Genetic Association Analysis of Skin Traits and the TAF11 Gene in Shenxian Pigs

Simple Summary

The thickness and collagen content of pig skin are key determinants of leather quality. This study systematically measured skin traits across nine anatomical sites in Shenxian pigs, revealing significant regional variation in both thickness and collagen content. The results indicate that a specific mutation in the TAF11 gene is significantly associated with increased skin thickness, with this effect being more pronounced in sows. This finding suggests that this genetic locus holds potential as a molecular marker for assisting in the future selection of breeding stock with superior skin thickness. The study provides a genetic basis for developing the hide resource value of Shenxian pigs and contributes to enhancing the overall economic efficiency of their production.

Abstract

This study aimed to characterize the site-specific variation in skin traits of Shenxian pigs and to identify key genetic loci regulating skin thickness. A total of 50 Shenxian pigs were selected, and skin samples were collected from nine different anatomical sites. Total skin thickness was precisely measured, and collagen content was determined for each site. Based on literature review and database screening, TAF11 was identified as a candidate gene. Genotyping of the g.35543837 locus was performed using Sanger sequencing and KASP, followed by association analysis between different genotypes and skin thickness traits. The results showed significant site-specific variations in skin thickness (1.26–7.20 mm) and collagen content (7.01–24.54 g/100 g) in Shenxian pigs. Association analysis revealed that the TAF11 g.35543837 C > G variant was significantly associated with increased skin thickness, with the effect being particularly evident in gilt. Individuals with the CG genotype exhibited greater skin thickness at multiple anatomical sites compared with those carrying the CC genotype. This study preliminarily identified a potential locus associated with skin thickness in Shenxian pigs within the TAF11 gene. The sex-dependent effect observed at this locus provides a new clue for understanding the genetic basis of this complex trait and offers valuable information for the genetic improvement of skin-related traits in Shenxian pigs.

1. Introduction

By the end of 2024, the global pig inventory reached approximately 759.3 million. China, the European Union, and the United States accounted for 57.19%, 17.50%, and 9.94% of the global total, respectively [1]. As a major pig-producing country, China generates a substantial amount of pig skin during slaughtering, providing a significant material basis for research on its utilization [2]. The skin serves as a critical barrier for maintaining internal homeostasis and protecting the body against viruses, bacteria, and other harmful external substances [3]. As the largest organ of the pig, the skin constitutes the first line of defense for overall health, with its structural integrity and functional status directly influencing physiological metabolism, immune defense, and general health. Therefore, maintaining skin health in pig production represents an important strategy for disease prevention and enhancing production efficiency. Beyond its biological functions, pig skin also plays a vital role in medical esthetics, clinical medicine, targeted drug delivery, and the leather manufacturing industry [4,5,6]. With expanding applications in collagen extraction and medical esthetics, along with growing consumer acceptance in the food sector, the market demand for high-quality pig skin is steadily increasing [7]. However, previous studies indicate that although pig skin resources are abundant in China, only a small proportion is utilized for industrial leather production, while the majority remains underutilized, leading to substantial waste of high-quality protein resources [8,9].

Pig skin is rich in collagen, and its nutritional value has attracted considerable attention [10]. However, current research on pig skin remains limited, particularly regarding skin thickness, genes influencing thickness, and the effect of sex on skin thickness [11]. Most existing studies on skin-related genes have focused on physiological or pathological skin processes, with few reports addressing genes associated with physiological skin thickness traits [12,13]. Through literature and database review, combined with previous genetic mapping results, this study identified TAF11 as a candidate gene for investigating the genetic mechanisms underlying porcine skin thickness. The TAF11 gene encodes one of the TATA-box binding protein-associated factors, which is a key component of the RNA polymerase II transcription initiation complex in eukaryotes and plays a central role in maintaining normal cell growth and transcriptional regulation [14]. Previous studies have shown that porcine skin thickness is under considerable genetic control. Ai et al. (2014) mapped a quantitative trait locus (QTL) to the 34.5–36.2 Mb interval on SSC7 in an Erhualian × White Duroc F₂ resource population, which explained 23.9% of the phenotypic variation in skin thickness [15]. Subsequently, Huang et al. (2016) confirmed the importance of this QTL region through association analysis in the Bama Xiang pig population and identified a SNP locus within TAF11 (SSC7: g.35543837) that was significantly associated with skin thickness at multiple body sites, including the armpit and rump [16]. These findings collectively suggest that TAF11 within this QTL region may contribute to skin thickness variation (Supplementary Materials). However, establishing a causal relationship between TAF11 and skin thickness requires further experimental validation. Existing genetic associations need to be confirmed across different populations and experimental designs, and the underlying biological mechanisms remain to be elucidated. Clarifying these aspects would help assess the potential utility of this genetic marker in breeding programs. Therefore, this study aimed to perform an exploratory analysis of this candidate locus within TAF11. Using Shenxian pigs currently the only highly prolific fatty-type black pig breed in Hebei Province, known for their strong environmental adaptability, thick and coarse skin, and early sexual maturity as experimental subjects [17,18,19], we analyzed polymorphism at the g.35543837 locus and examined its association with skin thickness traits across different body regions. This work aims to provide preliminary data and a reference for further functional studies of TAF11 and its potential application in pig breeding.

