: 551–563. 10.1038/s41586-021-03308-6. [DOI] [PubMed] [Google Scholar]
  48. Norfolk, W. A. , Shue C., Henderson W. M., Glinski D. A., and Lipp E. K.. 2023. “ Vibrio alginolyticus Growth Kinetics and the Metabolic Effects of Iron.” Microbiology Spectrum 11, no. 6: e02680‐23. 10.1128/spectrum.02680-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Olson, N. D. , and Morrow J. B.. 2012. “DNA Extract Characterization Process for Microbial Detection Methods Development and Validation.” BMC Research Notes 5, no. 1: 668. 10.1186/1756-0500-5-668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Patel, R. K. , Savalia C. V., Kumar R., Kalyani I. H., Gupta S., and Suthar A. P.. 2018. “Isolation, Identification and Molecular Characterization of Vibrio parahaemolyticus From Shrimp Samples From South Gujarat of Navsari District.” Journal of Animal Research 8, no. 1: 131–136. 10.30954/2277-940X.2018.00150.21. [DOI] [Google Scholar]
  51. Payne, S. M. , Mey A. R., and Wyckoff E. E.. 2016. “ Vibrio Iron Transport: Evolutionary Adaptation to Life in Multiple Environments.” Microbiology and Molecular Biology Reviews 80, no. 1: 69–90. 10.1128/MMBR.00046-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Pazhani, G. P. , Chowdhury G., and Ramamurthy T.. 2021. “Adaptations of Vibrio parahaemolyticus to Stress During Environmental Survival, Host Colonization, and Infection.” Frontiers in Microbiology 12: 737299. 10.3389/fmicb.2021.737299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Percival, S. L. , and Williams D. W.. 2014. “Microbiology of Waterborne Diseases.” In Microbiological Aspects and Risks, edited by Percival S. L., Yates M. V., Williams D. W., Chalmers R. M., and Gray N. F., 237–248. Elsevier/Academic Press. 10.1016/C2010-0-67101-X. [DOI] [Google Scholar]
  54. Praveen Joshi, H. S. , and Ramachadra Naik A. T.. 2023. “Water and Soil Studies in Shrimp Aquaculture Systems.” Environment Conservation Journal 24, no. 3: 249–259. 10.36953/ECJ.16132511. [DOI] [Google Scholar]
  55. Rahman, M. S. , Eshik M. M. E., Punom N. J., Abedin M. M., and Begum M. K.. 2020. “Diversity of Vibrio Species' and Their Antibiotic Resistance Patterns in Black Tiger Shrimp Penaeus monodon Fabricius, 1798 Cultured in South‐West Region of Bangladesh.” Asian Fisheries Science 33, no. 4: 330–340. 10.33997/j.afs.2020.33.4.004. [DOI] [Google Scholar]
  56. Rahman, M. T. , Sobur M. A., Islam M. S., et al. 2020. “Zoonotic Diseases: Etiology, Impact, and Control.” Microorganisms 8, no. 9: 1405. 10.3390/microorganisms8091405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. R Core Team . 2023. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing. https://www.R-project.org/. [Google Scholar]
  58. Ren, Q. , and Hill J. E.. 2023. “Rapid and Accurate Taxonomic Classification of cpn60 Amplicon Sequence Variants.” ISME Communications 3, no. 1: 77. 10.1038/s43705-023-00283-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sacheli, R. , Philippe C., Meex C., Mzougui S., Melin P., and Hayette M. P.. 2023. “Occurrence of Vibrio spp. in Selected Recreational Water Bodies in Belgium During 2021 Bathing Season.” International Journal of Environmental Research and Public Health 20, no. 20: 6932. 10.3390/ijerph20206932. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Sampaio, A. , Silva V., Poeta P., and Aonofriesei F.. 2022. “ Vibrio spp.: Life Strategies, Ecology, and Risks in a Changing Environment.” Diversity 14, no. 2: 97. 10.3390/d14020097. [DOI] [Google Scholar]
  61. Sarker, S. , Mahmud S., Sultana R., et al. 2019. “Quality Assessment of Surface and Drinking Water of Nakla Paurosova, Sherpur, Bangladesh.” Advances in Microbiology 9, no. 8: 703–727. 10.4236/aim.2019.98043. [DOI] [Google Scholar]
  62. Siddique, A. B. , Moniruzzaman M., Ali S., et al. 2021. “Characterization of Pathogenic Vibrio parahaemolyticus Isolated From Fish Aquaculture of the Southwest Coastal Area of Bangladesh.” Frontiers in Microbiology 12: 635539. 10.3389/fmicb.2021.635539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Sitthi, S. , Mirutanaphai M., Satanwat P., Powtongsook S., and Pungrasmi W.. 2024. “Effect of Ozone on Vibrio Removal in a Simulated Earthen Shrimp Pond.” Blue–Green Systems 6, no. 2: 310–326. 10.2166/bgs.2024.015. [DOI] [Google Scholar]
