Skip to main content
NCBI home page
Animals : an Open Access Journal from MDPI logoLink to Animals : an Open Access Journal from MDPI
. 2026 Feb 18;16(4):652. doi: 10.3390/ani16040652

Glutamine Promotes Collagen Deposition via TGF-β/Smads Pathway in Swim Bladder of Chu’s Croaker (Nibea coibor)

Yongjun Liang 1,2, Haoyu Tian 1, Lanfei Xiao 1,2,*
Editor: Marina Paolucci
PMCID: PMC12937217  PMID: 41751112

Simple Summary

Our previous studies have confirmed that glutamine can promote collagen deposition in fish swim bladders of Chu’s croaker (Nibea coibor), and the purpose of this study is to further elucidate the potential mechanism of this effect. Transcriptomic results showed that the TGF-β/Smads pathway was significantly upregulated when glutamine was fed. In vitro experiments showed that glutamine promotes swim bladder cell proliferation and increases the extracellular type I collagen content, and this effect required the participation of the TGF-β/Smads pathway. Our research enriches the theory of amino acid nutrition and provides a theoretical basis for improving the quality of functional aquatic products.

Keywords: amino acids, swim bladder, transcriptomic analysis, TGF-β/Smads pathway

Abstract

Glutamine (Gln), one of the most abundant free conditionally essential amino acids in animals, plays a pivotal role in protein and energy metabolism. Beyond its nutritional importance, Gln also modulates key cellular processes through diverse signaling pathways. Our previous studies have shown that appropriate Gln (0.4%) can promote collagen deposition in the swim bladder of Nibea coibor; however, the mechanism has not been investigated. Therefore, this study used transcriptomic analysis on the control group (0.0% Gln) and the 0.4% Gln group to screen for possible pathways and validate the function of candidate pathways in vitro. The results showed that the TGF-β/Smads pathway was significantly upregulated in the 0.4% Gln group compared with 0.0% Gln. At the same time, Gln could also promote the swim bladder cells’ proliferation and increase the extracellular type I collagen content and gene expression (col1a1, col1a2) in vitro, accompanied by the activation of the TGF-β/Smads pathway (tgf-β, smad2, smad3, smad4 upregulated). Inhibition of the TGF-β/Smads pathway (tgf-β, smad2, smad3, smad4 downregulated) partially reversed the effect of Gln on collagen deposition (col1a1, col1a2 downregulated), thus proving that the TGF-β/Smads pathway is involved in the process of Gln on collagen deposition. In conclusion, the discovery not only expands our understanding of amino acid functions but establishes a foundational theory for further research on collagen regulation in fish.

1. Introduction

Collagen, the most abundant structural protein in animals, is a core component of the extracellular matrix (ECM) [1], and its unique triple helix structure endows tissues with good toughness and elasticity [2]. Currently, approximately 29 different collagen types with different biological functions have been identified [3], but fish do not possess type III collagen, which is more important for higher mammals [4]. Swim bladders, as buoyancy-regulating organs unique to bony fish, have broad application prospects in functional foods and biomaterials due to their rich type I collagen content, which has extremely high nutritional and medicinal value [5]. In recent years, improving the quality of swim bladders by enhancing collagen deposition through nutritional regulation has become a research hotspot in the aquaculture field. Numerous studies have confirmed that amino acids are not only substrates for protein synthesis, but also act as signaling molecules to regulate cell signaling pathways, thereby affecting the synthesis and deposition of collagen [6,7]. Glutamine (Gln), as a conditionally essential amino acid, participates in various physiological process such as nitrogen metabolism, energy supply and immune regulation [8], and has been shown to regulate collagen synthesis in terrestrial animals [9], but its role and mechanism in swim bladder collagen metabolism remain unclear. Fish obtain Gln mainly through two pathways, endogenous synthesis [10] and exogenous intake [11], which work together to maintain the dynamic balance of Gln in fish and meet their physiology metabolic needs. Building upon our previous findings that Gln can increase collagen content in the swim bladder [12], we further elucidate the possible mechanism of this effect.