2. Materials and Methods

2.1. Test Animals

A total of 50 healthy 270-day-old Shenxian pigs (25 barrows and 25 gilts) were randomly selected. The pigs were housed in standardized enclosed pens and had an average pre-slaughter body weight of approximately 110 kg. After a 24 h fast, the pigs were humanely slaughtered. Skin tissue samples were collected from nine anatomical sites: face, shoulder, armpit, back, loin, rump, belly, trotter, and chest (Figure 1). In addition, ear tissue samples were taken from all 50 pigs using an ear notcher and stored immediately in 75% ethanol at −20 °C for subsequent DNA analysis.

Figure 1.

Schematic diagram of the nine anatomical sampling sites on Shenxian pigs.

2.2. Measurement of Skin Thickness and Determination of Collagen Content

After slaughter, intact 9 cm² skin samples were collected from nine anatomical sites (face, shoulder, armpit, back, loin, belly, trotter, rump, and chest) of each Shenxian pig using surgical scissors. Vascular and scarred areas were avoided during sampling. Two replicates per site were collected to ensure intact sample margins. For thickness measurement, skin samples were kept unstretched and in their natural state. Total epidermal and dermal thickness was measured perpendicularly on the cut surface using a vernier caliper (accuracy: 0.01 mm). Three measurements were taken per sample, and the mean value was recorded as the final thickness. To determine collagen content, 8 pigs (4 barrows and 4 gilts) were randomly selected from the original cohort (n = 50) for collagen analysis, while the remaining 42 pigs were used for supplementary trait assessment. Skin samples from all nine sites were analyzed for collagen content, with three technical replicates per site per animal. Porcine type I collagen (COLI) content was quantified using a commercial Porcine Type I Collagen ELISA Kit (JM-10304P1, 96 T) (Shanghai Lanjibio Technology Co., Ltd., Shanghai, China). Tissue homogenates were centrifuged, and the supernatant was collected. After 5-fold dilution, samples and a serial standard curve (100–1600 μg/L) were loaded into the microplate. The procedure included incubation at 37 °C, washing steps, addition of HRP-conjugated antibody, TMB substrate reaction, and stopping with sulfuric acid. Absorbance was measured at 450 nm. Sample concentrations were calculated by fitting a four-parameter logistic (4-PL) standard curve and expressed as μg per gram of wet tissue weight (μg/g).

2.3. DNA Extraction and Quality Control

DNA was extracted from ear tissue samples of 50 pigs using the Tiangen Fast DNA Extraction and Detection Kit (DP304-02, Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. Approximately 20 mg of tissue was lysed in 200 μL of buffer GA with 20 μL of Proteinase K at 56 °C until complete dissolution. After adding 200 μL of buffer GB, the mixture was incubated at 70 °C for 10 min, followed by the addition of 200 μL of absolute ethanol. The lysate was then transferred to a silica-membrane column and washed sequentially with 500 μL of buffer GD and 600 μL of buffer PW. DNA was eluted in 100 μL of pre-heated elution buffer (10 mM Tris–HCl, pH 8.5). Concentration and purity were assessed using a NanoDrop micro-spectrophotometer (Beijing Liuyi Instrument Factory, Beijing, China), with the OD₂₆₀/₂₈₀ ratio ranging from 1.8 to 2.1. Integrity was further verified by agarose gel electrophoresis. Qualified samples were stored at −20 °C.