  64. Sohidullah, M. , Rahman M. H., Sayeed A., et al. 2025. “Exploration of Shrimp and Their Environments for the Detection of Antibiotic Resistance Genes of Vibrio parahaemolyticus and Spectrophotometry of Shrimp Muscles for Heavy Metals and Their Human Health Risk Assessment in Bangladesh.” Journal of Food Protection 88, no. 4: 100475. 10.1016/j.jfp.2025.100475. [DOI] [PubMed] [Google Scholar]
  65. Stratev, D. , Fasulkova R., and Krumova‐Valcheva G.. 2023. “Incidence, Virulence Genes and Antimicrobial Resistance of Vibrio parahaemolyticus Isolated From Seafood.” Microbial Pathogenesis 177: 106050. 10.1016/j.micpath.2023.106050. [DOI] [PubMed] [Google Scholar]
  66. Talukder, B. , Chakma F., Sabuj A. A. M., Haque Z. F., Rahman M. T., and Saha S.. 2019. “Identification, Prevalence and Antimicrobial Susceptibility of Major Pathogenic Bacteria in Exportable Shrimp (Penaeus monodon) of Southern Bangladesh.” International Journal of Fisheries and Aquatic Studies 7, no. 1: 96–99. [Google Scholar]
  67. Tan, J. , Luo M., Tan F., et al. 2022. “Iron Reduction Controls Carbon Mineralization in Aquaculture Shrimp Pond Sediments in Subtropical Estuaries.” Journal of Geophysical Research: Biogeosciences 127, no. 12: e2022JG007081. 10.1029/2022JG007081. [DOI] [Google Scholar]
  68. Ulfiani, P. , Hasan A. M., and Retnowati Y.. 2022. “Detection of Vibrio sp. on Vaname Shrimp (Litopanaeus vannamei) Cultivation Pond in Gorontalo, Indonesia.” Nusantara Bioscience 14, no. 2: 340–346. 10.13057/nusbiosci/n140216. [DOI] [Google Scholar]
  69. Vandeputte, M. , Coppens S., Bossier P., Vereecke N., and Vanrompay D.. 2024. “Genomic Mining of Vibrio parahaemolyticus Highlights Prevalence of Antimicrobial Resistance Genes and New Genetic Markers Associated With AHPND and tdh+/trh+ Genotypes.” BMC Genomics 25, no. 1: 178. 10.1186/s12864-024-10093-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Venkateswarlu, V. , Seshaiah P. V., Arun P., and Behra P. C.. 2019. “A Study on Water Quality Parameters in Shrimp L. vannamei Semi‐Intensive Grow Out Culture Farms in Coastal Districts of Andhra Pradesh, India.” International Journal of Fisheries and Aquatic Studies 7, no. 4: 394–399. [Google Scholar]
  71. Villarreal, H. , and Juarez L.. 2022. “Super‐Intensive Shrimp Culture: Analysis and Future Challenges.” Journal of the World Aquaculture Society 53, no. 5: 928–932. 10.1111/jwas.12929. [DOI] [Google Scholar]
  72. Wang, D. , Fang Z., Xie C., and Liu Y.. 2013. “Construction of Method for Rapid Detection of Vibrio parahaemolyticus Using the Quantitative Real‐Time PCR Based on the ToxR Gene.” Advance Journal of Food Science and Technology 5, no. 8: 1022–1030. [Google Scholar]
  73. Wang, W. , Liu J., Guo S., et al. 2021. “Identification of Vibrio parahaemolyticus and Vibrio spp. Specific Outer Membrane Proteins by Reverse Vaccinology and Surface Proteome.” Frontiers in Microbiology 11: 625315. 10.3389/fmicb.2020.625315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Ward, L. N. , and Bej A. K.. 2006. “Detection of Vibrio parahaemolyticus in Shellfish by Use of Multiplexed Real‐Time PCR With TaqMan Fluorescent Probes.” Applied and Environmental Microbiology 72, no. 3: 2031–2042. 10.1128/aem.72.3.2031-2042.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Wong, Y. Y. , Lee C. W., Bong C. W., et al. 2024. “Environmental Factors That Regulate Vibrio spp. Abundance and Community Structure in Tropical Waters.” Anthropocene Coasts 7, no. 1: 21. 10.1007/s44218-024-00054-w. [DOI] [Google Scholar]
  76. Yeung, M. , and Thorsen T.. 2016. “Development of a More Sensitive and Specific Chromogenic Agar Medium for the Detection of Vibrio parahaemolyticus and Other Vibrio Species.” Journal of Visualized Experiments: JoVE 117: 54493. 10.3791/54493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Yu, Y. , Tang M., Wang Y., et al. 2023. “Virulence and Antimicrobial Resistance Characteristics Assessment of Vibrio Isolated From Shrimp (Penaeus vannamei) Breeding System in South China.” Ecotoxicology and Environmental Safety 252: 114615. 10.1016/j.ecoenv.2023.114615. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Table S1: Analysis of water parameters (Mean ± SD) at each sampling interval collected from selected shrimp ponds (n = 30).

MBO3-15-e70256-s001.docx (18.3KB, docx)

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Articles from MicrobiologyOpen are provided here courtesy of Wiley

RESOURCES