Studies of Gln in animal fibrosis models have shown that it can be metabolized by glutaminase into glutamate and α-ketoglutarate, providing essential amino acid precursors (such as glycine and proline) for collagen synthesis. For example, in lung fibroblasts, Gln and its metabolic enzyme glutaminase (GLS1) are essential for TGF-β-induced collagen synthesis, and silencing GLS1 can significantly inhibit TGF-β-mediated col1a1 gene expression [9]; in cardiomyocytes, Gln can promote the synthesis of type I and type III collagen by upregulating GLS1 expression, and this process depends on the activation of the TGF-β/Smads pathway [13]. The transforming growth factor-β (TGF-β)/Smads signaling pathway plays a crucial role in vertebrate tissue fibrosis, matrix remodeling, and development [9,14]. In fish, studies have confirmed that this pathway can mediate the regulatory effects of amino acids such as proline and leucine on collagen deposition in the swim bladder or muscle [15,16], indicating that the regulation of collagen deposition by amino acids in fish may be conserved through a TGF-β/Smads pathway mechanism. In Nile tilapia [17], Gln has been shown to improve growth performance, regulate gut microbiota balance, and enhance immune function, but research on its regulation of collagen metabolism in fish remains limited.

For Nibea coibor, collagen deposition is regulated by the synthesis and degradation rate, and this process relies on the proliferation and activation of swim bladder fibroblast-like cells, the transcription of genes to facilitate collagen synthesis, and post-translational modifications such as translation, hydroxylation and cross-linking of collagen peptide chains, ultimately completing the assembly and extracellular deposition of collagen fibrines [18]. Based on this, this study explores the response of the swim bladder to Gln through transcriptomics, revealing the role of the TGF-β/Smads pathway in Gln-promoted collagen deposition in the swim bladder. This study will clarify the regulatory effect of Gln on collagen deposition in the swim bladder, providing a theoretical basis for improving the yield and quality of swim bladder collagen through nutritional regulation, and enriching the study of pathway networks of amino acids in the regulation of tissue-specific protein synthesis in fish.

2. Materials and Methods

2.1. Samples

In our previous research, dietary supplementation with 0.4% Gln significantly promoted collagen deposition in swim bladders of Nibea coibor [12]; thus, set 0.4% Gln as the experimental group and 0.0% Gln as the control group for subsequent transcriptomic analysis to explore the underlying mechanism by which Gln promotes collagen deposition in swim bladders.

2.2. Transcriptomic Analysis

Eight swim bladders were pooled to form one sample, and three pooled samples were prepared per group. Total RNA extraction using RNAiso Plus (TaKaRa, Kyoto, Japan) and reverse transcription procedures using PrimeScriptTM RT reagent Kit (Perfect Real Time) (TaKaRa, Japan) were performed according to the manufacturer’s instructions. The double strands were trimmed, followed by A-tailing and ligation to sequencing adapters. AMPure XP beads were used for cDNA screening, facilitating PCR amplification and purification to construct a cDNA library. Transcriptome sequencing was performed using the Illumina NovaSeq 6000 platform at Novogene (Beijing, China). The raw sequencing reads in FASTQ format underwent initial processing with fast to remove low-quality reads, resulting in clean read datasets. Gene expression was quantified by calculating Fragments Per Kilobase of Exon Model per Million (FPKM), and read counts were obtained through HTSeq-count. Principal Component Analysis (PCA) was conducted using R to evaluate sample biological replication.

2.3. Swim Bladder Cell Culture and Treatment

Swim bladder cells were cultured following the methods detailed in a previous study by our research group [7]. Cells were cultured at 28 °C using Dulbecco’s Modified Eagle’s Medium/Ham’s Nutrient Mixture F12 (DMEM/F12) (Procell, Wuhan, China) supplemented with 20% fetal bovine serum (FBS) (SORFA, Beijing, China), 100 IU/mL penicillin, and 100 μg/mL streptomycin (Gibco, Grand Island, NY, USA).

Cells were incubated with different concentrations of Gln (0 mM, 2 mM, 4 mM, 8 mM, 16 mM, 32 mM, named Control, Gln 2, Gln 4, Gln 8, Gln 16, Gln 32, respectively) for 24 h. After treatment, cell viability was assessed by CCK8 (Glpbio, Los Angeles, CA, USA) and Edu staining (Beyotime, Shanghai, China). To specifically investigate the role of the TGF-β/Smads pathway, cells were treated with 10 μM TGF-β/Smads pathway inhibitor SB431542 [19] (MCE, Middlesex, NJ, USA) for 24 h.

2.4. Determination of Type I Collagen Content

Swim bladder cell type I collagen content after treatment was analyzed using an ELISA kit acquired from Enzyme-linked Biotechnology Co., Ltd. (Shanghai, China), following the guidelines. All experimental procedures were carried out strictly in accordance with the manufacturer’s detailed guidelines to ensure the reliability and reproducibility of results.