2.4. Primer Synthesis and Sequencing

Specific primers targeting the exon region of the porcine TAF11 gene (Gene ID: 100151814) were designed with SnapGene 6.0.2 and Primer Premier 5.0, based on the NCBI reference sequence. In silico specificity was confirmed using NCBI BLAST (Version 2.5.0). All primers (Table 1) were synthesized by Beijing Biomade Gene Technology Co., Ltd., (Beijing, China), PCR was performed using reagents from the Tiangen Fast DNA Extraction Kit (DP304-02, Tiangen Biotech Co., Ltd., Beijing, China) under conditions listed in Table 2. The thermal profile consisted of initial denaturation at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s; and final extension at 72 °C for 5 min. PCR products were separated on a 1.5% agarose gel (1× TBE) at 150 V for 25 min, with fragment size estimated using a DL2000 DNA Marker (Suzhou Yuheng Biotechnology Co., Ltd., Suzhou, China). Target bands were excised and purified using the SanPrep Column DNA Gel Recovery Kit (B518131-0100, Sangon Biotech, Shanghai, China) following the manufacturer’s instructions. Briefly, gel slices were weighed and dissolved in 3–6 volumes of Buffer B2 at 50 °C for 5–10 min. The dissolved gel solution was loaded onto a purification column and centrifuged at 8000× g for 30 s. The column was washed twice with 500 μL of Wash Solution (containing 80% ethanol) and centrifuged at 9000× g for 30 s each. After a final empty centrifugation step (9000× g, 1 min), DNA was eluted with 30 μL of Elution Buffer (2.5 mM Tris–HCl, pH 8.5). Purified amplicons were submitted to Shanghai Sangon Biotech Co., Ltd., (Shanghai, China), for bidirectional Sanger sequencing to identify sequence variants.

Table 1.

Primers for amplifying the TAF11 gene.

Primer Name	Primer Sequence (5′–3′)	Amplification Region Annealing	Temperature (°C)	Fragment Length (bp)
TAF11-F2	GTTGAAGGCATCCAGCTCTTAC	g.100151628–g.100151972	58	345
TAF11-R2	CCATTCCAACCAGCTAGACAG	g.100151628–g.100151972	58	345

Table 2.

PCR Reaction System.

Components	Volume
2 × Det PCR MasterMix	10 μL
Forward Primer	0.5 μL
Reverse Primer	0.5 μL
Template DNADNA	1 μL
ddH2O	8 μL

2.5. KASP Genotyping

Following the identification of SNP loci in the target region of the TAF11 gene, genomic DNA samples from all Shenxian pigs, along with detailed SNP information, were submitted to Beijing Compass Biotechnology Co., Ltd., (Beijing, China), for genotyping using KASP. The genotyping was conducted on the QuantStudio™ 7 Flex system (Thermo Fisher Scientific Inc., Waltham, MA, USA), and a cluster plot was generated for allele discrimination.

2.6. Statistical Analysis

Data were organized in Excel 2019 and analyzed using SPSS 26.0. Descriptive statistics and normality tests were conducted. Differences in skin thickness and collagen content between sexes were assessed using independent samples t-tests. Variations in these traits across the nine anatomical sites were compared via one-way ANOVA. Simple correlation analysis was performed to evaluate the relationships between skin thickness measurements at different sites. As the experiment was conducted within a single farm, season, and cohort, factors such as year and age were omitted from the model. The following linear model was applied: y = μ + S + B + G + e, where y is the skin thickness phenotype, μ is the intercept, S is the fixed effect of sex, B is the fixed effect of body site, G is the fixed effect of genotype, and e is the residual.

3. Results

3.1. Analysis of Skin Thickness at Nine Sites in Shenxian Pigs

3.1.1. Statistical Analysis of Skin Thickness at Different Sites

Skin thickness was measured at nine anatomical sites in 50 Shenxian pigs (Table 3). Ordered from thinnest to thickest, the sites were: armpit, chest, belly, face, trotter, rump, loin, shoulder, and back. The back showed the greatest thickness (5.73 ± 0.68 mm), while the belly was the thinnest (2.21 ± 0.42 mm). Facial skin thickness had the lowest coefficient of variation (CV = 11%), whereas belly skin thickness exhibited the highest (CV = 19%). Normality tests indicated that skin thickness data for all nine sites face, shoulder, armpit, back, loin, belly, trotter, rump, and chest followed a normal distribution (p > 0.05).

Table 3.

Statistical analysis of skin thickness in 9 different parts of Shenxian pig.