2.5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

Eight swim bladders were pooled to form one sample, and three pooled samples were prepared per group. Total RNA was isolated using TRIzol reagent following the manufacturer’s instructions. The reverse transcription reaction of mRNA was conducted using HiScript III RT SuperMix, and the synthetized cDNA was diluted and then amplified using ChamQ SYBR qPCR Master Mix. Each sample was prepared in triplicate. The above reagents were provided by Vazyme (Nanjing, China). The qPCR reaction was carried out in a total volume of 20 μL, containing 10 μL 2 × ChamQ SYBR qPCR Master Mix, 0.4 μL forward primer, 0.4 μL reverse primer, 2 μL cDNA template and 7.2 μL RNase-free water. The qPCR reactions were performed with the following program: 95 °C 30 s; 95 °C 5 s and 60 °C 15 s (40 cycles). The expression level of genes was normalized to 18s rRNA using the 2−ΔΔCt method, and the reference gene was stable under the experimental conditions. All primers were obtained from Sangon, Inc. (Shanghai, China), and the sequences are shown in Table 1.

Table 1.

Primer sequences.

Gene Primer Sequences (5′-3′) Amplicon Size (bp) Ref.
18s F: AGCTCGTAGTTGGACTTCG 155 [12]
R: CGGCCTGCTTTGAACACTCT
col1a1 F: AGACCTGCGTGACTCCCA 138 [12]
R: AGCCCTCGCTGCCATACT
col1a2 F: CAAGAACAGCGTTGCCTAC 120 [12]
R: ACGGAGAAGGTGAAGCGG
tgf-β F: AGAAACGAGCAGAGGATTG 217 [15]
R: CTGAAAGTGTGGCAGGGAC
smad2 F: GCCTCAGTGACAGTGCCATTTT 162 [15]
R: CAAACCCCTGATTGACCGACTG
smad3 F: TCCCACAGGAAAGGTCTGCC 172 [15]
R: GCACTGGCGTCTCTACTCTCTG
smad4 F: GCTATTAGTCTGTCAGCAGCAG 200 [15]
R: TCCGCTATAGGCATCGTGTG
Open in a new tab

Note: F = Forward; R = Reverse. 18s: 18S ribosomal RNA; col1a1: collagen type I alpha 1 chain; col1a2: collagen type I alpha 2 chain; tgf-β: transforming growth factor-β; smad2: Smad family member 2; smad3: Smad family member 3; smad4: Smad family member 4.

2.6. Statistical Analysis

All data were tested for normality using the Kolmogorov–Smirnov test and homogeneity of variances using Levene’s test. The t-test for two groups or one-way analysis of variance (ANOVA) for multiple groups was used to test for statistical differences. All statistical analyses were performed using the SPSS 17.0 software. Data were presented as means ± standard deviation (SD) and p < 0.05 was considered statistically significant. All graphics were prepared using the GraphPad Prism 8.0 software. For transcriptomic analysis, differential expression analysis was carried out with DESeq2, applying a significance threshold of p < 0.05 and a log2FoldChange > 1 to identify significantly differentially expressed genes (DEGs). Hierarchical clustering analysis of DEGs, illustrating expression patterns across various groups and samples, was conducted using R-4.5.2. A radar plot was generated using the ggplot2 package in R to visualize the expression of upregulated or downregulated DEGs. Gene Ontology and KEGG pathway analyses were performed on the DEGs using the cluster Profiler package in R to elucidate their functional roles.

3. Results

3.1. Analysis of Differentially Expressed Genes and KEGG Analysis

Differentially expressed genes (DEGs) analysis identified a total of 9230 DEGs between the 0.4% Gln and 0.0% Gln groups, among which there were 2882 significantly upregulated and 6348 downregulated DEGs (p < 0.05, log2FoldChange > 1), respectively (Figure 1A). Subsequent KEGG pathway enrichment analysis was conducted on these DEGs to explore their potential biological functions. The top 20 most significantly enriched KEGG pathways were selected and visualized using a bubble plot (Figure 1B). Key enriched pathways included the “TGF-beta signaling pathway”, “FoxO signaling pathway”, “Histidine metabolism”, and “Fatty acid metabolism”, implying their involvement in Gln-mediated biological processes.

Figure 1.

Figure 1

Open in a new tab

Differential gene volcano map (A). The horizontal axis in the figure is log2FoldChange value, the vertical axis is −log10padj, and the blue dotted line represents the threshold line of the differential gene screening standard; red and green dots represent upregulated and downregulated genes, respectively (p < 0.05, log2FoldChange > 1). The scatter plot of KEGG enrichment analysis, where the horizontal axis represents the ratio of the number of differentially expressed genes annotated to each KEGG pathway to the total number of differentially expressed genes, and the vertical axis represents the KEGG pathways (B).