Body Part	Face	Shoulder	Armpit	Back	Loin	Belly	Trotter	Rump	Chest
Mean	3.24	4.8	2.54	5.73	5.17	2.21	2.86	3.06	2.74
Standard Deviation	0.37	0.61	0.45	0.68	0.77	0.42	0.36	0.37	0.35
Maximum	4.18	6.10	3.37	7.20	6.71	3.06	3.55	3.99	3.44
Minimum	2.57	3.52	1.58	4.05	3.59	1.26	1.95	2.25	1.85
CV	0.11	0.13	0.18	0.12	0.15	0.19	0.13	0.12	0.13
p-value	0.55	0.63	0.17	0.7	0.79	0.54	0.64	0.75	0.81

p-value for the normality test. Unit in millimeters.

3.1.2. Correlation Analysis of Skin Thickness Between Different Sites

A correlation analysis was conducted to assess skin thickness relationships across the nine anatomical sites in Shenxian pigs. The results showed a significant correlation between the armpit and the face (p < 0.05), and between the loin and the rump (p < 0.05). Skin thickness between all other site pairs exhibited a highly significant positive correlation (p < 0.01) (Figure 2).

Figure 2.

Correlation analysis of skin thickness among different body parts in Shenxian pigs. The heatmap depicts the pairwise Pearson correlation coefficients (r). The color scale from blue to red represents the strength and direction of correlation, with blue indicating negative and red indicating positive correlations. Asterisks denote statistical significance: * p < 0.05, ** p < 0.01. The analyzed body parts are labeled on both axes.

3.1.3. Analysis of Skin Thickness Differences Between Sexes

To investigate sex-related differences in skin thickness, Shenxian pigs were divided into barrows and gilts. Independent samples t-tests revealed that barrows had significantly thicker skin than gilts at the armpit and belly (p < 0.05). The difference was highly significant (p < 0.01) at the face, trotter, rump, and chest, with barrows again showing greater thickness. No significant sex-based difference was observed at the shoulder, back, or loin (Table 4).

Table 4.

Sex differences in skin thickness at nine anatomical sites of Shenxian pigs.

Body Part	Gender	Sample Size	Mean/mm	p-Value
Face	barrow	25	3.37 ± 0.35	0.006
	gilt	25	3.10 ± 0.32
Shoulder	barrow	25	4.93 ± 0.59	0.107
	gilt	25	4.65 ± 0.60
Armpit	barrow	25	2.67 ± 0.42	0.028
	gilt	25	2.39 ± 0.43
Back	barrow	25	5.87 ± 0.68	0.128
	gilt	25	5.58 ± 0.66
Loin	barrow	25	5.31 ± 0.77	0.185
	gilt	25	5.02 ± 0.75
Belly	barrow	25	2.34 ± 0.39	0.02
	gilt	25	2.07 ± 0.40
Trotter	barrow	25	3.00 ± 0.33	0.004
	gilt	25	2.71 ± 0.33
Rump	barrow	25	3.19 ± 0.36	0.008
	gilt	25	2.92 ± 0.32
Chest	barrow	25	2.87 ± 0.32	0.004
	gilt	25	2.59 ± 0.33

In the table, p > 0.05 indicates no significant difference, and p < 0.05 indicates a significant difference.

3.2. Sites Analysis of Skin Collagen Content at Nine Sites in Shenxian Pigs

3.2.1. Statistical Analysis of Skin Collagen Content Across Different Body

Collagen content was measured in skin samples from nine anatomical sites in eight Shenxian pigs. The content across sites, listed in descending order, was trotter, face, shoulder, back, loin, rump, belly, chest, and armpit. Specifically, collagen content per 100 g of skin was highest in the trotter (23.32 ± 0.71 g) and lowest in the armpit (8.34 ± 0.63 g) (Table 5). Normality tests confirmed that collagen content data for all sites followed a normal distribution (p > 0.05).

Table 5.

Collagen content in 9 different parts of Shenxian pig skin.

Body Part	Face	Shoulder	Armpit	Back	Loin	Belly	Trotter	Rump	Chest
Mean	21.31	20.96	8.34	20.28	17.71	12.52	23.32	17.62	9.53
Standard Deviation	0.45	0.75	0.63	0.75	0.54	0.79	0.71	0.71	0.85
Maximum	21.98	22.41	9.32	21.80	18.53	14.18	24.54	19.01	11.10
Minimum	20.36	19.42	7.01	18.26	16.54	11.06	21.62	16.42	7.88
p-value	0.69	0.97	0.84	0.54	0.48	0.62	0.77	0.46	0.88

p-value for the normality test. Unit in millimeters.

3.2.2. Correlation Analysis of Collagen Content in Different Skin Regions

Collagen content was measured in skin samples from nine anatomical regions of Shenxian pigs. A correlation analysis showed a significant positive correlation between the trotter and rump regions (p < 0.05), while no significant correlations were observed among any other site pairs (Table 6).