3.2. Gln Promotes Swim Bladder Cells Proliferation and Increase Collagen Content

In vitro experiments were used to further verify the regulatory effect of Gln on swim bladder cells. Edu staining and CCK8 were employed to evaluate cell proliferation, and the results showed that the number of Edu-positive cells in Gln-treated experimental groups was significantly higher than that in the control group. This indicated that Gln could effectively promote the swim bladder cell proliferation, and consistent results were obtained from the CCK-8 assay (Figure 2A,B). Furthermore, extracellular type I collagen content was quantified, and a concentration-dependent increase was observed in Gln-treated groups, with this upward trend maintained when the Gln concentration did not exceed 16 mM (Figure 2C).

Figure 2.

Figure 2

Open in a new tab

Effects of different concentrations glutamine (Gln) on swim bladder cells. The viability of swim bladder cells after Gln incubation was determined by Edu staining (Dapi indicates staining of the nucleus, and Merge indicates the localization of Edu-positive cells and the nucleus) and the CCK8 method (n = 5), respectively (A,B); The content of extracellular type I collagen after incubation with glutamine (n = 3) (C). Control, Gln 2, Gln 4, Gln 8, Gln 16, Gln 32 indicate Gln concentrations at 0 mM, 2 mM, 4 mM, 8 mM, 16 mM, 32 mM, respectively. Data are expressed as mean ± SD; different letters show a significant difference (p < 0.05).

3.3. Gene Expression After Gln Treatment

It was confirmed that Gln could effectively promote swim bladder cell proliferation and increase the extracellular type I collagen content. On this basis, the gene expression levels of type I collagen (col1a1, col1a2) and key components of the TGF-β/Smads pathway (tgf-β, smad2, smad3, smad4) were further detected to explore the underlying molecular mechanism (Figure 3). The results demonstrated that Gln not only upregulated the expression of col1a1 and col1a2 genes (Figure 3A) but also activated the TGF-β/Smads pathway by enhancing the transcription of its core genes (Figure 3B). Considering the comprehensive effects on cell proliferation, gene expression, and extracellular type I collagen accumulation, 16 mM Gln was selected as the optimal concentration for subsequent experiments to systematically investigate its regulatory roles.

Figure 3.

Figure 3

Open in a new tab

Effects of glutamine (Gln) on gene expression related to type I collagen synthesis (col1a1 and col1a2) (n = 3) (A) and TGF-β/Smads pathway (tgf-β, smad2, smad3, smad4) (n = 3) (B). Data are expressed as mean ± SD; different letters show a significant difference (p < 0.05). The genes in the figure include: col1a1: collagen type I alpha 1 chain; col1a2: collagen type I alpha 2 chain; tgf-β: transforming growth factor-β; smad2: Smad family member 2; smad3: Smad family member 3; smad4: Smad family member 4.

3.4. TGF-β/Smads Pathway Is Involved in the Role of Gln Promoting Type I Collagen Synthesis

Gln treatment effectively increased extracellular type I collagen content (Figure 4A) and gene expression (Figure 4B), and activated the TGF-β/Smads pathway (Figure 4C). To confirm whether this pathway is involved in mediating Gln’s regulator role, swim bladder cells were divided into groups and treated with the specific TGF-β/Smads pathway inhibitor SB431542, either alone or in combination with Gln. Results showed that SB431542 treatment alone significantly reduced extracellular type I collagen levels (Figure 4A,B) and successfully suppressed the activation of the TGF-β/Smads pathway (Figure 4C). The combined treatment of Gln weakened the effect of SB431542. These findings clearly indicate that the TGF-β/Smads pathway is involved in mediating Gln-induced collagen accumulation in swim bladder cells.

Figure 4.

Figure 4

Open in a new tab

Type I collagen content and gene expression (A,B), and TGF-β/Smads pathway gene expression (C) in SB431542 treatment with/without Gln (n = 3). Data are expressed as mean ± SD; different letters show a significant difference (p < 0.05).