Table 6.

Correlation between epidermis and dermal collagen content in different parts of Shenxian pigs.

Body Part	Face	Shoulder	Armpit	Back	Loin	Belly	Trotter	Rump	Chest
Face		−0.008	−0.009	0.175	−0.120	0.039	−0.325	−0.315	−0.046
Shoulder	0.486		−0.091	0.060	−0.097	0.174	0.096	0.219	0.156
Armpit	0.484	0.337		−0.190	0.047	−0.236	0.164	0.266	0.102
Back	0.206	0.390	0.187		0.268	0.048	−0.303	0.219	0.023
Loin	0.287	0.326	0.414	0.103		0.058	0.055	0.290	0.143
Belly	0.428	0.208	0.133	0.411	0.394		−0.194	−0.166	−0.096
Trotter	0.061	0.327	0.222	0.075	0.400	0.182		0.345	−0.079
Rump	0.067	0.151	0.104	0.152	0.084	0.220	0.049		0.000
Chest	0.415	0.234	0.317	0.458	0.252	0.328	0.357	0.500

The upper triangle represents the correlation coefficient. The lower triangle represents the significance p-value.

3.3. Results for Candidate Genes Associated with Skin Thickness in Shenxian Pigs

3.3.1. Genomic DNA Extraction from Shenxian Pigs

Following 1% agarose gel electrophoresis, PCR products amplified with TAF11 primers R2 and F2 showed clear target bands without nonspecific amplification or primer dimers. The product length was 345 bp, and the 260/280 absorbance ratio ranged from 1.8 to 2.1, indicating high DNA purity (Figure 3). These results are consistent with expectations and confirm that the samples were suitable for downstream analysis.

Figure 3.

Agarose gel electrophoresis of PCR products for the TAF11 gene. M: DL2000 DNA Marker (band sizes as labeled). Sample lanes show a single, clear target band at approximately 345 bp with no nonspecific amplification, confirming specific and accurate PCR amplification.

3.3.2. SNP Analysis and KASP Genotyping

Purified DNA samples were submitted to Shanghai Sangon Biotech Co., Ltd. for Sanger sequencing, which identified a C > G mutation at position g.35543837 within the TAF11 gene on chromosome 7 (Figure 4). This missense mutation alters the codon from CGG (arginine) to GGG (glycine), resulting in an arginine-to-glycine substitution. Subsequent KASP genotyping of the 50 Shenxian pigs confirmed two genotypes: the wild-type CC and the variant CG. The genotype frequencies were 46 (CC) and 4 (CG) (Figure 5, Table 7).

Figure 4.

Sequencing chromatograms of the SNP (g.35543837 C > G) in the TAF11 gene. Chromatograms for the CC (top) and CG (bottom) genotypes are shown. The arrowhead points to the SNP site, showing a C/G heterozygous double peak (bottom) in contrast to the C homozygous single peak (top).

Figure 5.

KASP typing results of SNP loci of TAF11 gene. The genotyping results are shown in the legend, blue indicate homozygosity, green indicates heterozygosity, and black represents the negative control.

Table 7.

Distribution of TAF11 gene mutations in the population.

Gene	Genotype	Count	Population Proportion
TAF11	GG	0	0.0%
	GC	4	8.0%
	CC	46	92.0%

3.3.3. Association Between TAF11 Genotypes and Skin Thickness

To assess the association between TAF11 genotypes and skin thickness in Shenxian pigs, phenotypic values were compared between pigs carrying the CG genotype and those with the CC genotype. The results showed that among gilts, the CG genotype was associated with greater skin thickness than the CC genotype at seven of the nine sites (face, shoulder, armpit, belly, trotter, rump, and chest), suggesting a broad thickening effect of this mutation in females. In barrows, however, the CG genotype showed a trend toward greater thickness only at the face and rump, with minimal differences observed at other sites (Table 8).

Table 8.

Association Analysis Between TAF11 Genotype and Pig Skin Thickness at Different Body Sites.

Gene	Gender	Genotype	Face	Shoulder	Armpit	Back	Loin	Belly	Trotter	Rump	Chest
TAF11	Male	CC	3.34 ± 0.38	4.91 ± 0.64	2.66 ± 0.48	5.8 ± 0.81	5.25 ± 0.88	2.33 ± 0.44	2.96 ± 0.37	3.13 ± 0.4	2.85 ± 0.36
		GC	3.55 ± 0.44	4.51 ± 0.36	2.46 ± 0.3	5.78 ± 0.06	5.2 ± 0.23	2.26 ± 0.17	3.02 ± 0.44	3.37 ± 0.59	2.82 ± 0.42
	Female	CC	3.12 ± 0.34	4.69 ± 0.6	2.4 ± 0.42	5.66 ± 0.6	5.1 ± 0.72	2.07 ± 0.4	2.73 ± 0.32	2.95 ± 0.31	2.6 ± 0.33
		GC	3.18 ± 0.15	5.03 ± 0.39	2.77 ± 0.28	5.63 ± 0.49	4.97 ± 0.45	2.3 ± 0.33	3.08 ± 0.12	3.11 ± 0.17	2.89 ± 0.02

Unit in millimeters.

3.3.4. Analysis of Genetic Variation in the TAF11 Gene

Within the TAF11 gene, the C allele at g.35543837 was dominant, with a frequency of 0.96, while the G allele had a frequency of 0.04. The corresponding genotype frequencies were 0.92 for CC and 0.08 for CG. The population was in Hardy–Weinberg equilibrium (p = 0.663, p > 0.05). The polymorphic information content (PIC) was 0.074, the effective number of alleles was 1.08, observed heterozygosity was 0.077, and homozygosity was 0.923 (Table 9).

Table 9.

Polymorphism Distribution of the TAF11 Gene.

Site	N	Genotype Frequency			Allele Frequency		χ2	PIC	He	Ho	Ne
g.35543837	50	CC	GC	GG	C	G	0.821
		0.92	0.08	0	0.96	0.04		0.074	0.077	0.923	1.08
		(46)	(4)	(0)

χ² is Hardy–Weinberg equilibrium test value for genotype distribution at this site. p = 0.663 > 0.05.

4. Discussion

4.1. Results and Analysis of Skin Thickness in Nine Body Regions of Shenxian Pigs

The skin is a complex organ whose development is influenced by multiple factors. In mammals, skin thickness varies both among individuals and across anatomical regions. Human skin, for example, typically ranges from 0.5 to 4.0 mm [20], while equine skin measures 1.5 to 4.6 mm [21]. Indigenous Chinese pig breeds generally possess thicker skin than introduced exotic breeds. For instance, local breeds such as Bama Xiang, Wujin, and Diannan small-ear pigs exhibit skin thicknesses of approximately 4–6 mm, whereas exotic breeds like Landrace and Large White average about 2–3 mm [22]. Studies further show that skin thickness varies across body sites within local breeds. Chen [23] reported that in Yunnan local pigs, the rump had the thickest skin and the abdomen the thinnest. Similarly, Wang [24] found that in Yantai Black pigs, the rump displayed the greatest thickness (4.5 mm), while the abdomen and loin were thinner, with loin thickness below 0.8 mm. In the present study, Shenxian pigs showed a skin thickness range of 1.26–7.20 mm across nine sites, ordered from thinnest to thickest as follows: belly, armpit, chest, trotter, rump, face, shoulder, loin, and back. This pattern is largely consistent with findings in Bama Xiang pigs by Huang [25], who reported a range of 1.02–7.06 mm, with the thickest skin at the loin and the thinnest at the belly. In both breeds, the three thickest sites include the loin, shoulder, and back. In Shenxian pigs, skin thickness varied relatively little across the contiguous dorsal to gluteal regions (shoulder, back, loin, rump), indicating consistently thick skin over the dorsum. In contrast, the belly, chest, face, and trotter were comparatively thinner, with the armpit being the thinnest. This dorsal ventral gradient in skin thickness may relate to the distinctive physiology of Shenxian pigs, which are characterized by short stout limbs and a pendulous abdomen [26,27]. Back and loin skin likely provides enhanced structural integrity and mechanical protection, supporting load-bearing and resisting environmental abrasion [28]. Conversely, thinner belly and articular skin affords greater pliability and freedom of movement, facilitating respiration and locomotion [29]. The observed pattern in Shenxian pigs may thus reflect an evolutionary balance between protection, mobility, and thermoregulation. The TAF11 gene, as a key transcriptional regulator examined in this study, could potentially contribute to such region-specific skin development, a hypothesis that warrants further investigation.