4. Discussion

Collagen is a fibrous structural protein ubiquitously distributed in animal tissues, serving as the predominant component of connective tissue and playing an irreplaceable role in maintain tissue integrity, mechanical strength, and structural stability [19]. To date, twenty-seven distinct collagen types have been successfully identified in fish, among which type I and type V are the most abundant isoforms, particularly in tissues such as the skin, muscle, and swim bladder [20]. Accumulating evidence indicates that the quantity, distribution, and cross-linking degree of connective tissue are the primary determinants of tissue stiffness, and these properties are directly correlated with collagen content and structural integrity [21]. Collagen is mainly synthesized and secreted by fibroblasts, and its homeostasis within tissues is strictly governed by the dynamic balance between de novo synthesis and degradation. The process of collagen synthesis encompasses two sequential phases: the canonical transcription–translation cascade, which generates procollagen polypeptides, and the post-translational modification stage, involving hydroxylation, glycosylation, and cross-linking—events that are essential for the formation of functionally active collagen fibers [18]. In contrast, collagen degradation is predominantly regulated by the activity of matrix metalloproteinases (MMPs), a family of zinc-dependent endopeptidases that specifically cleave collagen molecules [22].

The swim bladder, a specialized organ unique to most teleost fish, is rich in collagen, and its collagen content and quality directly dictate its commercial value and processing properties. Notably, swim bladder collagen metabolism is highly sensitive to external factors, including environmental conditions (e.g., water temperature and dissolved oxygen), dietary nutrition, and exercise intensity [7,23,24]. Among these, adequate nutritional supply, especially of essential amino acids and fatty acids, provides an indispensable structural basis for the growth and collagen biosynthesis of swim bladders. In Nibea coibor, a commercially valuable marine fish species, dietary nutrition exerts a direct regulatory effect on key metabolic pathways, thereby modulating swim bladder collagen metabolism. Our previous research has demonstrated that dietary Gln, a conditionally essential amino acid, can significantly promote collagen deposition in the swim bladder of N. coibor [12]. To further elucidate the underlying molecular mechanism by which Gln enhances collagen deposition, transcriptomic analysis was performed to identify differentially expressed genes (DEGs) and enriched signaling pathways in the swim bladder of fish fed Gln-supplemented diets. The results revealed that the TGF-β/Smads pathway was significantly enriched in the group fed with 0.4% Gln. Intriguingly, this pathway was also enriched in our prior study investigating the regulatory role of proline in N. coibor swim bladder collagen metabolism [15], suggesting that the TGF-β/Smads pathway may serve as a conserved molecular hub mediating the response of swim bladder collagen metabolism to amino acid supplementation.

The TGF-β/Smads pathway is a widely recognized as a core regulatory switch governing collagen metabolism across diverse organisms and tissues, and it is regarded as one of the most potent inducers of collagen synthesis [25], holding great promise for the development of the high-quality aquatic collagen industry. The TGF-β/Smads pathway modulates collagen deposition through multiple synergistic mechanisms. On the one hand, activated TGF-β ligands bind to their transmembrane receptors, triggering the phosphorylation of receptor-regulated Smads (R-Smads), primarily smad2 and smad3. These phosphorylated R-Smads then form heteromeric complexes with the common-mediator Smad (Co-Smad, smad4) and translocate into the nucleus, where they directly bind to Smad-binding elements (SBEs) in the promoters of collagen-encoding genes, such as col1a1 and col1a2, thereby initiating their transcription and promoting collagen synthesis [26]. On the other hand, the pathway can upregulate the expression of tissue inhibitors of metalloproteinases (TIMPs), which specifically antagonize MMP activity, thereby reducing collagen degradation and maintaining collagen accumulation [27]. Consistent with this regulatory model, a study on Ctenopharyngodon idellus (grass carp) showed that the TGF-β/Smads pathway can respond to metal ion stimulation, upregulate TIMP2 expression, inhibit MMP2 activity, reduce collagen degradation, and ultimately increase muscle collagen content [19]. Additionally, the TGF-β1 gene has been shown to be involved in the transcription of col1a2 in mechanically unloaded atrophied soleus muscle, highlighting its conserved role in collagen regulation [28]. As a key TGF-β-responsive element in the col1a2 promoter, Smad proteins are considered among the most potent mediators of col1a2 promoter activation in fibroblasts [29]. Beyond amino acids and metal ions, other bioactive substances and dietary components—such as daidzein in cultured skin fibroblasts and nude mouse skin [30], and faba bean in crisp grass carp muscles [31]—have also been shown to stimulate collagen synthesis by activating the TGF-β/Smads signaling pathway. Collectively, these findings strongly support the hypothesis that Gln modulates swim bladder collagen synthesis and deposition by regulating the TGF-β/Smads pathway in N. coibor. To verify this hypothesis, in vitro experiments were conducted using SB431542, a specific inhibitor of the TGF-β/Smads pathway, to explore the regulatory effect of Gln on collagen metabolism. The expression levels of genes involved in type I collagen synthesis and key components of the TGF-β/Smads pathway were analyzed. The results showed that SB431542 effectively inhibited the TGF-β/Smads pathway and downregulated the expression of type I collagen-related genes (col1a1 and col1a2). Importantly, Gln treatment could reverse these inhibitory effects, restoring the expression of pathway-related genes and collagen-encoding genes to normal levels. During this process, the transcriptional change in Smad3 was particularly prominent, suggesting that Smad3 may play a central role in Gln-mediated collagen regulation. This is consistent with a study on grass carp, where Smad3 was also shown to be involved in the regulation of muscle collagen deposition [19]. Despite these findings, the specific mechanism by which Gln activates the TGF-β/Smads pathway remains to be elucidated, representing a key focus of our future research. Currently, we hypothesize that Gln may promote swim bladder collagen deposition by enhancing TGF-β signaling transduction to cytoplasmic Smad3, thereby activating the transcription of collagen-encoding genes and facilitating collagen synthesis and deposition in the swim bladder. From an industrial perspective, the regulatory role of the TGF-β/Smads pathway has been widely exploited: by selecting or adding functional feed additives (such as Pro, Gln) to activate this pathway, collagen deposition in aquatic animals can be targeted and accelerated, converting basic biological discoveries into practical productivity that enhances the economic value of aquatic products.