Skin thickness exhibits sexual dimorphism, with males generally possessing thicker skin than females [30]. In a study of 124 volunteers aged 7–40 years, Li et al. [31] used high-frequency ultrasound to measure skin thickness at the deltoid region. They found that, except in females under 10 years of age (1.6 mm), skin thickness remained around 2.3 mm in females and approximately 2.6 mm in males, with thickness increasing with age in the latter. The skin and its appendages are strongly influenced by sex hormones, particularly androgens, which regulate skin thickness in a sex-specific manner [32]. This dimorphism is also evident in livestock. For example, Wang et al. [33] reported that in Yanbian cattle, bulls had an average total skin thickness of 4089 μm (dermis: 4036 μm), whereas cows averaged 2222 μm (dermis: 2176 μm). The epidermis constituted 1.17% of total thickness in bulls compared with 1.68% in cows. Sexual dimorphism in skin thickness is also present in pigs. In the present study, Shenxian barrows had significantly thicker skin than gilts at the armpit and belly (p < 0.05), and highly significantly thicker skin at the face, trotter, rump, and chest (p < 0.01). This pattern may be attributed to the absence of androgen influence following castration, coupled with site-specific differences in skin sensitivity to androgens. In intact boars, higher testosterone levels can stimulate fibroblast activity and promote dermal thickening. Castration alters hormone profiles, potentially leading to adaptive changes in skin structure [34,35,36]. Cai et al. [37] further suggested that testosterone differentially regulates the development of skin, muscle, and adipose tissues, with skin thickness being positively regulated by testosterone, although regional receptor characteristics may explain why certain sites (the back) show less response. In this study, no significant difference (p > 0.05) in skin thickness was observed between barrows and gilts at the shoulder, back, or loin. This may be because skin in these regions is intrinsically thick, serves primary supportive and protective roles, and is less influenced by hormonal fluctuations, resulting in a more stable structure that is less responsive to castration or sex differences.

4.2. Variation in Collagen Content in Skin from Nine Different Sites of Shenxian Pigs

Collagen, or tropocollagen, is a major class of biological macromolecules classified into interstitial, basement membrane, and pericellular types, with types I, II, and III being the most prominent [38,39,40]. Owing to its favorable biological properties, collagen is widely used in clinical medicine, food science, packaging, cosmetics, and medical esthetics. In animal skin, collagen serves as the primary structural protein, accounting for approximately 25–35% of the skins dry weight [41,42]. In this study, collagen content across nine skin sites of Shenxian pigs varied considerably, ranking from highest to lowest as follows: trotter, face, shoulder, back, loin, rump, belly, chest, and armpit. Specifically, collagen content per 100 g of skin was 23.32 ± 0.71 g in the trotter and 8.34 ± 0.63 g in the armpit, with an overall range of 7.01–24.54 g/100 g across all sites. This marked regional variation reflects the skin’s adaptation to the distinct mechanical and physiological demands of different anatomical regions. Among the 28 known collagen types, fibrillar collagens are the major components of the extracellular matrix in connective tissues, providing structural stability and constituting 70–80% of the dry weight of dense connective tissue [43,44,45]. The trotter region exhibits a thick dermis rich in dense connective tissue, with densely packed collagen fibers forming a robust structural framework. This arrangement confers high tensile strength, rigidity, and abrasion resistance, enabling the skin to withstand substantial mechanical stress during locomotion and fulfill load-bearing functions [46]. Furthermore, the dermis in the trotter region contains a high density of metabolically active fibroblasts that continuously synthesize and deposit type I and III collagen, maintaining a stable collagen network and contributing to the region’s high collagen content [47,48]. In contrast, highly mobile areas such as the armpit have a thinner dermis with less connective tissue, naturally limiting collagen accumulation [49,50]. The resulting lower collagen density and thinner structure provide greater pliability and extensibility, allowing the skin to deform without damage during limb movement and respiration, while also facilitating thermoregulation [51].

4.3. Genetic Polymorphisms Associated with Skin Thickness in Shenxian Pigs

Sanger sequencing identified the g.35543837 C > G mutation in the TAF11 gene. This missense mutation results in the amino acid substitution from arginine to glycine. Arginine, a positively charged basic amino acid, participates in salt bridge/hydrogen bond formation [52], whereas glycine has a small flexible side chain that may alter local protein conformation [53]. As a subunit of the TFIID complex, TAF11 facilitates transcription initiation via TBP-mediated TATA-box recognition. The mutation may disrupt TBPs DNA bending capacity and subsequent RNA polymerase II assembly [54]. Although the G allele at this locus was a low-frequency variant, it was associated with increased skin thickness at multiple sites, particularly in gilt. Therefore, this locus represents a potential molecular marker for skin thickness in Shenxian pigs. Zou et al. [55] screened key candidate genes regulating Chenghua pigs unique skin thickness traits COL11A1, TNN, and INHBA by analyzing single-cell transcriptomic expression data from Chenghua pig skin tissue, confirming these genes significant influence on skin thickness. In this study, association analysis revealed that individuals with the CC genotype had lower skin thickness at the face and rump than those with the CG genotype. Moreover, the effect of the TAF11 genotype was more extensive in gilt, suggesting sex-specific regulation. TAF11 may interact with estrogen or other sex hormone pathways, differentially regulating downstream target genes involved in skin development and collagen deposition. Future research should compare TAF11 expression, downstream networks, and hormone receptor co-expression across sexes to elucidate this mechanism.