5. Conclusions

Building on our previous finding that glutamine (Gln) enhances collagen deposition in the swim bladder of Nibea coibor, this study investigated the underlying mechanism using transcriptomic analysis. The results revealed that the TGF-β/Smads pathway, a conserved core regulator of collagen metabolism, is likely implicated in mediating Gln’s pro-collagen deposition effect. To validate this, we inhibited the TGF-β/Smads pathway in vitro with SB431542. Notably, Gln supplementation reversed the expression of collagen genes (col1a1, col1a2) and increased corresponding collagen content. Collectively, our findings elucidate the molecular mechanism by which Gln promotes swim bladder collagen deposition, laying a solid theoretical foundation for advancing the isinglass industry.

Acknowledgments

The authors sincerely thank the people who provided guidance and suggestions for this research.

Author Contributions

Investigation, Y.L.; formal analysis, Y.L.; writing—original draft, Y.L.; methodology, H.T.; resources, H.T.; supervision, L.X.; project administration, L.X.; funding acquisition, L.X. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

The study was approved by the International Cooperation Committee for Animal Welfare of South China Agricultural University (protocol code 2022B027 and date of approval 27 May 2022).

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are contained within the article.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research was supported by the China Postdoctoral Science Foundation (Grant no. 2025M773132).

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Guillard J., Schwörer S. Metabolic control of collagen synthesis. Matrix Biol. 2024;133:43–56. doi: 10.1016/j.matbio.2024.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kusebauch U., Cadamuro S.A., Musiol H.J., Lenz M.O., Wachtveitl J., Moroder L., Renner C. Photocontrolled folding and unfolding of a collagen triple helix. Angew. Chem. Int. Ed. 2006;45:7015–7018. doi: 10.1002/anie.200601432. [DOI] [PubMed] [Google Scholar]
  • 3.Ricard-Blum S. The collagen family. Cold Spring Harb. Perspect. Biol. 2011;3:a004978. doi: 10.1101/cshperspect.a004978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Duran I., Csukasi F., Taylor S.P., Krakow D., Becerra J., Bombarely A., Marí-Beffa M. Collagen duplicate genes of bone and cartilage participate during regeneration of zebrafish fin skeleton. Gene Expr. Patterns. 2015;19:60–69. doi: 10.1016/j.gep.2015.07.004. [DOI] [PubMed] [Google Scholar]
  • 5.Sripriya R., Kumar R. A novel enzymatic method for preparation and characterization of collagen film from swim bladder of fish rohu (Labeo rohita) Food Nutr. Sci. 2015;6:1468–1478. doi: 10.4236/fns.2015.615151. [DOI] [Google Scholar]
  • 6.Durán R.V., Oppliger W., Robitaille A.M., Heiserich L., Skendaj R., Gottlieb E., Hall M.N. Glutaminolysis activates rag-mTORC1 signaling. Mol. Cell. 2012;47:349–358. doi: 10.1016/j.molcel.2012.05.043. [DOI] [PubMed] [Google Scholar]
  • 7.Liu C.S., Xiao L.F., Cai J.R., Jiang W.Y., Ye X.K., Wang S.Q., Wen X.B., Lin F. Inhibition of autophagy is involved in the collagen deposition promoted by dietary leucin in chu’s croaker (Nibea coibor) J. Agric. Food Chem. 2025;73:24795–24804. doi: 10.1021/acs.jafc.5c08836. [DOI] [PubMed] [Google Scholar]
  • 8.Taşkıran A.E.G., Karaoğlu D.A., Eylem C.C., Ermiş Ç., Güderer İ., Nemutlu E., Canlı S.D., Banerjee S. Glutamine withdrawal leads to the preferential activation of lipid metabolism in metastatic colorectal cancer. Transl. Oncol. 2024;48:102078. doi: 10.1016/j.tranon.2024.102078. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hamanaka R.B., O’Leary E.M., Witt L.J., Tian Y.F., Gökalp G.A., Meliton A.Y., Dulin N.O., Mutlu G.M. Glutamine metabolism is required for collagen protein synthesis in lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 2019;61:597–606. doi: 10.1165/rcmb.2019-0008OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Li X.Y., Zheng S.X., Wu G.Y. Nutrition and metabolism of glutamate and glutamine in fish. Amino Acids. 2020;52:671–691. doi: 10.1007/s00726-020-02851-2. [DOI] [PubMed] [Google Scholar]
  • 11.Coutinho F., Castro C., Palomares E.R., Grande B.O., Gallardo M.A., Teles A.O., Peres H. Dietary glutamine supplementation effects on amino acid metabolism, intestinal nutrient absorption capacity and antioxidant response of gilthead sea bream (Sparus aurata) juveniles. Comp. Biochem. Phys. A. 2016;191:9–17. doi: 10.1016/j.cbpa.2015.09.012. [DOI] [PubMed] [Google Scholar]
  • 12.Tian H.Y., Xiao L.F., Lin C.X., Lin F., Sun T., Fang K., Jiang W.Y., Wen X.B. Effects of dietary glutamine on growth performance, antioxidant capacity, and swim bladder collagen deposition in chu’s croaker (Nibea coibor) Aquac. Rep. 2025;45:103140. doi: 10.1016/j.aqrep.2025.103140. [DOI] [Google Scholar]
  • 13.Wang R.Y., Yuan X., Xie T., Zhao X., Li J.Y., Zhang X.H., Lv C.Z. The endogenous glutamatergic transmitter system promotes collagen synthesis in cardiac fibroblasts under hypoxia. Front. Cardiovasc. Med. 2025;12:1638650. doi: 10.3389/fcvm.2025.1638650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Deng Z.Q., Fan T., Xiao C., Tian H., Zheng Y.J., Li C.X., He J. TGF-β signaling in health, disease, and therapeutics. Signal Transduct. Target. Ther. 2024;9:61. doi: 10.1038/s41392-024-01764-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Rong H., Zhang H.R., Ning L.J., Wu K., Limbu S.M., Shi Q.C., Qin C.J., Wen X.B. The transforming growth factor beta (TGF-β/Smads) pathway regulates collagen synthesis and deposition in swim bladder of Chu’s croaker (Nibea coibor) stimulated by proline. Aquaculture. 2022;558:738360. doi: 10.1016/j.aquaculture.2022.738360. [DOI] [Google Scholar]
  • 16.Xia Y., Yu E.M., Li Z.F., Zhang K., Tian J.J., Wang G.J., Xie J., Gong W.B. Both TGF-β1 and Smad4 regulate type I collagen expression in the muscle of grass carp, Ctenopharyngodon Idella. Fish Physio Biochem. 2021;47:907–917. doi: 10.1007/s10695-021-00941-w. [DOI] [PubMed] [Google Scholar]
  • 17.Carvalho P.L.P.F., Xavier W.D.S., Guimarães M.G., Rodrigues E.J.D., Furuya W.M., Yamamoto F.Y., Pezzato L.E., Gatlin D.M., Barros M.M. Dietary glutamine improves growth and intestinal morphology of juvenile GIFT tilapia (Oreochromis niloticus) but has limited effects on innate immunity and antioxidant capacity. Aquaculture. 2023;536:738976. doi: 10.1016/j.aquaculture.2022.738976. [DOI] [Google Scholar]
  • 18.Trackman P.C. Diverse biological functions of extracellular collagen processing enzymes. J. Cell. Biochem. 2005;96:927–937. doi: 10.1002/jcb.20605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lin Y.J., Chen P., Pan M.Z., Qin G.C., Wu Z.H., Jiang W.D., Han D., Mai K.S., Zhang W.B. Role of timp2 in Ctenopharyngodon idellus muscle collagen deposition and the regulatory mechanism by Cu2+ Food Chem. Mol. Sci. 2025;11:100306. doi: 10.1016/j.fochms.2025.100306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mizuta S., Asano C., Yokoyama Y., Taniguchi M. Molecular species of collagen in muscular and vertebral parts of white sturgeon Acipenser transmontanus. Fish. Sci. 2012;78:399–406. doi: 10.1007/s12562-011-0443-7. [DOI] [Google Scholar]