Sanger sequencing identified a C > G mutation at position g.35543837 in the TAF11 gene. This missense mutation leads to an arginine-to-glycine substitution. Arginine, a positively charged basic amino acid, is involved in salt-bridge and hydrogen-bond formation [52], whereas glycine has a small flexible side chain that can alter local protein conformation [53]. As a subunit of the TFIID complex, TAF11 facilitates transcription initiation through TBP-mediated TATA-box recognition. The mutation may therefore impair TBP-induced DNA bending and subsequent RNA polymerase II assembly [54]. Although the G allele at this locus occurred at low frequency, it was associated with increased skin thickness at multiple anatomical sites, especially in gilts. These results suggest that this locus could serve as a potential molecular marker for skin thickness in Shenxian pigs. Zou et al. [55] identified COL11A1, TNN, and INHBA as key candidate genes regulating skin thickness in Chenghua pigs through single-cell transcriptomic analysis, confirming their significant influence on this trait. In the present study, association analysis revealed that individuals with the CC genotype had lower skin thickness at the face and rump than those with the CG genotype. Notably, the effect of the TAF11 genotype was more pronounced in gilts, pointing to possible sex-specific regulation. TAF11 may interact with estrogen or other sex-hormone pathways, differentially regulating downstream target genes involved in skin development and collagen deposition. Further studies comparing TAF11 expression, downstream networks, and hormone-receptor co-expression between sexes are needed to elucidate this mechanism.

5. Conclusions

This study provides the first comprehensive assessment of skin traits in Shenxian pigs. Measurements across nine anatomical sites revealed significant regional variation in both skin thickness (1.26–7.20 mm) and collagen content (8.34–23.35 g/100 g). Sex-based differences in skin thickness were also evident at specific sites. A C > G mutation was identified at locus g.35543837 within the TAF11 gene on chromosome 7. Although this mutation occurs at low frequency, the CG genotype is derived from the wild-type CC. Association analysis demonstrated that the C to G substitution is significantly linked to increased skin thickness, with a more pronounced and widespread effect in gilts. These findings suggest that TAF11 is a key candidate gene regulating skin thickness and that its effect may be modulated in a sex-specific manner. Based on the findings of this study, future research should focus on validating the function and regulatory pathways of the TAF11 gene, verifying the potential of this locus across more pig breeds, and elucidating the underlying mechanisms of sex-specific effects. Ultimately, this work should aim to develop molecular breeding strategies and evaluate their industrial application value.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ani16040593/s1: Figure S1: Information on the SNP locus with the highest p-value in TAF11 association analysis; Figure S2: Association assay between skin thickness at 9 body sites and 46 candidate SNPs on SSC7 in Bamaxiang pig. Table S1: Raw sequencing data. Table S2: Raw sequencing data.

Author Contributions

Conceptualization, C.L. and H.C.; methodology, Y.L., S.L., M.S. and W.W.; software, Y.L., S.L., M.S. and W.W.; validation, Y.L., S.L., M.S. and W.W.; formal analysis, Y.L. and S.L.; investigation, Y.L., S.L., M.S. and W.W.; resources, C.L. and H.C.; data curation, Y.L., S.L., M.S. and W.W.; writing—original draft preparation, Y.L. and S.L.; writing—review and editing, M.S., W.W., C.L. and H.C.; visualization, Y.L. and S.L.; supervision, C.L. and H.C.; project administration, C.L. and H.C.; funding acquisition, C.L. and H.C. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

All animal procedures were approved by the Animal Care Committee at Agricultural University of Hebei in accordance with the university’s guidelines for animal research (Approval number: 2025177) (Approval Date: 15 December 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data analyzed during the current study are available from the corresponding authors upon reasonable request.

Conflicts of Interest

The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding Statement

This study was financially supported by the Special Fund for the Construction of Modern Agricultural Industrial Technology System in Hebei Province (HBCT2024220204).