  • 21.Dong M., Zhang L., Wu P., Feng L., Jiang W.D., Liu Y., Kuang S.Y., Li S.W., Mi H.F., Tang L., et al. Dietary protein levels changed the hardness of muscle by acting on muscle fiber growth and the metabolism of collagen in sub-adult grass carp (Ctenopharyngodon idella) J. Anim. Sci. Biotechnol. 2022;13:109. doi: 10.1186/s40104-022-00747-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhu L., Yu H., Liu S.Y., Xiao X.S., Dong W.H., Chen Y.N., Xu W., Zhu T. Prognostic value of tissue inhibitor of metalloproteinase-2 expression in patients with non-small cell lung cancer: A systematic review and meta-analysis. PLoS ONE. 2015;10:e0124230. doi: 10.1371/journal.pone.0124230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Li L.Y., Zhao Y.Q., He H., Chi C.F., Wang B. Physicochemical and antioxidant properties of acid- and pepsin-soluble collagens from the scales of miiuy croaker (Miichthys Miiuy) Mar. Drugs. 2018;16:394. doi: 10.3390/md16100394. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Dong H.B., Chen J.W., Li Y.J., Wang C., Jiao C.Y., Wang L.Q. Influence of liquid nitrogen pre-freezing and drying methods on the collagen content, physical properties, and flavor of fish swim bladder. Foods. 2024;13:2790. doi: 10.3390/foods13172790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Roberts A.B., Sporn M.B., Assoian R.K., Smith J.M., Roche N.S., Wakefield L.M., Heine U.I., Liotta L.A., Falanga V., Hehrl J.H. Transforming growth factor type beta: Rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. USA. 1986;83:4167–4171. doi: 10.1073/pnas.83.12.4167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Varga J., Pasche B. Transforming growth factor beta as a therapeutic target in systemic sclerosis. Nat. Rev. Rheumatol. 2009;5:200–206. doi: 10.1038/nrrheum.2009.26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shen J., Wang Z.P., Zhao W.M., Fu Y.F., Li B.X., Cheng J.H., Deng Y.F., Li S.J., Li H. TGF-β1 induces type I collagen deposition in granulosa cells via the AKT/GSK-3β signaling pathway-mediated MMP1 down-regulation. Reprod. Biol. 2022;22:100705. doi: 10.1016/j.repbio.2022.100705. [DOI] [PubMed] [Google Scholar]
  • 28.Hirose T., Nakazato K., Song H.S., Ishii N. TGF-β1 and TNF-α are involved in the transcription of type I collagen α2 gene in soleus muscle atrophied by mechanical unloading. J. Appl. Physiol. 2008;104:107–177. doi: 10.1152/japplphysiol.00463.2006. [DOI] [PubMed] [Google Scholar]
  • 29.Derynck R., Zhang Y.E. Smad-dependent and Smad-independent pathways in TGF-β family signalling. Nature. 2003;425:577–584. doi: 10.1038/nature02006. [DOI] [PubMed] [Google Scholar]
  • 30.Zhao D., Shi Y.L., Dang Y.Y., Zhai Y.M., Ye X.Y. Daidzein stimulates collagen synthesis by activating the TGF-β/smad signal pathway. Australas. J. Dermatol. 2015;56:e7–e14. doi: 10.1111/ajd.12126. [DOI] [PubMed] [Google Scholar]
  • 31.Yu E.M., Ma L.L., Ji H., Li Z.F., Wang G.J., Xie J., Yu D.G., Kaneko G., Tian J.J., Zhang K., et al. Smad4-dependent regulation of type I collagen expression in the muscle of grass carp fed with faba bean. Gene. 2019;685:32–41. doi: 10.1016/j.gene.2018.10.074. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All data are contained within the article.

Articles from Animals : an Open Access Journal from MDPI are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES